Compositions and methods for treating retinal diseases

Abstract

The present invention relates, inter alia, to a method of treating retinal disease using a splicing modulator, such as an antisense oligonucleotide, capable of inducing natural splicing of exon 6 of mutant nuclear receptor subfamily group 2 E member 3 (NR2E3) pre-mRNA. The invention also provides a composition containing the splicing modifier and application of the composition.

Description

[0001] Reference to Electronic Sequence Listing

[0002] The entire contents of the Electronic Sequence Listing (SKIP-P-002-PCT ST26.xml; size: 32,896 bytes; creation date: October 11, 2023) are incorporated herein by reference.

[0003] Cross-Reference to Related Applications

[0004] This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 426,077, entitled "Compositions and Methods for Treating Retinal Diseases," filed on November 17, 2022, the entire contents of which are incorporated herein by reference. Technical Field

[0005] The present invention relates to the field of antisense oligonucleotides and their therapeutic uses. Background Art

[0006] Recently, restoration of gene function in genetic disorders has been achieved by modulating the splicing of mutant genes using antisense oligonucleotides (ASOs). ASOs are single-stranded, chemically modified nucleic acids that bind to the pre-mRNA of a target gene and alter splicing in a manner that can restore gene function. For example, Nusinersen is an ASO-based drug that alters the splicing pattern of SMN2 and has been successfully used to treat spinal muscular atrophy (SMA, Parkash 2107; Gene Ther). Another example is Milasen, a "N = 1" drug in which an ASO was developed to effectively restore the correct splicing of a unique mutation in the MFSD8 gene that causes Batten disease (Kim et al., 2019; N Engl J Med).

[0007] Defects in the nuclear receptor subfamily 2 group E member 3 (NR2E3) gene result in a series of hereditary retinal disorders, including enhanced S cone syndrome (ESCS), retinitis pigmentosa, Goldmann-Favre syndrome (GFS), and clumped pigmentary retinal degeneration (CPRD) (Mollema and Haider 2010; Exp Eye Res). NR2E3 is a member of the nuclear receptor superfamily that regulates transcription in a ligand-dependent manner. The expression of NR2E3 is restricted to the middle retinal photoreceptors in humans and may function in multiple capacities: 1) as an activator that guides the differentiation of postmitotic cells into rod cells; 2) as a repressor that affects the competence of retinal progenitor cells and retinal development; and 3) as a regulator of phototransduction in adult rod and cone cells (Mollema and Haider 2010; Exp Eye Res).

[0008] A relatively common pathogenic mutation in NR2E3 is c.932G>A (p.Arg311Gln) (Bandah et al., 2009; Arch Ophthalmol, ClinVar ID: 5532). This mutation is classified as a missense variant, which means it causes the arginine residue at position 311 to change to a glutamine residue. The mechanism by which this change results in an overt disease phenotype is not fully understood (see Roduit et al., 2009; PLoS One, which demonstrated that this residue change does not affect homodimerization, interaction with the CRX corepressor, and DNA binding).

[0009] There remains a great need for compounds suitable for treating or improving retinal diseases, particularly in subjects carrying the c.932G>A mutation. SUMMARY OF THE INVENTION

[0010] In some embodiments, the present invention relates to a method of splicing to regulate the NR2E3 gene, thereby eliminating or reducing the impact of pathogenic mutations.

[0011] In some embodiments, the present invention is at least partially based on the discovery that the c.932G>A mutation triggers aberrant splicing of the NR2E3 transcript, resulting in an in-frame deletion of 186 bases in exon 6 (corresponding to 62 amino acids in the protein product encoded by the NR2E3 transcript). Accordingly, the inventors propose using splice-shifting / modifying antisense oligonucleotides (ASOs) to restore the native and / or proper splicing of the NR2E3 transcript, thereby restoring the function of the protein product encoded thereby.

[0012] According to one aspect, a method of treating a retinal disease in a subject in need thereof is provided, the method comprising administering to the subject a therapeutically effective amount of at least one synthetic antisense oligonucleotide (ASO), wherein the ASO induces nucleotides at positions 748-933 of the nuclear receptor subfamily 2 group E member 3 (NR2E3) pre-mRNA, thereby treating the retinal disease in the subject.

[0013] According to another aspect, a composition is provided that comprises an ASO that comprises 14 to 25 bases and has at least 80% complementarity with the NR2E3 pre-mRNA, and is characterized by inducing nucleotides at positions 748-933 of the NR2E3 pre-mRNA.

[0014] A method for producing a compound suitable for treating a retinal disease, the method comprising a compound that binds to exon 6 of the NR2E3 pre-mRNA, determining nucleotides at positions 748-933 of the NR2E3 pre-mRNA in the presence of the compound, and selecting at least one compound that induces nucleotides at positions 748-933 of the NR2E3 pre-mRNA.

[0015] In some embodiments, the ASO comprises a backbone selected from the following: phosphoribose backbone, phosphodeoxyribose backbone, phosphorothioate deoxyribose backbone, 2'-O-methyl phosphorothioate backbone, phosphorodiamidate morpholino backbone, peptide nucleic acid backbone, 2-methoxyethyl phosphorothioate backbone, alternating locked nucleic acid backbone, phosphorothioate backbone, N3'-P5' phosphoramide, 2'-deoxy-2'-fluoro-β-D-arabinonucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclic DNA (tcDNA) nucleic acid backbone, and combinations thereof.

[0016] In some embodiments, the ASO comprises 14 to 25 bases.

[0017] In some embodiments, the ASO has at least 75% complementarity with an equi-length portion of a nucleic acid sequence derived from the following polynucleotide sequence: GTGATCCTGCTGGAAGAGGCGTGGAGTGAACTCTTTCTCCTCGGGGCCATCCAGTGGTCTCTGCCTCTGGACAGCTGTCCTCTGCTGGCACCGCCCGAGGCCTCTGCTGCCGGTGGTGCCCAGGGCCGGCTCACGCTGGCCAGCATGGAGACGCGTGTCCTGCAGGAAACTATCTCTCGGTTCCGGGCATTGGCGGTGGACCCCACGGAGTTTGCCTGCATGAAGGCCTTGGTCCTCTTCAAGCCAG (SEQ ID NO:1).

[0018] In some embodiments, the ASO has at least 75% complementarity with GCAGGAAACTATCTCTCGGTTCCAGGCATTGGCGGTGGACCCCACGGAGT (SEQ ID NO:2).

[0019] In some embodiments, the subject comprises at least one in-frame and / or missense mutation in exon 6 of NR2E3.

[0020] In some embodiments, the at least one mutation is c.932G>A.

[0021] In some embodiments, the ASO comprises a chemically modified backbone.

