Application of activity inhibitor of fatty acid synthase or gene of fatty acid synthase in preparation of medicine for treating primary thrombocythemia

Abstract

The invention provides an application of an activity inhibitor of fatty acid synthase (FASN) or a gene thereof in preparation of a medicine for treating primary thrombocythemia (ET). The inventor verifies the treatment effect of the FASN small-molecule inhibitor and a gene editor or inhibitory nucleic acid aiming at the FASN gene in ET in-vitro and in-vivo models, further evaluates the possibility that the FASN or the gene thereof serves as a new ET treatment target, and provides a new thought for clinical ET treatment.

Description

Technical Field

[0001] The present disclosure relates to the field of biomedicine. In particular, the present disclosure relates to the use of an active inhibitor of fatty acid synthase (FASN) or its gene in the preparation of a medicament for treating essential thrombocythemia (ET). Background Art

[0002] Essential thrombocythemia (ET) is a myeloproliferative neoplasm (MPN) characterized by abnormally increased platelets, leading to a significantly increased risk of thrombosis and bleeding. The clinical manifestations of ET are highly heterogeneous. Patients may be asymptomatic for a long time, but may also experience symptoms of microcirculation disorders such as headache, dizziness, and numbness in the limbs. In severe cases, fatal complications such as myocardial infarction, stroke, or deep vein thrombosis may occur, and the harm of its long-term complications cannot be ignored. Among them, thromboembolic events are the main cause of death in ET patients. In addition, some patients may progress to myelofibrosis (MF) or acute myeloid leukemia (AML), with extremely poor prognosis.

[0003] The pathogenesis of ET is closely related to mutations in JAK2V617F, CALR, and MPL genes. These mutations activate the JAK-STAT signaling pathway, resulting in abnormal proliferation of megakaryocytes and overactive platelet production. Current treatment strategies mainly include low-dose aspirin to reduce the risk of thrombosis, and the use of hydroxyurea or interferon α to control platelet levels. However, these treatment methods have obvious limitations. Hydroxyurea may cause cytotoxic side effects and has a potential risk of inducing the disease to progress to AML, while interferon α has poor tolerance and often causes adverse reactions such as flu-like symptoms and depression, affecting patient compliance. In recent years, JAK2 inhibitors (such as ruxolitinib) have shown certain efficacy as emerging targeted treatment methods in ET, but some patients have drug resistance, and these drugs cannot effectively block the progression of the disease to MF or AML.

[0004] With the chronic progression of the disease and the recurrence of complications, ET seriously affects the quality of life of patients. Long-term drug treatment and frequent blood monitoring not only increase the medical burden, but once thrombosis occurs or the disease progresses to MF or AML, the treatment cost and hospitalization risk will increase significantly, bringing a heavy economic pressure to the patient's family and the public medical system. Therefore, there is an urgent need to explore new therapeutic targets and potential drugs to improve the disease management effect, reduce the risk of complications, and relieve the economic burden on society and the medical system while improving the prognosis of patients.

[0005] Current treatment methods for ET aim to reduce the risks of thrombosis and bleeding. However, these treatment regimens have the following deficiencies and drawbacks: (1) Side effects and tolerance issues: Cytostatic drugs such as hydroxyurea may cause side effects, including myelosuppression, oral ulcers, and skin ulcers, and some patients have difficulty tolerating them. Additionally, there is still controversy regarding whether the use of hydroxyurea increases the risk of AML or other malignancies. (2) Inability to effectively prevent disease progression: Existing therapies mainly target symptom management and fail to effectively prevent the progression of ET to MF or AML. Studies have shown that approximately 10% of ET patients progress to MF after diagnosis, and approximately 3% progress to AML. (3) Limited improvement in overall survival: Although existing treatment methods have certain effects in reducing the risks of thrombosis and bleeding, they have not significantly extended the overall survival of patients. Epidemiological data show that the median survival of ET patients is approximately 20 years, and the survival of high-risk patients is significantly shorter than that of age- and gender-matched normal populations. Given the above deficiencies, there is an urgent need to explore new molecular targets and treatment strategies to achieve more effective disease intervention and improved prognosis. Summary of the Invention

[0006] Technical problems to be solved:

[0007] In the first aspect of the present disclosure, in view of the defect that the existing treatment for essential thrombocythemia (ET) lacks effective targets and related drugs, there is provided the use of an active inhibitor of fatty acid synthase (FASN) or its gene in the preparation of a drug for treating ET.

