Application of IRF2 gene in resisting chicken chronic respiratory disease

Abstract

The invention discloses an application of a poultry IRF2 gene, and the poultry IRF2 gene is used for inhibiting the replication of Mycoplasma gallisepticum (MG) in host cells and the expression of virulence protein, so that the poultry chronic respiratory disease (CRD) caused by MG infection can be resisted. According to the application disclosed by the invention, the IRF2 gene in the chicken macrophage HD11 is interfered by utilizing a gene silencing technology, after MG challenge, the replication level and virulence protein expression of intracellular MG are obviously lower than those of wild type cells, inflammatory response and cell apoptosis of HD11 are obviously inhibited, and cell proliferation is promoted. The overexpressed IRF2 gene in the cell, the replication of the MG in the cell and the expression of the virulence protein are obviously enhanced, which indicates that the IRF2 gene is a susceptible gene of the MG, and the cell has an MG resistance phenotype after being knocked down, so that the replication of the MG and the expression of the virulence protein can be effectively inhibited. Therefore, the IRF2 gene can be used as a new target for development of vaccine drugs for inhibiting MG replication and research on disease resistance breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering for animal molecular breeding, and particularly relates to the application of Interferon regulatory factor 2 (IRF2) in the prevention of chicken chronic respiratory disease. Background Art

[0002] Mycoplasma gallisepticum (MG) can not only cause chronic respiratory disease (CRD) in chickens, but also infect poultry such as turkeys, geese, pigeons, quails and sparrows, and is widely spread worldwide. MG can be transmitted horizontally and vertically. Once infected, it is difficult to be completely cleared, and it is also an inducer for the infection of other bacteria or viruses such as avian influenza virus, infectious bronchitis virus, Newcastle disease virus and Escherichia coli, causing huge economic losses to the poultry industry.

[0003] At present, the prevention and treatment measures for CRD in production mainly include vaccination and antibiotic treatment. The vaccines mainly include inactivated vaccines and attenuated live vaccines. The inactivated vaccines have good safety, but cannot prevent the invasion of wild virus or clear the wild virus in the body, and are expensive; the attenuated live vaccines have poor safety and are easy to cause MG infection in chicken flocks. Antibiotic treatment can only relieve the clinical symptoms caused by MG infection, and it is easy to relapse once the drug is stopped. In addition, the unreasonable use of antibiotics will lead to the generation of drug-resistant strains, and cause drug residues in poultry products and environmental pollution, endangering human health. Cultivating disease-resistant varieties is the most effective measure to solve MG infection, but currently there is a serious lack of target genes available for disease-resistant breeding, which restricts the process of disease-resistant breeding. Therefore, exploring host genes resistant to CRD helps to provide targets for disease-resistant breeding and also provides a scientific basis for the research and development of new vaccines and drugs. Summary of the Invention

[0004] In order to solve the problems existing in the above-mentioned prior art, the purpose of the present invention is to provide the application of the IRF2 gene of chickens in the prevention of chicken chronic respiratory disease. The present invention discovers that by silencing the IRF2 gene in chicken macrophages with oligonucleotide siRNA, after MG challenge, the copy number of MG and the expression of virulence proteins in the cells are significantly reduced, indicating that the IRF2 gene-silenced cells can effectively inhibit the replication of MG and the expression of virulence proteins, significantly improve the anti-MG ability of the cells, provide a new strategy for the prevention and inhibition of MG infection, and also provide a new target for the research of disease-resistant breeding of chickens.

[0005] In order to achieve the above purpose, the present invention adopts the following technical solutions:

[0006] The present invention provides the application of the IRF2 gene in any one of the following:

[0007] (1) Application in improving the disease resistance of animals;

[0008] (2) Application in preparing products for improving the disease resistance of animals;

[0009] (3) Application in breeding animal breeds with high disease resistance;

[0010] (4) Application in preparing products for breeding animal breeds with high disease resistance.