[0022] In some embodiments, the chemically modified backbone comprises: a phosphoribose backbone, a phosphodeoxyribose backbone, a phosphorothioate deoxyribose backbone, a 2'-O-methyl phosphorothioate backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2-methoxyethyl phosphorothioate backbone, an alternating locked nucleic acid backbone, a phosphorothioate backbone, an N3'-P5' phosphoramidate, a 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid, a cyclohexene nucleic acid backbone nucleic acid, a tricyclic DNA (tcDNA) nucleic acid backbone, and combinations thereof.

[0023] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0024] In some embodiments, it is used to induce nucleotides at positions 748-933 of the NR2E3 pre-mRNA in a subject in need thereof.

[0025] In some embodiments, the subject comprises a c.932G>A mutation in exon 6 of the NR2E3 pre-mRNA.

[0026] In some embodiments, the subject has or is at increased risk of having a retinal disease.

[0027] In some embodiments, the composition is used to treat or prevent a retinal disease in a subject in need thereof.

[0028] In some embodiments, the NR2E3 pre-mRNA comprises a c.932G>A mutation in exon 6.

[0029] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification (including definitions) shall prevail. In addition, the materials, methods, and examples are illustrative only and not necessarily restrictive.

[0030] From the detailed description given below, further embodiments and the full scope of applicability of the present invention will become apparent. However, it should be understood that the detailed description and specific examples are given by way of illustration only, since various changes and modifications within the spirit and scope of the present invention will become apparent to those skilled in the art from this detailed description. Brief Description of the Drawings

[0031] Figure 1A-1E Including micrographs, fluorescence micrographs, non-limiting diagrams, and chromatograms in HEK293 cells, which show that the abnormal splicing of NR2E3 pre-mRNA is caused by the p.Arg311Gln mutation. (1A) Gel electrophoresis of RT-PCR products obtained from HEK293 cells transfected with NR2E3 WT or NR2E3 p.Arg311Gln plasmids (flag-tagged). RT-PCR was performed using primers spanning exons 5, 6, and 7. (1B) Diagram showing abnormal splicing caused by the p.Arg311Gln mutation in exon 6. Sequencing of the lower band of the RT-PCR product of NR2E3 p.Arg311Gln confirmed the predicted abnormal splicing. (1C) Proteins were extracted from the cells 48 hours after transfection, and the lysates were analyzed by Western blot using an anti-flag antibody. Histone 3 (H3) was used as a loading control. (1D) Immunofluorescence staining with an anti-flag antibody showed a loss of nuclear localization of NR2E3 p.Arg311Gln compared to NR2E3WT. (1E) Non-limiting potential therapeutic correction strategy - using ASO to block abnormal splicing and attempt to restore natural and proper splicing.

[0032] Figure 2A-2CIncluding images, photographs, and vertical bar graphs showing the identification of ASOs that block the aberrant splicing caused by the c.932G>A mutation in NR2E3 and restore normal splicing. (2A) Snapshot image from the UCSC browser showing the genomic locations of exon 6 of the NR2E3 gene and ASOs 1-16 (SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33). The position of the NR2E3 c.932G>A mutation is marked with a vertical solid line. The gray shading indicates the remaining part of exon 6 with aberrant splicing due to the mutation. (2B) Mini-screening of ASOs targeting NR2E3 exon 6. Sixteen ASOs were evaluated in HEK293 cells transfected with the NR2E3 c.932G>A plasmid. RT-PCR results were shown using primers for exons 5 and 7 (lower panel) (forward sequence: 5'-CCCCTCCTCTCCATACTCCT-3' (SEQ ID NO: 34), reverse sequence: 5'-CCTCTACGTGCTCAGGATCC-3'; (SEQ ID NO: 35)). Ctrl - antisense control (TTAGTTTAATCACGCTCG; (SEQ ID NO: 36)). pWT - plasmid expressing NR2E3 WT . (2C) Western blot and densitometric analysis confirmed that ASO-2 (SEQ ID NO: 4) corrected the aberrant splicing at the protein level. GAPDH was used as a loading control.

[0033] Figure 3A-3C Including fluorescence micrographs, photographs, and vertical bar graphs showing that ASO treatment corrected the subcellular localization of mutant NR2E3 c.932G>A protein and rhodopsin (RHO) promoter activation. (3A) Immunofluorescence staining in HeLa cells after transfection with plasmids and ASO treatment. (3B) Western blot analysis of nuclear-cytoplasmic fractionation in HEK293 cells transfected with plasmids and treated with ASOs (left panel). H3 and GAPDH were used to confirm correct nuclear-cytoplasmic fractionation. Right panel, densitometric quantification of the restored nuclear NR2E3, highlighted by a red dashed rectangle in the blot. (3C) Luciferase activity assay after ASO treatment (n = 4). All groups were transfected with the RHO reporter gene, CRX, and NRL. Ns - not significant. Ctrl-ASO control (as described above). Data are mean ± standard error *P<0.05; **P<0.01 (one-way ANOVA). Detailed Description of the Invention

[0034] Treatment Methods

[0035] According to some embodiments, a method for treating a retinal disease in a subject is provided. In some embodiments, the method comprises administering to the subject a therapeutically effective amount of a splicing regulator, wherein the splicing regulator induces endogenous splicing of exon 6 of the nuclear receptor subfamily 2 group E member 3 (NR2E3) pre-mRNA, thereby treating the retinal disease in the subject.

[0036] According to some embodiments, a method for inducing complete or full inclusion of exon 6 in the mature mRNA product of NR2E3 is provided.

[0037] According to some embodiments, a method for inducing inclusion of nucleotides 748 - 933 of exon 6 of NR2E3 pre-RNA in the mature mRNA product of NR2E3 is provided.

[0038] As used herein, the term "complete or full inclusion of exon 6" refers to a spliced or mature mRNA of the NR2E3 product that includes nucleotides 1 - 186 of exon 6.

[0039] In some embodiments, complete or full inclusion of exon 6 results in a spliced or mature mRNA of the NR2E3 product that includes nucleotides 1 - 1240 of the NR2E3 mRNA.

[0040] In some embodiments, complete or full inclusion of exon 6 results in a spliced or mature mRNA of the NR2E3 product that includes at least 1200, at least 1210, at least 1220, or at least 1230 nucleotides, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.

[0041] In some embodiments, the protein product encoded by the spliced or mature mRNA of the NR2E3 gene that completely or fully includes exon 6 obtained from this application comprises 410 amino acids. In some embodiments, the protein product comprises the amino acids encoded by positions 1 - 186 of exon 6 of the NR2E3 mRNA. In some embodiments, the protein product comprises amino acids at positions 250 - 311. In some embodiments, as disclosed herein, the mutant NR2E3 gene is transcribed into mRNA in which exon 6 is partially excluded, resulting in the NR2E3 protein lacking the amino acids at positions 250 - 311 of the wild-type NR2E3 protein.

[0042] In some embodiments, the protein product comprises a substitution of arginine to glutamine at position 311 of the protein.