[0008] Technical solutions:

[0009] The use of an active inhibitor of fatty acid synthase (FASN) or its gene in the preparation of a drug for treating essential thrombocythemia (ET).

[0010] Furthermore, the above-mentioned active inhibitor may be a product that blocks or reduces the expression of the gene, or a product that blocks or reduces the activity of the fatty acid synthase.

[0011] In some embodiments of the present disclosure, the above-mentioned active inhibitor may be an active inhibitor containing a polypeptide that specifically binds to FASN.

[0012] Furthermore, in some other embodiments of the present disclosure, the above-mentioned active inhibitor may be an antibody that specifically binds to FASN or an antigen-binding portion of the antibody, a complex containing an E3 ubiquitin ligase that specifically binds to FASN, an antibody-drug conjugate that specifically binds to FASN, or a chimeric antigen receptor that specifically binds to FASN.

[0013] Specifically, the above-mentioned activity inhibitor can be a small molecule compound inhibitor, and the small molecule compound inhibitor is selected from C75 or its enantiomer, FASN-IN-1, FASN-IN-3, FASN-IN-4, FASN-IN-4 tosylate, FASN-IN-5, FASN-IN-6, Denifanstat, Fasnall or its enantiomer, Fasnallbenzenesulfonate, Orlistat, FT113, GSK837149A, TVB-3166, UCM05, Desoxyrhaponticin, IPI-9119, TVB-3664, Cerulenin, GSK2194069, PFM046, Androsin, CTL-06, CTL-12, YW1128, BI 99179 or Niga-ichigoside F1, or at least one of the salts of the above small molecule compounds.

[0014] It can be used according to the specified dosage and method of the above-mentioned small molecule compound inhibitor. The above-mentioned small molecule compound inhibitor can be used alone or in combination.

[0015] In some embodiments of the present disclosure, the above-mentioned activity inhibitor can also be an inhibitory nucleic acid of the FASN gene or a gene editor targeting the FASN gene. Further, in some embodiments of the present disclosure, the above-mentioned gene editor can include sgRNA. The sgRNA can be designed and obtained by conventional methods in the prior art. Specifically, the above-mentioned sgRNA can be Fasn Mouse Pre-designed siRNA Set A (Genbank ID: 14104), FASN HumanPre-designed siRNA Set A (Genbank ID: 2194), Fasn Rat Pre-designed siRNA Set A (Genbank ID: 50671).

[0016] In some embodiments of the present disclosure, the above-mentioned inhibitory nucleic acid includes shRNA, and the shRNA includes nucleotide pairs shown in SEQ ID No.1 or 2, or nucleotide pairs shown in SEQ ID No.3 or 4.

[0017] The second aspect of the present disclosure is to provide the use of a composition in the preparation of a drug for treating essential thrombocythemia (ET), and the composition includes an activity inhibitor of FASN or its gene.

[0018] In some embodiments, the above composition may further include a pharmaceutically acceptable carrier, delivery medium, excipient, stabilizer, diluent, surfactant, preservative, isotonic agent, etc., or a combination thereof.

[0019] The third aspect of the present disclosure is to provide the use of an active inhibitor of FASN or its gene in the preparation of a product for reducing the differentiation level of hematopoietic stem / progenitor cells into megakaryocytes (Mk).