[0011] The nucleotide sequence of the IRF2 gene is as shown in SEQ ID NO.1 or a gene sequence containing the nucleotide sequence as shown in SEQ ID NO.1.

[0012] The present invention designed and screened siRNAs for silencing the expression of the chicken IRF2 gene; the siRNAs were transfected into chicken macrophages HD11 to construct IRF2 gene-silenced cells.

[0013] The present invention provides a recombinant overexpression vector of IRF2. The expression vector was prepared by linearizing the pcDNA3.1(+) vector with HindⅢ / NotⅠ double restriction enzymes. After recovering the linearized pcDNA3.1(+) vector fragment, it was ligated with the IRF2 gene to construct an IRF2 gene overexpression vector.

[0014] The present invention provides a recombinant engineering bacterium, which is prepared by transforming the above-mentioned recombinant overexpression vector into a host bacterium, and the selected host bacterium is Escherichia coli TM5α.

[0015] The beneficial effects of the present invention are as follows:

[0016] Based on the changes in the replication level of MG and the expression level of IRF2 in MG-infected HD11 cells, the present invention reveals that the IRF2 level is positively correlated with MG replication and virulence protein expression. By designing an siRNA targeting the IRF2 gene and transfecting it into host cells, the replication of MG and the expression of virulence proteins can be significantly inhibited, and the inflammatory response and apoptosis induced by MG can be inhibited, providing a new method for improving the resistance of host cells to MG. By overexpressing IRF2 in HD11 cells, rapid replication of MG after infection and high-titer MG can be achieved, providing highly efficient MG amplification cells for the preparation of MG vaccines. The present invention provides a new measure for improving the resistance of host cells to MG and a new target for using molecular marker-assisted selection to breed disease-resistant varieties. Description of the Drawings

[0017] Figure 1 Expression level of IRF2 after MG-infected HD11 cells;

[0018] Figure 2Effect of IRF2 on MG copy number and expression level of virulence protein pMGA1.2 in HD11 cells;

[0019] Among them, Figure A shows the MG copy number in HD11 cells after overexpressing IRF2; Figure B shows the MG copy number in HD11 cells after knocking down IRF2; Figure C shows the expression level of virulence protein pMGA1.2 in HD11 cells after overexpressing and knocking down IRF2.

[0020] Figure 3 Effect of IRF2 on the proliferation of HD11 cells after MG infection;

[0021] Among them, Figure A shows the proliferation of HD11 cells after overexpressing IRF2; Figure B shows the proliferation of HD11 cells after knocking down IRF2.

[0022] Figure 4 Effect of IRF2 on the expression level of inflammatory factors in HD11 cells after MG infection;

[0023] Among them, Figure A shows the expression levels of pro-inflammatory factors TNF-α and IL-1B in HD11 cells after overexpressing IRF2; Figure B shows the expression levels of anti-inflammatory factors TGFB and IL-10 in HD11 cells after overexpressing IRF2; Figure C shows the expression levels of pro-inflammatory factors TNF-α and IL-1B in HD11 cells after knocking down IRF2; Figure D shows the expression levels of anti-inflammatory factors TGFB and IL-10 in HD11 cells after knocking down IRF2.

[0024] Figure 5 Effect of IRF2 on the expression level of apoptosis genes in HD11 cells after MG infection;

[0025] Among them, Figure A shows the expression levels of apoptosis genes CASP8, BCL-2, FAS, and CASP9 in HD11 cells after overexpressing IRF2; Figure B shows the expression levels of apoptosis genes CASP8, BCL-2, FAS, and CASP9 in HD11 cells after knocking down IRF2. Detailed implementation mode

[0026] The principles and characteristics of the present invention are described below. The examples are only used to explain the present invention and are not intended to limit the scope of the present invention. For those not specified in the examples, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0027] Application of IRF2 gene in anti-chicken chronic respiratory disease, including the following specific steps:

[0028] Example 1: Cultivation of HD11 cells

[0029] (1)Resuscitation of HD11 cells: Take out the cryopreserved cells from the -80°C refrigerator, quickly thaw the cells in a 37°C water bath. During the thawing process, constantly shake the cryopreservation tube to enable the cells to quickly cross the ice crystal stage. Transfer the thawed cell mixture into a 15 mL centrifuge tube, add 4 mL of complete cell medium, centrifuge at 1000 r / min for 5 min, and discard the supernatant. Add 1 mL of complete cell medium to resuspend the cells, inoculate them into a culture flask, and make up the medium to 4 mL. Gently shake the culture flask to evenly spread the cells on the bottom of the flask, and place it in a 37°C, 5% CO2 incubator for culture.