[0043] In some embodiments, the spliced or mature mRNA of the NR2E3 gene obtained according to the present application comprises at least 1200, at least 1210, at least 1220, or at least 1230 nucleotides, or any value and range therebetween, and a G932A substitution. Each possibility represents a separate embodiment of the invention.

[0044] According to some embodiments, a method is provided for repressing or inhibiting the exclusion of a portion of exon 6 of the NR2E3 pre-RNA from the mature mRNA product of NR2E3.

[0045] According to some embodiments, a method is provided for repressing or inhibiting the exclusion of nucleotides at positions 748-933 of the NR2E3 pre-RNA from the mature mRNA product of NR2E3.

[0046] In some embodiments, endogenous splicing of exon 6 includes the inclusion of exon 6 in the mature mRNA product of NR2E3.

[0047] In some embodiments, the splicing regulator induces the complete or full inclusion of exon 6 in the mature mRNA product of NR2E3.

[0048] In some embodiments, the splicing regulator induces the inclusion of nucleotides at positions 748-933 of the mature mRNA product of NR2E3.

[0049] In some embodiments, the splicing regulator is capable of binding to the pre-mRNA of the NR2E3 gene and inducing or promoting the complete or full inclusion of exon 6 in the mature NR2E3 mRNA.

[0050] In some embodiments, the splicing regulator is capable of binding to the pre-mRNA of the NR2E3 gene and inducing or promoting the inclusion of nucleotides at positions 748-933 of the mature NR2E3 mRNA.

[0051] In some embodiments, the splicing regulator is capable of binding to the pre-mRNA of the NR2E3 gene and repressing the exclusion of nucleotides at positions 748-933 of the mature NR2E3 mRNA.

[0052] In some embodiments, the nucleotides at positions 748-933 of the mature NR2E3 mRNA are located in exon 6 of the NR2E3 pre-mRNA.

[0053] In some embodiments, the retinal disease is or includes a hereditary retinal disease.

[0054] In some embodiments, the retinal disease is a hereditary retinal disease.

[0055] In some embodiments, the inherited retinal disease is induced by or involves a mutation that induces at least partial exclusion of exon 6 of NR2E3 mRNA.

[0056] In some embodiments, the inherited retinal disease is induced by or involves a mutation that induces at least partial exclusion of nucleotides 748 - 933 of NR2E3 mRNA.

[0057] In some embodiments, the inherited retinal disease is induced by or involves a mutation that results in an NR2E3 protein that is shorter compared to the wild - type NR2E3 protein.

[0058] In some embodiments, the short NR2E3 protein comprises 348 amino acids. In some embodiments, the short NR2E3 protein lacks or loses 62 amino acids encoded by nucleotides 748 - 933 of NR2E3 mRNA.

[0059] In some embodiments, the wild - type NR2E3 protein comprises 410 amino acids.

[0060] In some embodiments, the method comprises administering a splicing modulator, which is at least one synthetic antisense oligonucleotide (ASO).

[0061] In some embodiments, the ASO is chemically modified. In some embodiments, the chemical modification is a modification of the backbone of the ASO. In some embodiments, the chemical modification is a modification of the sugar of the ASO. In some embodiments, the chemical modification is a modification of the nucleobase of the ASO. In some embodiments, the chemical modification increases the stability of the ASO in cells. In some embodiments, the chemical modification increases the stability of the ASO in vivo. In some embodiments, the chemical modification increases the ability of the ASO to regulate splicing. In some embodiments, the chemical modification increases the ability of the ASO to induce complete or full inclusion of exon 6 of the NR2E3 pre-mRNA. In some embodiments, the chemical modification increases the ability of the ASO to induce inclusion of nucleotides at positions 748-933 of the NR2E3 pre-mRNA. In some embodiments, the chemical modification increases the ability of the ASO to repress exclusion of nucleotides at positions 748-933 from the mature NR2E3 mRNA. In some embodiments, the chemical modification increases the half-life of the ASO. In some embodiments, the chemical modification inhibits polymerase extension from the 3' end of the ASO. In some embodiments, the chemical modification inhibits polymerase recognition of the ASO. In some embodiments, the chemical modification inhibits duplex-triggered degradation. In some embodiments, the chemically modified ASO does not trigger degradation of the nucleic acid duplex when binding to the NR2E3 pre-mRNA. In some embodiments, the chemical modification inhibits RISC-mediated degradation. In some embodiments, the chemical modification inhibits RISC-mediated degradation or any parallel nucleic acid degradation pathway.

[0062] In some embodiments, the ASO lacks a label moiety. In some embodiments, the ASO is unlabeled. In some embodiments, the ASO does not emit a detectable signal or does not contain a moiety that can be recognized for nucleic acid detection (e.g., digoxin and a fluorescently labeled anti-DIG antibody). In some embodiments, the detectable signal includes a dye or emitted energy that provides detection of a compound (e.g., polynucleotide) in vivo or in vitro. In some embodiments, the detectable signal includes: a fluorescent signal, a chromatic signal, or a radioactive signal.

[0063] In some embodiments, the ASO lacks radiolabeled nucleobases; digoxin, streptavidin, biotin, fluorophores, hapten labels, CLICK labels, amine labels, or thiol labels.

[0064] In some embodiments, the chemical modification is selected from: a phosphoribose backbone, a phosphodeoxyribose backbone, a phosphorothioate deoxyribose backbone, a 2'-O-methyl phosphorothioate backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2-methoxyethyl phosphorothioate backbone, an alternating locked nucleic acid backbone, a phosphorothioate backbone, an N3'-P5' phosphoramide, a 2'-deoxy-2'-fluoro-β-D-arabinonucleic acid, a cyclohexene nucleic acid backbone, a tricyclic DNA (tcDNA) nucleic acid backbone, or any combination thereof.

[0065] In some embodiments, the ASO comprises at least 14 bases, at least 15 bases, at least 16 bases, at least 17 bases, at least 18 bases, at least 19 bases, at least 20 bases, at least 21 bases, at least 22 bases, at least 23 bases, at least 24 bases, or at least 25 bases, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.

[0066] In some embodiments, the ASO comprises 14 to 30 bases, 14 to 28 bases, 14 to 26 bases, 14 to 24 bases, 14 to 21 bases, 14 to 19 bases, 14 to 18 bases, or 14 to 17 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO comprises 17 to 22 bases.

[0067] In some embodiments, the ASO is complementary to exon 6 of NR2E3 pre-mRNA.

[0068] In some embodiments, exon 6 of NR2E3 pre-mRNA comprises the following sequence: GTGATCCTGCTGGAAGAGGCGTGGAGTGAACTCTTTCTCCTCGGGGCCATCCAGTGGTCTCTGCCTCTGGACAGCTGTCCTCTGCTGGCACCGCCCGAGGCCTCTGCTGCCGGTGGTGCCCAGGGCCGGCTCACGCTGGCCAGCATGGAGACGCGTGTCCTGCAGGAAACTATCTCTCGGTTCCGGGCATTGGCGGTGGACCCCACGGAGTTTGCCTGCATGAAGGCCTTGGTCCTCTTCAAGCCAG (SEQ ID NO:1).