[0020] Beneficial effects:

[0021] The inventors of the present invention verified the therapeutic effects of small molecule inhibitors of FASN and gene editors or inhibitory nucleic acids targeting the FASN gene in in vitro and in vivo models of ET, and further evaluated the possibility of FASN or its gene as a new therapeutic target for ET, providing new ideas for the clinical treatment of ET. Description of the drawings

[0022] Figure 1 This is a graph showing the proportion results of Mk (CD41a + CD42b + ) in each group on Day 3 and Day 6 of the differentiation of human megakaryocytic leukemia cell line (MEG-01) into megakaryocytes (Mk) before and after knockdown of the FASN gene in the examples of the present disclosure;

[0023] Figure 2 This is a graph showing the proportion results of Mk (CD41a + hematopoietic stem / progenitor cells (HSPCs) derived from umbilical cord blood into Mk on Day 9 and Day 12 before and after knockdown of the FASN gene in the examples of the present disclosure; + CD42b + ) in each group;

[0024] Figure 3 This is a graph showing the proportion results of Mk (CD41a + CD42b + ) in each group detected on Day 3 and Day 6 after adding FASN inhibitor C75 (0 μM (DMSO), 10 μM, 20 μM) to the MEG-01 to Mk differentiation system in the examples of the present disclosure;

[0025] Figure 4 This is a graph showing the results of the platelet count in the peripheral blood of each group of mice detected on Day 14 after intraperitoneal injection of C75 (0 mg / Kg (DMSO), 30 mg / Kg) into ET mice in the examples of the present disclosure.

[0026] Sequence description.

[0027] Detailed implementation mode

[0028] The present invention discloses the use of an active inhibitor of fatty acid synthase (FASN) or its gene in the preparation of a medicament for treating essential thrombocythemia (ET). Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. And relevant personnel can obviously make changes or appropriate alterations and combinations to the content described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0029] In this disclosure, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Unless otherwise clearly indicated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "having" etc. will be understood to include the stated elements or components, without excluding other elements or other components. The term "a" ( "an" and "the") includes plural referents. The term "plural" means two or more. Terms such as "such as", "for example" etc. are intended to indicate exemplary embodiments and are not intended to limit the scope of this disclosure.

[0030] In this disclosure, when a range of values is provided, it should be understood that unless the context clearly indicates otherwise, the endpoints are included in the range and each intermediate value between the upper and lower limits of the range and any other specified value or intermediate value within the specified range and any value within the smaller range between the specified values are all covered.

[0031] In this disclosure, the term "about" generally means varying within a range of 0.5% - 10% above or below the specified value, for example, varying within a range of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below the specified value.

[0032] In this disclosure, "one embodiment", "one example", "some embodiments", "specific examples", "related examples", "a certain example", "certain examples", "additional examples", or "further examples", "further implementation", or "another example", "other examples" mean that at least one feature or characteristic description is included in the relevance to the example. Therefore, throughout this disclosure, the above phrases do not necessarily refer to the same example. In addition, specific features can be combined in any suitable manner in one or more embodiments.

[0033] In this disclosure, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Definitions of common terms in molecular biology can be found in Lewin’s GENES, Twelfth Edition, Jocelyn E. Krebs, Elliott S. Goldstein, Stephen T. Kilpatrick, published by Jones & Bartlett Learning. Definitions of common terms in biochemistry can be found in Lehninger Principles of Biochemistry, Eighth Edition, David L. Nelson, Michael M. Cox, published by W. H. Freeman. Definitions of common terms in cell biology can be found in Molecular Biology of the Cell, Sixth Edition, Bruce Alberts, Alexander Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter, published by Garland Science. Definitions of common terms in genetics can be found in Genetics: Analysis of Genes and Genomes, Eighth Edition, Daniel L. Hartl, Maryellen Ruvolo, published by Jones & Bartlett Learning.

[0034] Unless otherwise specified, experimental techniques used herein employ conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, which can be found in standard books such as Molecular Cloning: A Laboratory Manual; Cell Biology: A Laboratory Handbook, etc.