[0030] (2)Subculture of HD11 cells: Observe the cells. When the cells in the culture flask are basically confluent and the cell density reaches more than 90%, the cells need to be subcultured. The basic subculture operations are as follows: Aspirate and discard the cell medium in the culture flask, add PBS to wash the cells, and repeat the operation twice. After discarding the PBS, add an appropriate amount of trypsin to cover the bottom of the flask, place it in the incubator and let it stand for 1 min. Observe the cell digestion situation under the microscope. When the cells begin to shrink and become round, add cell medium with twice the volume of trypsin to terminate the digestion. Gently pipette the cells in the culture flask to form a single cell suspension. Collect the cell suspension into a 15 mL centrifuge tube, centrifuge at 1000 r / min for 5 min, and discard the supernatant. Add complete cell medium, pipette to resuspend the cells, transfer the cells into a new culture flask, supplement an appropriate amount of cell medium, and place it in a 37°C, 5% CO2 constant temperature incubator for culture.

[0031] Example 2: Construction of IRF2 overexpression vector

[0032] In the present invention, the chicken IRF2 CDS region was retrieved from the NCBI database, and primers capable of performing PCR amplification on the full length of the CDS region were designed accordingly. According to the pcDNA3.1 plasmid sequence, the HindⅢ restriction enzyme site: 5’-AAGCTT-3’ and the NotⅠ restriction enzyme site: 5’-GCGGCCGC-3’ were selected. The primers were designed and synthesized using the primer design software primer5.0. After synthesis, fluorescence quantitative PCR was performed. The primer sequences are as follows:

[0033] IRF2 CDS-F: 5’- CCCAAGCTTATGCCTGTCGAAA -3’

[0034] IRF2 CDS-R: 5’- AAATATGCGGCCGCTTAGCAGCTCTTG-3’

[0035] (1)Amplification of the full length of the IRF2 CDS region:

[0036] Using the cDNA of HD11 cells as a template, TransStart® FastPfu DNA Polymerase was selected to amplify the target fragment. The PCR reaction system is as follows:

[0037] IRF2-CDS-F: 1.0 μL

[0038] IRF2-CDS-R: 1.0 μL

[0039] 5×Pfu Buffer: 10.0 μL

[0040] DNTPs: 5.0 μL

[0041] FastPfu high-fidelity DNA polymerase: 1.0 μL

[0042] MGSO4: 1.0 μL

[0043] Template cDNA: 2.0 μL

[0044] ddH2O: 29.0 μL

[0045] Total volume: 50.0 mL

[0046] The concentration of FastPfu high-fidelity DNA polymerase is 5 U / μL, and the amount of template cDNA is about 100 ng. After mixing, the PCR reaction program is as follows: 94°C, 2 min: (94°C, 30 sec; 55°C, 30 sec, 72°C, 30 sec) × 35; 72°C, 5 min; 15°C, 10 sec. After the PCR reaction is completed, the amplification result is detected by 1.0% agarose gel electrophoresis.