[0069] In some embodiments, the ASO is complementary to an equally long portion of a nucleic acid sequence derived from a polynucleotide sequence that comprises or consists of: GCAGGAAACTATCTCTCGGTTCCAGGCATTGGCGGTGGACCCCACGGAGT (SEQ ID NO:2).

[0070] In some embodiments, the ASO has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% complementarity with an equally long portion of a nucleic acid sequence derived from SEQ ID NO: 1-2, any value and range therebetween. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO has 70-80%, 75-85%, 80-90%, 85-95%, 90-99% or 95-100% complementarity with an equally long portion of a nucleic acid sequence derived from SEQ ID NO: 1-2. Each possibility represents a separate embodiment of the invention.

[0071] The term "complementary" refers to the ability of polynucleotides to form base pairs with each other. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair in the Watson-Crick manner (e.g., A with T, A with U, C with G) or in any other manner that permits the formation of a duplex. As is known to those skilled in the art, when RNA is used instead of DNA, uracil rather than thymine is the base considered complementary to adenosine. However, when U is represented in the context of the present invention, the ability to substitute T is implied unless otherwise stated.

[0072] In some embodiments, the ASO comprises the following nucleic acid sequences: ACCGAGAGATAGTTTCCTGC (SEQ ID NO:3); AACCGAGAGATAGTTTCCTG (SEQ ID NO:4); GAACCGAGAGATAGTTTCCT (SEQ ID NO:5); GGAACCGAGAGATAGTTTCC (SEQ ID NO:6); TGGAACCGAGAGATAGTTTC (SEQ ID NO:7); CTGGAACCGAGAGATAGTTT (SEQ ID NO:8); CCTGGAACCGAGAGATAGTT (SEQ ID NO:9); GCCTGGAACCGAGAGATAGT (SEQ ID NO:10); TGCCTGGAACCGAGAGATAG (SEQ ID NO:11); ATGCCTGGAACCGAGAGATA (SEQ ID NO:12); AATGCCTGGAACCGAGAGAT (SEQ ID NO:13); CAATGCCTGGAACCGAGAGA (SEQ ID NO:14); CCAATGCCTGGAACCGAGAG (SEQ ID NO:15); GCCAATGCCTGGAACCGAGA (SEQ ID NO:16); CGCCAATGCCTGGAACCGAG (SEQ ID NO:17); CCGCCAATGCCTGGAACCGA (SEQ ID NO:18); ACCGCCAATGCCTGGAACCG (SEQ ID NO:19); CACCGCCAATGCCTGGAACC (SEQ ID NO:20); CCACCGCCAATGCCTGGAAC (SEQ ID NO:21); TCCACCGCCAATGCCTGGAA (SEQ ID NO:22); GTCCACCGCCAATGCCTGGA (SEQ ID NO:23); GGTCCACCGCCAATGCCTGG (SEQ ID NO:24); GGGTCCACCGCCAATGCCTG (SEQ ID NO:25); GGGGTCCACCGCCAATGCCT (SEQ ID NO:26); TGGGGTCCACCGCCAATGCC (SEQ ID NO:27); GTGGGGTCCACCGCCAATGC (SEQ ID NO:28); CGTGGGGTCCACCGCCAATG (SEQ ID NO:29); CCGTGGGGTCCACCGCCAAT (SEQ ID NO:30);TCCGTGGGGTCCACCGCCAA (SEQ ID NO:31); CTCCGTGGGGTCCACCGCCA (SEQ ID NO:32); or ACTCCGTGGGGTCCACCGCC (SEQ ID NO:33).;

[0073] In some embodiments, the pre-mRNA is wild-type pre-mRNA. In some embodiments, the pre-mRNA is mutant pre-mRNA. In some embodiments, the NR2E3 pre-mRNA comprises any one of SEQ ID NOs: 1-2. In some embodiments, the ASO is complementary to a nucleic acid sequence comprising any one of SEQ ID NOs: 1-2.

[0074] In some embodiments, the ASO comprises an active fragment of any one of SEQ ID NOs: 3-33.

[0075] As used herein, the term "active fragment" refers to a fragment that is 100% identical to a contiguous portion of the full nucleotide sequence of the ASO, provided that at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the activity of the original ASO nucleotide sequence is retained, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.

[0076] In some embodiments, the ASO is specific for the NR2E3 pre-mRNA.

[0077] As used herein, the term "specific" refers to base pair specificity and gene specificity. In some embodiments, the ASO is specific for the NR2E3 gene. In some embodiments, the ASO is specific for a splicing activation motif in NR2E3. In some embodiments, the ASO is specific for a splicing activation region of NR2E3. In some embodiments, the splicing activation is part of or a partial splicing activation of exon 6 of NR2E3.

[0078] In some embodiments, the ASO binds to the NR2E3 pre-mRNA with perfect complementarity. In some embodiments, the ASO does not bind to any gene or its pre-mRNA product with perfect complementarity, except for NR2E3. In some embodiments, the ASO does not bind to any gene or its pre-mRNA product with a complementarity greater than 70, 75, 80, 85, 90, 95, 97, 99, or 100%, except for NR2E3. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO does not bind to any gene or its pre-mRNA product with a complementarity greater than 90%, except for NR2E3. In some embodiments, the ASO binds to any one of SEQ ID NO: 1-2 with perfect complementarity. In some embodiments, the ASO does not bind to any sequence other than SEQ ID NO: 1-2 with a complementarity greater than 70, 75, 80, 85, 90, 95, 97, 99, or 100%. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO does not bind to any sequence other than SEQ ID NO: 1-2 with a complementarity greater than 90%. In some embodiments, the ASO does not bind anywhere in the genome or transcriptome (including the pre-transcriptome, e.g., a transcriptome containing or consisting of pre-mRNA) of a cell other than within NR2E3 with perfect complementarity. In some embodiments, the ASO does not bind anywhere in the genome or transcriptome (including the pre-transcriptome, e.g., a transcriptome containing or consisting of pre-mRNA) of a cell other than within NR2E3 with a complementarity greater than 70, 75, 80, 85, 90, 95, 97, 99, or 100%. Each possibility represents a separate embodiment of the invention. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammal is a human.