[0035] Definitions:

[0036] The term "Fatty Acid Synthase" (FASN) in the present disclosure is a multifunctional enzyme (RefSeq: NP_004095.4), which is mainly responsible for converting acetyl-CoA and malonyl-CoA into palmitic acid and plays a central role in fatty acid synthesis and metabolism. Under physiological conditions, FASN is mainly expressed in the liver, adipose tissue and mammary gland, and is involved in key processes such as energy storage, cell membrane synthesis and signal molecule generation. In addition, FASN also has an important regulatory effect on cell proliferation, differentiation and redox balance. The FASN gene is located on human chromosome 17. The length of the FASN protein is 2511 amino acids, and the molecular mass is approximately 273,427 Daltons (Da). Under pathological conditions, the abnormal expression of FASN is closely related to the occurrence and development of various diseases. FASN is highly expressed in a variety of solid tumor cells, and its overactivation is considered to be part of tumor metabolic reprogramming (Warburg effect), promoting the rapid proliferation of tumor cells, inhibiting apoptosis and enhancing their drug resistance. The high expression of FASN has been found to be closely related to the invasiveness and poor prognosis of breast cancer, prostate cancer, colorectal cancer and ovarian cancer. By promoting the synthesis of lipid bilayers, FASN provides the material basis for the synthesis of biological membranes for tumor cells, supporting their high proliferation and migration ability. In addition, FASN can also promote the growth and survival of tumor cells and further drive tumor progression by regulating signal pathways such as PI3K / AKT / mTOR and HER2 / EGFR.

[0037] The term "activity inhibitor" in the present disclosure refers to a substance that can bind to and inhibit the protein activity of the FASN, preventing it from effectively participating in pathological processes. Exemplary examples include, for instance, competitive inhibitors, which have a structure similar to the substrate and compete for binding to the active site of the enzyme; non-competitive inhibitors, which bind to the non-active site of the enzyme, causing conformational changes and preventing catalytic reactions; uncompetitive inhibitors, which only bind to the enzyme-substrate complex (ES) and block product formation; irreversible inhibitors that covalently modify the active site of the enzyme; covalent reversible inhibitors; and allosteric inhibitors. The term "activity inhibitor" can also refer to a substance that can downregulate or inhibit the expression of the FASN gene. In some embodiments, the downregulation or inhibition can refer to either direct or indirect downregulation or inhibition. In some embodiments, the downregulation or inhibition of the FASN gene expression can be achieved by at least one of the regulatory methods at the transcriptional level, translational level, post-transcriptional modification level, or post-translational modification level of the FASN gene. To achieve better effects, the above regulatory methods can be used alone or in combination. The above regulatory methods can be carried out using the methods disclosed in the prior art, for example, referring to Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281-297. Further, in some embodiments, the downregulation or inhibition of the FASN gene expression is achieved by at least one of the following treatments on the FASN gene: gene silencing, gene knockout or knockdown, and gene mutation. To achieve better effects, the above treatment methods can be used alone or in combination. The above treatment methods can be carried out using the methods disclosed in the prior art, for example, referring to Ito Y, Inoue S, Nakashima T, et al. Epigenetic profiles guide improved CRISPR / Cas9-mediated gene knockout in human T cells. Nucleic Acids Res. 2024;52(1):141-153.

[0038] The term "enantiomers" in the present disclosure refers to stereoisomers that are non - superimposable mirror images of each other. For example, when a compound has an asymmetric center and is bonded to four different groups, a pair of enantiomers may exist. Enantiomers can be characterized by the absolute configuration of their asymmetric centers and described according to the R and S sequence rules of Cahn–Ingold–Prelog (CIP), or described according to the way the molecule rotates the plane of polarized light, thereby designating it as dextrorotatory or levorotatory (i.e., (+) or (−)-isomers, respectively). Chiral compounds can exist in the form of individual enantiomers or mixtures thereof. A mixture containing equal proportions of enantiomers is called a "racemic mixture".