[0047] (2)Gel recovery of the full-length amplification product of the IRF2 CDS region

[0048] Cut the gel with the amplified DNA product of the IRF2 CDS region, and recover the amplified product of the IRF2 CDS region according to the instruction manual of the EasyPure Quick Gel Extraction Kit. The specific operation steps are as follows:

[0049] ① Under ultraviolet light, quickly cut the gel block containing the target DNA in the agarose gel with a clean scalpel and put it into a clean 2 mL centrifuge tube to weigh. If the gel weighs 100 mg, it can be regarded as 100 μL (100 mg ≈ 100 μL);

[0050] ② Add 3 volumes of solution GSB, and melt the gel in a dry bath at 55 °C for 10 min. After the agar block is completely melted, observe the color of the solution. If the color is purple, add an appropriate amount of 3M sodium acetate to adjust the color to be the same as that of GSB;

[0051] ③ Place it at room temperature and wait for the melted gel mixture to cool to room temperature. Then add it to the adsorption column, let it stand for 1 min, centrifuge at 10,000 r / min for 1 min, and discard the filtrate;

[0052] ④ Add 650 μL of Wash buffer solution, centrifuge at 10,000 r / min for 1 min, and discard the filtrate;

[0053] ⑤ Centrifuge at 10,000 r / min for 1 - 2 min to remove the residual solution;

[0054] ⑥ Place the adsorption column in a 1.5 mL clean centrifuge tube, add 30 μL of 55 °C EB or deionized water (pH > 7.0) to the center of the column, and let it stand at room temperature for 1 min;

[0055] ⑦ Centrifuge at 10,000 r / min for 1 min to elute the DNA, and temporarily store the eluted DNA at -20 °C.

[0056] (3) Digest the IRF2-CDS and the complete pcDNA3.1 plasmid

[0057] Use the fast cut enzymes HindIII and NotI to double digest IRF2-CDS, pcDNA3.1, and the complete plasmid. The enzyme digestion reaction system is as follows:

[0058] 10×H buffer: 5.0 μL

[0059] NotI: 5.0 μL

[0060] HindIII: 2.5 μL

[0061] pcDNA3.1 plasmid: 15.0 μL

[0062] ddH2O: 25.0 μL

[0063] Total volume: 50.0 μL

[0064] Incubate the enzyme digestion overnight (8 - 12 h) in a 37 °C biochemical incubator, and detect the enzyme digestion result by 1.0% agarose gel electrophoresis.

[0065] (4) Ligation of the recovered products

[0066] Ligate the recovered IRF2 CDS fragment with the overexpression vector pcDNA3.1 fragment. The ligation reaction system is as follows:

[0067] pcDNA3.1: 4.0 μL

[0068] IRF2 CDS: 4.0 μL

[0069] T4 Ligase: 1.0 μL

[0070] 10× T4 buffer: 1.0 μL

[0071] Total volume: 10.0 μL

[0072] The PCR reaction program is 37 °C for 15 min. After the reaction, the product is stored at 4 °C for later use.

[0073] (5)Transformation of the ligation product

[0074] ① Take out 50 μL of Trelief TM5α Chemically Competent Cell from the -80 °C refrigerator. After melting on ice, add 10 μL of the ligation product to it and make corresponding marks on the tube;

[0075] ② Gently mix the mixture, incubate on ice for 5 min, heat shock at 42 °C for 45 sec, and then quickly incubate on ice for 2 min;

[0076] ③ Spread the 55 μL of liquid in step ② evenly on an LA (containing 1‰ ampicillin) plate;

[0077] ④ After placing the spread plate upright in a 37 °C constant temperature incubator for 15 min, incubate it upside down overnight.

[0078] ⑤ Pick a single colony into a 1.5 mL sterile centrifuge tube, add 1 mL of LA liquid medium containing 1‰ ampicillin, and incubate at 37 °C with shaking at 220 r / min for 4 h.