[0079] In some embodiments, the ASO modulates the expression of NR2E3. In some embodiments, the ASO modulates the splicing of NR2E3. In some embodiments, the ASO modulates the splicing of exon 6 of NR2E3. In some embodiments, the ASO does not cause off-target effects. In some embodiments, off-target refers to targets other than NR2E3. In some embodiments, off-target is a target other than the splicing of exon 6 of NR2E3. In some embodiments, the ASO substantially or significantly does not modulate the expression of genes other than NR2E3. In some embodiments, the ASO substantially or significantly does not modulate the splicing of genes other than NR2E3. In some embodiments, the ASO substantially or significantly does not modulate the splicing of exons other than exon 6 of NR2E3. In some embodiments, substantial (substantially) modulation of expression is a change in expression of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50%. Each possibility represents a separate embodiment of the invention. In some embodiments, substantial modulation of expression is a change in expression of at least 20%.

[0080] In some embodiments, the ASO is complementary to the exon-intron junction. In some embodiments, the exon is exon 6 of the NR2E3 pre-mRNA. In some embodiments, the ASO is complementary to an aberrant splicing junction present within exon 6 of the NR2E3 pre-mRNA. In some embodiments. The aberrant splicing junction within exon 6 of NR2E3 includes a substitution or mutation of G932A of the NR2E3 gene.

[0081] In some embodiments, the ASO disclosed herein is complementary to the aberrant splicing junction by at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100%, or any value and range therebetween. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO is complementary to the aberrant splicing junction disclosed herein by 70-85%, 80-90%, 85-95%, 90-99%, or 95-100%. Each possibility represents a separate embodiment of the invention.

[0082] In some embodiments, the ASO disclosed herein targets, complements, induces (or any combination thereof) exon 6 of the NR2E3 pre-mRNA that completely or fully contains the transcript from the mutant allele of the NR2E3 gene.

[0083] In some embodiments, the ASO disclosed herein targets, complements, induces (or any combination thereof) nucleotides 748 to 933 of exon 6 of the NR2E3 pre-mRNA that contains the transcript from the mutant allele of the NR2E3 gene.

[0084] In some embodiments, a subject comprises or is characterized by having a genome that comprises at least one mutation in exon 6 of NR2E3 such that the NR2E3 protein is partially or completely non-functional.

[0085] In some embodiments, a subject comprises or is characterized by having a genome that comprises at least one mutation in exon 6 of NR2E3, resulting in the splicing out and exclusion of nucleotides 748 to 933 of exon 6 of the NR2E3 pre-mRNA transcribed therefrom.

[0086] In some embodiments, the substitutions or mutations disclosed herein are in-frame mutations. In some embodiments, the substitutions or mutations disclosed herein are missense mutations.

[0087] In some embodiments, at least one mutation is c.932G>A (also referred to herein as the "G932A substitution").

[0088] In some embodiments, the mutations disclosed herein provide an arginine-to-glutamine substitution.

[0089] As used herein, "mutation" refers to a nucleotide substitution or modification that induces or causes a "retinal disease" in a subject carrying or comprising the mutation.

[0090] As used herein, the term "retinal disease" includes any symptom or manifestation associated with a disease involving the retina. Methods for diagnosing retinal diseases and / or symptoms associated therewith are common and will be apparent to those of ordinary skill in the art.

[0091] In some embodiments, the method involves improving at least one clinical parameter of a retinal disease in a subject.

[0092] As used herein, the terms "treatment" or "treating" a disease, disorder or condition include alleviating at least one of its symptoms, reducing its severity or inhibiting its progression. Treatment does not necessarily mean that the disease, disorder or condition is completely cured. For a composition to be an effective treatment, it need only reduce the severity of the disease, disorder or condition, reduce the severity of the symptoms associated therewith, or provide an improvement in the quality of life of the patient or subject.

[0093] As used herein, the term "condition" includes anatomic and physiologic deviations from the normal that constitute an impairment of the normal state of a living animal or one of its parts, thereby interrupting or altering the manifestation of body functions.

[0094] As used herein, the terms "subject" or "individual" or "animal" or "patient" or "mammal" refer to any subject in need of therapy, particularly a mammalian subject such as a human.

[0095] In some embodiments, a method for treating a retinal disease in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a synthetic antisense oligonucleotide (ASO), wherein the ASO induces complete or full inclusion of exon 6 of NR2E3 pre-mRNA, thereby treating the retinal disease in the subject.

[0096] In some embodiments, the ASO induces inclusion of nucleotides at positions 748-933 of NR2E3 pre-mRNA, thereby treating the retinal disease in the subject.

[0097] In some embodiments, a method for treating a retinal disease in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a synthetic antisense oligonucleotide (ASO), wherein the ASO inhibits exclusion of a portion of exon 6 from NR2E3 pre-mRNA, thereby treating the retinal disease in the subject.

[0098] In some embodiments, the ASO represses exclusion of nucleotides at positions 748-933 of NR2E3 pre-mRNA, thereby treating the retinal disease in the subject.

[0099] Composition

[0100] According to some embodiments, a composition comprising an ASO is provided, the ASO comprising 14 to 30 bases having at least 80% complementarity to NR2E3 pre-mRNA and characterized by inducing inclusion of nucleotides at positions 748-933 of NR2E3 pre-mRNA.

[0101] According to some embodiments, a composition comprising an ASO is provided, the ASO comprising 14 to 30 bases having at least 80% complementarity to NR2E3 pre-mRNA and characterized by repressing exclusion of nucleotides at positions 748-933 of NR2E3 pre-mRNA.

[0102] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0103] As used herein, the term "pharmaceutically acceptable carrier" refers to any standard pharmaceutical carrier known in the art, such as sterile solutions, tablets, coated tablets, and capsules. Generally, such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or its salts, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients. Such a carrier may also include flavor and color additives or other ingredients. Examples of pharmaceutically acceptable carriers include, but are not limited to, the following substances: water, saline, buffers, inert non-toxic solids (such as mannitol, talc). Compositions containing such carriers are formulated by well-known conventional methods. Depending on the intended mode of administration and intended use, the composition may be in the form of a solid, semi-solid or liquid dosage form, such as powders, granules, crystals, liquids, suspensions, liposomes, nanoparticles, nanoemulsions, pastes, creams, ointments, etc., or may be a unit dosage form suitable for relatively precise dosage administration.

[0104] In some embodiments, the pharmaceutical composition is formulated for systemic administration. In some embodiments, the pharmaceutical composition is formulated for administration to a subject. In some embodiments, the subject is a human subject. Those skilled in the art will understand that the pharmaceutical composition to be administered to a subject should not have off-target effects, such as effects other than the intended therapeutic effect. In some embodiments, the pharmaceutical composition has no substantial effect on genes other than NR2E3. In some embodiments, the pharmaceutical composition has no substantial effect on the splicing of exons other than exon 3 of NR2E3. In some embodiments, a substantial effect is an effect with a phenotypic outcome. In some embodiments, a substantial effect is a harmful effect. In some embodiments, harmful is with respect to the health and / or well-being of the subject.

[0105] In some embodiments, the composition is administered by a route selected from: topical administration, local administration, ocular administration, retinal administration, ophthalmic administration, systemic administration, intravitreal administration, or any combination thereof. In some embodiments, the composition is formulated for: topical administration, local administration, ocular administration, retinal administration, ophthalmic administration, systemic administration, intravitreal administration, or any combination thereof inhalation composition. In some embodiments, the ASO or the pharmaceutical composition containing the same as disclosed and described above is used to regulate the splicing of NR2E3 pre-mRNA transcribed from the NR2E3 gene having a mutant exon 6.

[0106] As used herein, the phrase "splicing modulation" refers to a change in the level of any RNA or mRNA variant that affects the production of native NR2E3 pre-mRNA, mutant pre-mRNA, or both.

[0107] In certain embodiments, it is used to increase the level of an mRNA molecule comprising nucleotides 748 - 933 of mutant exon 6.

[0108] In some embodiments, the ASO or a pharmaceutical composition comprising the same as disclosed and described above is used in a method for improving at least one clinical parameter of a retinal disease. In some embodiments, the ASO or a pharmaceutical composition comprising the same as disclosed and described above is used to treat a retinal disease.

[0109] Production method

[0110] According to some embodiments, a method for producing a compound suitable for treating a retinal disease is provided.

[0111] In some embodiments, the method comprises obtaining a compound that binds to exon 6 of NR2E3 pre - mRNA. In some embodiments, the method comprises assaying for the presence of exon 6 of NR2E3 pre - mRNA in the presence of the obtained compound. In some embodiments, the method comprises selecting at least one compound that induces exon 6 of NR2E3 pre - mRNA. In some embodiments, the inclusion is of nucleotides 748 - 933 of NR2E3 pre - mRNA.

[0112] In some embodiments, the method comprises obtaining a compound that binds to exon 6 of NR2E3 pre - mRNA, assaying for the presence of exon 6 of NR2E3 pre - mRNA in the presence of the obtained compound, and selecting at least one compound that induces exon 6 of NR2E3 pre - mRNA, thereby producing a compound suitable for treating a retinal disease.

[0113] In some embodiments, the method comprises obtaining a compound that binds to exon 6 of NR2E3 pre - mRNA, assaying for the presence of nucleotides 748 - 933 of NR2E3 pre - mRNA in the presence of the obtained compound, and selecting at least one compound that induces nucleotides 748 - 933 of NR2E3 pre - mRNA, thereby producing a compound suitable for treating a retinal disease.

[0114] In some embodiments, the assay is performed intracellularly. In some embodiments, the assay is performed in a subject. In some embodiments, the assay is performed in cells obtained or derived from a subject. In some embodiments, the assay is performed in cells within a subject.

[0115] In some embodiments, the assay is performed in vivo. In some embodiments, the assay is performed in vitro or ex vivo.

[0116] In some embodiments, the method comprises obtaining a compound that binds to SEQ ID NO:1 or SEQ ID NO:2.

[0117] In some embodiments, the compound is an ASO. In some embodiments, the ASO is an ASO as disclosed and described herein.

[0118] Methods for determining exon inclusion or exclusion are well-known. Non-limiting examples of such methods include, but are not limited to, PCR, qPCR, gene sequencing, RNA blotting, dot blotting, in situ hybridization, or other methods that would be apparent to one of ordinary skill in the art.

[0119] General Description

[0120] When a range of values is provided, it is to be understood that each intermediate value (to one-tenth of the unit of the lower limit) between the upper and lower limits of that range, as well as any other stated value or intermediate value within the range, is included within the invention, unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included within the smaller ranges and are also included within the invention, subject to any specifically excluded limitations within the stated range. Where the stated range includes one or both of the limits, the invention also includes ranges excluding one or both of those included limits.

[0121] As used herein, the term "about," when associated with a numerical value, refers to plus or minus 10% (±10%) of the reference value. For example, a length of about 1000 nanometers (nm) refers to a length of 1000 nm ± 100 nm.

[0122] It should be noted that, unless the context clearly dictates otherwise, the singular forms "a," "an," and "the" as used herein and in the appended claims include plural referents. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides, reference to "the polypeptide" includes reference to one or more polypeptides known to those skilled in the art and their equivalents, and so forth. It should also be noted that the claims may be drafted to exclude any optional elements. Thus, this statement is intended to serve as antecedent basis for use of such exclusive terms as "solely," "only," and the like in the recitation of claim elements or in the use of "negative" limitations.

[0123] In the case of using a convention similar to "at least one of A, B, and C, etc.", generally speaking, such a construction is in the sense that a person skilled in the art understands the meaning of this convention (for example, "a system having at least one of A, B, and C" will include, but not be limited to, a system having only A, only B, only C, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). A person skilled in the art will further understand that, whether in the specification, claims, or drawings, almost any disjunctive word and / or phrase presenting two or more alternative terms should be understood as considering the possibility of including one of the terms, either term, or both terms. For example, the phrase "A or B" will be understood as including the possibility of "A" or "B" or "A and B".

[0124] It should be understood that, for the sake of clarity, certain features of the present invention described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for the sake of brevity, the various features of the present invention described in the context of a single embodiment may also be provided separately or in any suitable sub-combination. All combinations of embodiments related to the present invention are specifically covered by the present invention and are disclosed herein as if each combination were separately and explicitly disclosed. In addition, all sub-combinations of various embodiments and their elements are also explicitly covered by the present invention and are disclosed herein as if each such sub-combination were separately and explicitly disclosed herein.

[0125] By examining the following embodiments, those of ordinary skill in the art will be clear about the additional objects, advantages, and novel features of the present invention, and these embodiments are not intended to be restrictive. In addition, each of the various embodiments and aspects of the present invention described above and claimed in the appended claims section is supported by experiments in the following embodiments.

[0126] The various embodiments and aspects of the present invention described above and claimed in the appended claims section are supported by experiments in the following embodiments.

[0127] Unless otherwise specified, all scientific and technical terms used herein have the meanings commonly used in the art. The definitions provided herein are for the convenience of understanding certain terms frequently used herein and do not mean to limit the scope of the present disclosure.

[0128] Before describing in detail the specific aspects and embodiments of the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, as these methods and conditions may vary. It should also be understood that the terms used herein are only for describing specific embodiments and are not intended to be restrictive, as the scope of the present invention will only be limited by the appended claims.

[0129] In the discussion, unless otherwise specified, adjectives such as "substantially" and "about" modifying a condition or relationship feature of one or more features of an embodiment of the present invention are understood to mean that the condition or feature is defined within the acceptable tolerances for the operation of the embodiment for its intended application. Unless otherwise specified, the word "or" in the specification and claims is considered inclusive rather than exclusive and means at least one or any combination of the items it connects.