[0079] Example 3: Design of siRNA sequence for IRF2

[0080] In the present invention, starting from 50 - 100 nucleotides downstream of the start codon AUG of the target gene, an ideal siRNA sequence is searched, and the designed siRNA sequence for knocking down the IRF2 gene is:

[0081] 5’-CCUCCAGGUCACCAUCAAATT-3’

[0082] 5’-UUUGAUGGUGACCUGGAGGTT-3’

[0083] Example 4: Design of PCR primers

[0084] In the present invention, according to the relevant gene sequences of the red junglefowl (Gallus gallus) in GenBank, primers were designed using the primer design software primer5.0 and synthesized. After synthesis, quantitative fluorescence PCR was performed. All primer sequences are as follows:

[0085] pMGA1.2-F 5’-TGAAACTTCGCTCAAAGAG-3’ pMGA1.2-R 5’-TGTAACCCAACATCATCGT-3’ IRF2-F 5’-GGGACGACTTCATTGGCAGA-3’ IRF2-R 5’-GTGGAGGCTGTGGACACTAC-3’ CASP8-F 5’-GGGTGTCTCCGTTCAGGTAT-3’ CASP8-R 5’-CATCTCTCCTTCACCAAGTAAGT-3’ CASP9-F 5’-TGCCGACGTTCCATAGAGTC-3’ CASP9-R 5’-ACGATGTCTGACACCCGAAG-3’ BCL-2-F 5’-AAGCAAGCGTGACAAC-3’ BCL-2-R 5’-ATCATAGGCTGCACATAC-3’ FAS-F 5’-CTGCTCCTCGTCATTGTGTT-3’ FAS-R 5’-CTCCACAGGTAATTTCTCGC-3’ MGC2-F 5’-CGCAATTTGGTCCTAATCCCCAACA-3’ MGC2-R 5’-TAAACCCACCTCCAGCTTTATTTCC-3’

[0086] Example 5: Extraction of RNA and reverse transcription into cDNA

[0087] After 24 h of MG infection, HD11 cell samples were collected using TRIzol to extract RNA. The steps are as follows:

[0088] (1) Extraction of cellular RNA:

[0089] ① Add 1 mL of TRIzol to each well of a 6-well plate, blow the cells down and collect them into a 1.5 mL RNase-free centrifuge tube;

[0090] ② Add 200 μL of chloroform, shake vigorously for 15 sec, let stand at 4°C for 5 min, and centrifuge at 4°C and 12,000 r / min for 15 min;

[0091] ③ Pipette the supernatant into a new 1.5 mL RNase-free centrifuge tube, add an equal volume of pre-chilled isopropanol, invert and mix several times, let stand at -20°C for 15 min, centrifuge at 4°C and 12,000 r / min for 15 min, and discard the supernatant;

[0092] ④ Add 1 mL of 75% ethanol, gently flick the precipitate to wash the precipitate, centrifuge at 4°C and 12,000 r / min for 5 min, and discard the supernatant; this step is repeated twice;

[0093] ⑤ According to the amount of precipitate, add an appropriate amount of DEPC water to dissolve the RNA precipitate. After gently mixing and dissolving, measure the concentration and purity of the total RNA extracted by NanoDrop-2000. Take 2 μL of the total RNA and perform electrophoresis detection on a 1.2% agarose gel. The remaining RNA is stored at -80°C in the refrigerator for later use. Observe the three bands of 28S rRNA, 18S rRNA, and 5.8S rRNA to judge the quality of RNA extraction;

[0094] ⑥ Measurement of RNA purity and concentration: RNA has the largest absorption peak at a wavelength of 230 nm. Measure the concentration of the total RNA at a wavelength of 230 nm by spectrophotometry. The ratio of OD260 / OD280 of a pure RNA sample is about 2.0. Therefore, the purity of RNA can be estimated according to the ratio of OD260 / OD280.

[0095] (2) Reverse transcription

[0096] According to the instruction manual of Vazyme's reverse transcription kit, the specific operation steps are as follows:

[0097] 1) Genomic DNA removal

[0098] Prepare the following mixture in an RNase-free centrifuge tube:

[0099] RNase-free ddH2O: to 16 μL

[0100] 4×gDNA wiper Mix: 4 μL

[0101] Template RNA: Total RNA 1 pg - 1 μg

[0102] Gently pipette to mix well. Incubate at 42°C for 2 min.