[0130] It should be understood that the terms "a" and "an" as used above and elsewhere in this document refer to "one or more" of the recited components. It will be clear to those of ordinary skill in the art that, unless otherwise specifically stated, the use of the singular includes the plural. Thus, the terms "a", "an", and "at least one" may be used interchangeably in this application.

[0131] For a better understanding of the present teachings and without in any way limiting the scope of the teachings, unless otherwise specified, all numbers representing amounts, percentages, or ratios, as well as other numerical values used in the specification and claims should in all cases be understood to be modified by the term "about". Thus, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximations that may vary depending upon the desired characteristics sought. At the very least, each numerical parameter should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0132] In the specification and claims of this application, each of the verbs "comprise", "include", and "have" and their variations is used to indicate that one or more of the verb's objects are not necessarily a complete list of the components, elements, or parts of the verb's one or more subjects.

[0133] Other terms used herein are meant to be defined by their well-known meanings in the art.

[0134] Unless specifically stated or obvious from the context, the term "or" as used herein should be understood to be inclusive.

[0135] In this specification and claims, variations such as the words "comprise", "comprises", or "comprising" mean including any recited integer or group of integers, but do not exclude any other integer or group of integers.

[0136] As used herein, the term "consists essentially of", or variants such as "consist essentially of" or "consisting essentially of" as used throughout the specification and claims, means including any recited integer or group of integers, and optionally including any integer or group of integers that do not materially change the basic or novel properties of the specified method, structure, or composition.

[0137] As used herein, the terms "comprises", "comprising", "contains", "has", etc. may mean "includes" and "including", etc.; "consisting essentially of" or "consists essentially of" likewise has the meaning as defined by U.S. patent law, and this term is open-ended, allowing for more than what is recited, provided that the basic or novel characteristics of what is recited are not changed by the additional matter, but excluding prior art embodiments. In one embodiment, the terms "comprises", "comprising", "has" may be interchangeable with "consists of".

[0138] Although the present invention has been particularly described, those skilled in the art will understand that many variations and modifications can be made. Therefore, the present invention should not be construed as limited to the specifically described embodiments, and the scope and concept of the present invention will be more readily understood by reference to the appended claims.

[0139] Examples

[0140] Generally, the nomenclature used herein and the laboratory procedures used in the present invention include molecular, biochemical, microbial, and recombinant DNA techniques. These techniques are well explained in the literature. For example, see "Molecular Cloning: A Laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R.M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); the methods described in U.S. Patent Nos. 4,666,828, 4,683,202, 4,801,531, 5,192,659, and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J.E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N.Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-IIIColigan J.E., ed.(1994); Stites et al. (eds), “Basic and Clinical Immunology” (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), “Strategies for Protein Purification and Characterization – A Laboratory Course Manual” CSHL Press (1996); “Monoclonal Antibodies: Methods and Protocols”. Vincent Ossipow, Nicolas Fischer. Humana Press (2014); “Monoclonal Antibodies: Methods and Protocols”. Maher Albitar. Springer Science & Business Media (2007), all of which are incorporated herein by reference. Additional general references are provided in this document.

[0141] Example 1

[0142] Missense mutations in exon 6 of NR2E3 pre-mRNA induce inappropriate splicing impairing protein nuclear localization

[0143] The NR2E3 gene is located on chromosome 15 (15q23), contains 8 exons, spans approximately 7.7 kb of genomic DNA, and encodes a 410-amino acid protein. The c.932G>A mutation (chr15:71813573G>A, all genomic coordinates refer to the hg38 gene model) is located in exon 6, which encodes part of the ligand-binding domain (exon 6 genomic coordinates: chr15:71813389 - 71813635). Figure 1 shows the aberrant splicing of the NR2E3 gene caused by the c.932G>A mutation and potential strategies to restore the original splicing. Using plasmids, the inventors expressed wild-type (NR2E3 WT ) and mutant (NR2E3 c.932G>A)NR2E3. The plasmid was purchased from VectorBuilder encoding the transcript NM_014249.4 sequence, which includes all exons and introns of the gene (with or without the c.932G>A mutation), and is tagged with flag at the C-terminus. HEK293T cells were transfected with 1 μg of each plasmid (or control vector) using FuGene HD transfection reagent. Forty-eight (48) hours after transfection, RNA was extracted, reverse-transcribed into cDNA, and analyzed by polymerase chain reaction (PCR) using specific primers spanning exons 5 to 7. The PCR results showed that the c.932G>A mutation induced the expression of abnormal transcripts ( Figure 1A ). Sequencing of the PCR products revealed abnormal splicing in the mutant gene, and the exon started from position chr15:71813575 (c.934G). The WT exon started from position chr15:71813389), thus, the c.932G>A mutation resulted in the loss of 186 bases (75%) of exon 6 ( Figure 1B ). This result was further confirmed by Western blot (WB) analysis. Protein lysates were prepared 48 hours after transfection with protease / phosphatase inhibitor mixture in RIPA buffer. NR2E3 expression was analyzed by WB using a specific anti-flag antibody (Sigma#F1804). Compared with NR2E3 WT , the expression of NR2E3 c.932G>A protein was less and the size was smaller, indicating that the abnormally spliced NR2E3 c.932G>A transcript was translated into a shorter and unstable protein ( Figure 1C ). After transient transfection of the plasmid (48 hours) and expression, the inventors further tested the subcellular localization of NR2E3 c.932G>A in HEK293 cells by immunofluorescence. The NR2E3 WT and NR2E3 c.932G>A proteins were detected using an anti-flag antibody (Sigma-Aldrich#F1804), and the nuclei were stained with Hoechst 33342. The inventors showed that NR2E3 WT was clearly located within the nucleus (as expected for a transcription factor), while NR2E3 c.932G>A was characterized by less intense staining and mainly located outside the nucleus ( Figure 1D ).

[0144] Therefore, the inventors concluded that NR2E3 c.932G>AThe mutation results in abnormal splicing, which in turn may be associated with many pathological properties, including altering the subcellular localization of the translated protein. Based on these results, the inventors thus propose the use of ASOs to block the abnormal splicing of pre-mRNAs transcribed from the mutant gene in an attempt to restore normal splicing as a potential therapeutic strategy. Such ASOs can complement and / or target any region of exon 6 ± 50 bp upstream and / or downstream of the NR2E3 pre-mRNA transcript, which includes but is not limited to dozens of bases upstream and / or downstream thereof, as well as the c.932G>A mutation site ( Figure 1E ).

[0145] Example 2

[0146] Figure 2 depicts the design and results of an ASO screen that blocks the abnormal splicing of NR2E3 exon 6 and restores the original splicing. The inventors designed a screen of 16 ASOs targeting the NR2E3 exon 6 sequence, specifically the region defined by SEQ ID NO:2 ( Figure 2A ). Next, the inventors performed an ASO mini-screen using semi-quantitative PCR and identified two ASOs, ASO-2 and ASO-3 (SEQ ID NOs: 4 and 6, respectively), which significantly corrected the abnormal splicing and restored the expression of the full transcript ( Figure 2B ). In addition, the inventors confirmed that ASO-2 (SEQ ID NO: 4) corrected the abnormal splicing at the protein level using Western blot analysis ( Figure 2C ).

[0147] Example 3

[0148] Transplanted NR2E3 functions as a transcription factor, and thus, the inventors attempted to evaluate the nuclear localization of the mutant and ASO-2-treated / corrected isoforms and the activation of downstream target genes - Figure 3. The inventors evaluated the nuclear subcellular localization of NR2E3 by immunofluorescence in HEK293 cells after transient transfection of plasmids c.932G>A of the mutant protein and found that NR2E3 WT was clearly localized within the nucleus (as expected for a transcription factor), while NR2E3 c.932G>A was mainly located outside the nucleus, a feature that has been reported for several other NR2E3 mutations (PMID: 19898638). Treatment with ASO-2 (SEQ ID NO: 4) restored the nuclear expression of NR2E3 ( Figure 3A ). The inventors further confirmed this result using nuclear-cytoplasmic fractionation followed by Western blot analysis. Treatment with ASO-2 (SEQ ID NO: 4) corrected the abnormal splicing and restored the expression of NR2E3 protein in the nucleus ( Figure 3B)。To demonstrate that ASO-2 (SEQ ID NO:4) can restore the downstream activity of mutant NR2E3, the inventors evaluated the downstream transcriptional levels of rhodopsin, a well-established downstream target gene of NR2E3 (PMID:15689355). To this end, the inventors used transient transfection in HEK293 cells to establish a luciferase reporter gene controlled by the rhodopsin (RHO) promoter in the presence of its cofactors CRX and NRL (as described by Peng et al., 2005; Hum Mol Genet 2005 Mar 15;14(6):747-64)( Figure 3C ). Cells were additionally transfected with an equal amount of plasmid encoding eGFP to normalize transfection efficiency. First, the current results indicate that NR2E3 c.932G>A is unable to activate the transcription of the RHO promoter, while NR2E3 WT induces a 2-fold increase in RHO transcriptional activation. Treatment of NR2E3 with ASO-2 c.932G>A results in a complete rescue of RHO transcriptional activation( Figure 3C ), demonstrating the therapeutic potential of ASO-2 treatment.

[0149] Although the invention has been particularly described, those skilled in the art will understand that many changes and modifications can be made. Accordingly, the invention should not be construed as limited to the particularly described embodiments, and the scope and concept of the invention will be more readily understood by reference to the appended claims.

Claims

1. A method for treating a retinal disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of at least one synthetic antisense oligonucleotide (ASO), wherein the ASO induces nucleotides at positions 748 - 933 of the nuclear receptor subfamily 2 group E member 3 (NR2E3) pre-mRNA, thereby treating the retinal disease in the subject.

2. The method according to claim 1, wherein the ASO comprises a backbone selected from the following: phosphoribose backbone, phosphodeoxyribose backbone, phosphorothioate deoxyribose backbone, 2'-O-methyl phosphorothioate backbone, phosphorodiamidate morpholino backbone, peptide nucleic acid backbone, 2-methoxyethyl phosphorothioate backbone, alternating locked nucleic acid backbone, phosphorothioate backbone, N3'-P5' phosphoramide, 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclic DNA (tcDNA) nucleic acid backbone, and combinations thereof.

3. The method according to claim 1 or 2, wherein the ASO comprises 14 to 25 bases.

4. The method according to any one of claims 1 to 3, wherein the ASO has at least 75% complementarity with an equi-length portion of a nucleic acid sequence derived from the following polynucleotide sequence: GTGATCCTGCTGGAAGAGGCGTGGAGTGAACTCTTTCTCCTCGGGGCCATCCAGTGGTCTCTGCCTCTGGACAGCTGTCCTCTGCTGGCACCGCCCGAGGCCTCTGCTGCCGGTGGTGCCCAGGGCCGGCTCACGCTGGCCAGCATGGAGACGCGTGTCCTGCAGGAAACTATCTCTCGGTTCCGGGCATTGGCGGTGGACCCCACGGAGTTTGCCTGCATGAAGGCCTTGGTCCTCTTCAAGCCAG (SEQ ID NO:1).

5. The method according to any one of claims 1 to 4, wherein the ASO has at least 75% complementarity with GCAGGAAACTATCTCTCGGTTCCAGGCATTGGCGGTGGACCCCACGGAGT (SEQ ID NO:2).

6. The method according to any one of claims 1 to 5, wherein the subject comprises at least one in-frame and / or missense mutation in exon 6 of NR2E3.

7. The method according to claim 6, wherein the at least one mutation is c.932G>A.

8. A composition comprising an ASO, the ASO comprising 14 to 25 bases, the bases having at least 80% complementarity with NR2E3 pre-mRNA, and characterized by inducing nucleotides at positions 748 - 933 of the NR2E3 pre-mRNA.

9. The composition according to claim 8, wherein the ASO has at least 75% complementarity with SEQ ID NO:

2.

10. The composition according to claim 8 or 9, wherein the ASO comprises a chemically modified backbone.

11. The composition according to claim 10, wherein the chemically modified backbone comprises: Phosphoribose backbone, phosphodeoxyribose backbone, phosphorothioate deoxyribose backbone, 2'-O-methyl phosphorothioate backbone, phosphorodiamidate morpholino backbone, peptide nucleic acid backbone, 2-methoxyethyl phosphorothioate backbone, alternating locked nucleic acid backbone, phosphorothioate backbone, N3'-P5' phosphoramidate, 2'-deoxy-2'-fluoro-β-D-arabinonucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclic DNA (tcDNA) nucleic acid backbone, and combinations thereof.

12. The composition according to any one of claims 8 to 11, further comprising a pharmaceutically acceptable carrier.

13. The composition according to any one of claims 8 to 12, for inducing nucleotides at positions 748 - 933 of the NR2E3 pre-mRNA in a subject in need thereof.

14. The use according to claim 13, wherein the subject comprises a c.932G>A mutation in exon 6 of the NR2E3 pre-mRNA.

15. The use according to claim 13 or 14, wherein the subject has or is at increased risk of having a retinal disease.

16. The composition according to any one of claims 8 to 12, for treating or preventing a retinal disease in a subject in need thereof.

17. A method for producing a compound suitable for treating a retinal disease, the method comprising a compound that binds to exon 6 of the NR2E3 pre-mRNA, determining the nucleotides at positions 748 - 933 of the NR2E3 pre-mRNA in the presence of the compound, and selecting at least one compound that induces the nucleotides at positions 748 - 933 of the NR2E3 pre-mRNA.

18. The method according to claim 17, wherein the NR2E3 pre-mRNA comprises a c.932G>A mutation in exon 6.

Images