[0103] 2) Prepare the reverse transcription reaction system

[0104] Directly add 5×HiScript Ⅲ qRT SuperMix to the reaction tube in step 1

[0105] 5×HiScript Ⅲ qRT SuperMix: 4 μL

[0106] Reaction solution from step 1: 16 μL

[0107] Gently pipette to mix well.

[0108] Perform reverse transcription reaction: 37°C for 15 min; 85°C for 5 sec.

[0109] Example 6: Detect the expression level of IRF2 gene

[0110] Collect samples 24 h after MG infects HD11 cells. After extracting cellular RNA and reverse transcribing it into cDNA, detect the expression level of IRF2;

[0111] The system for fluorescence quantitative PCR is as follows:

[0112] Forward primer: 0.1 μL

[0113] Reverse primer: 0.1 μL

[0114] cDNA: 1 μL

[0115] Mix: 5 μL

[0116] ddH2O: 3.6 μL

[0117] The reaction conditions for fluorescence quantitative PCR are as follows: 95°C, 5 min; (95°C, 30 s, 62°C, 30 s, 72°C, 30 s) × 38 cycles.

[0118] Example 7: Detection of the copy number of MG

[0119] After overexpressing and knocking down IRF2, HD11 cells were infected with MG for 24 h, and the total genomic DNA of the cells was extracted. The copy number of MG was detected using the MGC2 primer.

[0120] According to the instructions of the Tiangen Blood / Cell / Tissue Genomic DNA Extraction Kit (spin column type), the specific steps are as follows:

[0121] ① First, adherent cells were processed into cell suspensions, then centrifuged at 10,000 rpm for 1 min. The supernatant was poured out, 200 μL of buffer GA was added, and the mixture was shaken until completely suspended.

[0122] ② 20 μL of Proteinase K solution was added and mixed well. When extracting cell genomic DNA, only Proteinase K needs to be added and mixed well, and then the next step can be continued.

[0123] ③ 200 μL of buffer GB was added, and the mixture was thoroughly inverted and mixed. It was placed at 70°C for 10 min. The solution should become clear. Briefly centrifuge to remove the water droplets on the inner wall of the tube cap.

[0124] ④ 200 μL of absolute ethanol was added, and the mixture was thoroughly shaken and mixed for 15 sec. At this time, flocculent precipitates may appear. Briefly centrifuge to remove the water droplets on the inner wall of the tube cap.

[0125] ⑤ The solution and flocculent precipitates obtained in the previous step were both added to an adsorption column CB3, and centrifuged at 12,000 rpm for 30 sec. The waste liquid was discarded, and the adsorption column CB3 was placed back into the collection tube.

[0126] ⑥ 500 μL of buffer GD was added to the adsorption column CB3, and centrifuged at 12,000 rpm for 30 sec. The waste liquid was discarded, and the adsorption column CB3 was placed into the collection tube.

[0127] ⑦ 600 μL of washing buffer PW was added to the adsorption column CB3, and centrifuged at 12,000 rpm for 30 sec. The waste liquid was discarded, and the adsorption column CB3 was placed into the collection tube.

[0128] ⑧ Repeat operation step 7.

[0129] ⑨ The adsorption column CB3 was placed back into the collection tube and centrifuged at 12,000 rpm for 2 min. The waste liquid was discarded. The adsorption column CB3 was placed at room temperature for several minutes to completely dry the residual washing buffer in the adsorption material.

[0130] ⑩ Transfer the adsorption column CB3 into a clean centrifuge tube, suspend and add 50 - 200 μL of elution buffer TE to the middle part of the adsorption membrane, place it at room temperature for 2 - 5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into the centrifuge tube.

[0131] Example 8: Detection of the expression level of MG adhesion protein pMGA1.2

[0132] After overexpressing and knocking down IRF2, infect HD11 cells with MG for 24 h respectively, and detect the expression level of pMGA1.2.

[0133] The system of fluorescence quantitative PCR is as follows:

[0134] Forward primer: 0.1 μL

[0135] Reverse primer: 0.1 μL

[0136] cDNA: 1 μL

[0137] Mix: 5 μL

[0138] ddH2O: 3.6 μL

[0139] The reaction conditions of fluorescence quantitative PCR are: 95 °C, 5 min; (95 °C, 30 s, 62 °C, 30 s, 72 °C, 30 s) × 38 cycles.

[0140] Example 9: Detection of HD11 cell proliferation

[0141] After overexpressing and knocking down IRF2, infect HD11 cells with MG for 24 h respectively, and detect the cell proliferation with the CCK8 kit.

[0142] According to the instructions of Abbkine's SuperKine TM Ultra-sensitive cell proliferation detection reagent (CCK-8), the specific steps are as follows:

[0143] (1) Prepare the standard curve

[0144] ① First, count the number of cells in the prepared cell suspension with a cell counting plate, and then inoculate the cells;

[0145] ② Dilute the cells successively in proportion with the culture medium, generally making 5 - 7 cell concentration gradients, with 4 - 6 replicates in each group;

[0146] ③ Incubate adherent cells or suspension cells for 0.5 - 4 h after inoculation. Add 10 μL of CCK-8 reagent to every 100 μL of culture medium. After culturing for a certain period of time, measure the OD450 value and create a standard curve with the cell number as the abscissa and the OD450 value as the ordinate. The cell number of the unknown sample can be determined according to this standard curve. The prerequisite for using this standard curve is that the experimental conditions are exactly the same.

[0147] (2) Cell proliferation detection

[0148] ① Inoculate 100 μL of cell suspension (5000 cells / well) in a 96-well plate and pre-culture the plate in an incubator for 24 h;

[0149] ② Add 1 - 10 μL of various concentrations of the substance to be tested to the plate;

[0150] ③ Incubate the plate in an incubator for an appropriate time;

[0151] ④ Add 10 μL of CCK8 solution to each well of the plate;

[0152] ⑤ Incubate the plate in an incubator for 0.5 - 4 h;

[0153] ⑥ Measure the absorbance at 450 nm using a microplate reader.

[0154] Example 10: Detect the expression levels of inflammatory factors in HD11 cells

[0155] After overexpressing and knocking down IRF2, infect HD11 cells with MG for 24 h, then collect the cell supernatant, and detect the expression levels of inflammatory factors TNF-α, IL-1B, TGFB, and IL-10 according to the instructions of the enzyme immunoassay Elisa kit.

[0156] The specific steps are as follows:

[0157] (1) Dilution of standards:

[0158] 64 ng / L Standard 5 150 μL of undiluted standard was added to 150 μL of standard diluent 32 ng / L Standard 4 150 μL of Standard 5 was added to 150 μL of standard diluent 16 ng / L Standard 3 150 μL of Standard 4 was added to 150 μL of standard diluent 8 ng / L Standard 2 150 μL of Standard 3 was added to 150 μL of standard diluent 4 ng / L Standard 1 150 μL of Standard 2 was added to 150 μL of standard diluent

[0159] (2) Sample addition: Set blank wells (the blank control wells do not add samples and enzyme-labeled reagents, and the operations in the remaining steps are the same), standard wells, and wells for samples to be tested respectively. Accurately add 50 μL of the standard product to the enzyme-labeled coated plate. In the wells for samples to be tested, first add 40 μL of sample dilution solution, and then add 10 μL of the sample to be tested (the final dilution of the sample is 5 times). When adding the sample, add it to the bottom of the enzyme-labeled plate wells, try not to touch the well walls, and gently shake to mix evenly.

[0160] (3) Incubation: Seal the plate with a sealing film and incubate at 37 °C for 30 minutes.

[0161] (4) Preparation of the reagent solution: Dilute the 30-fold concentrated washing solution 30-fold with distilled water for later use.

[0162] (5) Washing: Carefully remove the sealing film of the plate, discard the liquid, centrifuge dry, fill each well with the washing solution, let stand for 30 seconds and then discard. Repeat this 5 times and pat dry.

[0163] (6) Adding enzyme: Add 50 μL of the enzyme-labeled reagent to each well, except for the blank well.

[0164] (7) Incubation: The operation is the same as in step 3.

[0165] (8) Washing: The operation is the same as in step 5.

[0166] (9) Color development: First add 50 μL of color developer A to each well, then add 50 μL of color developer B, gently shake and mix well, and develop color at 37 °C in the dark for 10 minutes.

[0167] (10) Termination: Add 50 μL of the termination solution to each well to terminate the reaction (at this time, the blue color immediately turns yellow).

[0168] (11) Measurement: Zero with the blank well, and measure the absorbance (OD value) of each well in sequence at a wavelength of 450 nm. The measurement should be carried out within 15 minutes after adding the termination solution.

[0169] Example 11: Detection of the expression level of apoptosis genes in HD11 cells

[0170] After overexpressing and knocking down IRF2, HD11 cells were infected with MG for 24 h, and the expression levels of apoptosis genes CASP8, BCL-2, FAS, and CASP9 were detected by fluorescence quantitative PCR.

[0171] The system of fluorescence quantitative PCR is as follows:

[0172] Forward primer: 0.1 μL

[0173] Reverse primer: 0.1 μL

[0174] cDNA: 1 μL

[0175] Mix: 5 μL

[0176] ddH2O: 3.6 μL

[0177] The reaction conditions of fluorescence quantitative PCR are: 95 °C, 5 min; (95 °C, 30 s, 62 °C, 30 s, 72 °C, 30 s) × 38 cycles.

[0178] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

[0179] SEQ ID NO.1

[0180] Nucleotide sequence of the IRF2 gene:

[0181]

Claims

1. Application of IRF2 in resisting Mycoplasma gallisepticum, characterized in that, The DNA sequence of the IRF2 gene is SEQ ID NO.

1.

2. A siRNA sequence for knocking down the expression of the IRF2 gene, characterized in that, It can significantly reduce the expression of the IRF2 gene in cells.

3. The use according to claim 2, characterized in that, The sequence of the siRNA is 5’-CCUCCAGGUCACCAUCAAATT-3’.

4. Design an overexpression sequence according to the CDS region of the IRF2 gene DNA sequence described in claim 1, characterized in that, The primer sequences are IRF2 CDS-F: 5’-CCCAAGCTTATGCCTGTCGAAA-3’ and IRF2 CDS-R: 5’-AAATATGCGGCCGCTTAGCAGCTCTTG-3’.

5. A recombinant overexpression vector, characterized in that, The recombinant overexpression vector is recombined by inserting the amplified CDS region with the overexpression primers in Claim 4 into pcDNA3.1 through the HindIII and NotI restriction enzyme sites.

6. A recombinant engineering bacterium, characterized in that, The recombinant engineering bacteria are prepared by transforming the recombinant overexpression vector in Claim 5 into the host bacteria.

7. A recombinant engineering bacterium according to claim 6, characterized in that, The host bacteria is Escherichia coli TM5α strain.

8. Chicken macrophage cell line (HD11), characterized in that, A cell model for the study of Mycoplasma gallisepticum infection.

9. Use of the IRF2 gene in resisting chronic respiratory disease of chickens, characterized in that: Infect Mycoplasma gallisepticum in chicken macrophages HD11, and detect the dynamic changes of the IRF2 gene and the Mycoplasma gallisepticum virulence protein pMGA1.2 gene in the cells, as well as the effect on the replication of Mycoplasma gallisepticum, by fluorescence quantitative PCR technology.

10. Use of the IRF2 gene in resisting chronic respiratory disease in chickens, characterized in that: Detect the effects of the dynamic changes of IRF2 on the inflammatory response and apoptosis in host cells after Mycoplasma gallisepticum infection by fluorescence quantitative PCR technology and Elisa.

11. Use of the IRF2 gene in the prevention and treatment of chronic respiratory disease in chickens according to claims 9-10, characterized in that It provides a new strategy for the prevention and inhibition of MG infection and a new target for the research on disease-resistant breeding of chickens.

Images