[0039] The term "C75" in the present disclosure is a synthetic FASN inhibitor. The half - inhibitory concentration (IC 50 ) of C75 against prostate cancer cell line PC3 is 35 μM. C75 is an effective carnitine palmitoyltransferase 1A (CPT1A) activator. The structural formula of C75 is shown in Formula I below. See Rae C, et al. Inhibition of Fatty Acid Synthase SensitizesProstate Cancer Cells to Radiotherapy. Radiat Res. 2015 Nov;184(5):482 - 93.doi: 10.1667 / RR14173.1.

[0040]

[0041] Formula I

[0042] The term "Inhibitory Nucleic Acid" (INA) in the present disclosure is a class of nucleic acid molecules that can inhibit the expression of specific genes or the function of proteins. Through specific sequence design and modification, they can bind to the complementary sequences of the target gene's mRNA or protein, thereby interfering with its normal function or expression level. Common examples of inhibitory nucleic acids include antisense oligonucleotides, small interfering RNA (siRNA), short hairpin RNA (shRNA), and other nucleic acid molecules that act through the RNA interference (RNAi) mechanism, etc.

[0043] Examples:

[0044] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be further described in detail below with reference to specific examples.

[0045] Example 1: Construction of FASN - shRNA knockdown plasmid

[0046] 1. The pSIH1-H1-copGFP shRNA expression slow vector was purchased from System Biosciences. According to the product manual, the control shRNA (Scramble) plasmid was constructed. Queries were made on the Sigma website to screen for verified sequences, and the following FASN-shRNA sequences were synthesized by BGI.

[0047] FASN -sh1F: GATCCGCTACGACTACGGCCCTCATTCTTCCTGTCAGAAATGAGGGCCGTAGTCGTAGCTTTTTG (SEQ ID No:1)

[0048] FASN -sh1R: AATTCAAAAAGCTACGACTACGGCCCTCATTTCTGACAGGAAGAATGAGGGCCGTAGTCGTAGCG (SEQ ID No:2)

[0049] FASN -sh2F: GATCCGCATGGAGCGTATCTGTGAGAACTTCCTGTCAGATTCTCACAGATACGCTCCATGCTTTTTG (SEQ ID No:3)

[0050] FASN -sh2R: AATTCAAAAAGCATGGAGCGTATCTGTGAGAATCTGACAGGAAGTTCTCACAGATACGCTCCATGCG (SEQ ID No:4)

[0051] 2. Vector construction.

[0052] (1) Restriction enzyme digestion of the vector plasmid.

[0053] System:

[0054]

[0055] After digestion, the linear fragment vector was recovered by gel extraction.

[0056] (2) Primer annealing.

[0057] System:

[0058]

[0059] PCR reaction:

[0060]

[0061] (3) Ligation.

[0062] System:

[0063]

[0064] Incubate overnight at 16°C.

[0065] (4) Transformation.

[0066] Use Trans5α competent cells for transformation, spread on plates, pick colonies and culture in liquid medium the next day, and send for sequencing.

[0067] (5) Select shRNA with correct sequence and extract plasmid.

[0068] Culture bacteria one day in advance, keep bacteria on the same day and freeze at -80°C with 50% glycerol, use the remaining bacterial liquid to extract plasmid with a plasmid midiprep kit, and freeze at -80°C.

[0069] 3. Virus packaging.

[0070]

[0071] Plate 293T cells 2 days in advance, package virus when the confluence reaches 95%. Collect the supernatant at 48 h and 72 h after virus packaging respectively, mix them together, centrifuge at 3000 rpm for 15 min, filter the supernatant through a 0.45 μm filter membrane, concentrate by centrifugation at 20000 rpm for 2.5 h, aliquot and store at -80°C.

[0072] Example 2: The virus obtained in Example 1 infects human megakaryocytic leukemia cell line (MEG-01), cord blood CD34 + hematopoietic stem / progenitor cells (HSPCs), and induce their differentiation into megakaryocytes (Mk) in vitro.

[0073] 1. Infect MEG-01 with the virus obtained in Example 1.

[0074] (1) Prepare cells at a density of 7x10 5 cells / mL, calculate the volume of virus to be added according to the virus titer, and add 8 mg / mL polybrene at 1:2000.

[0075] (2) Wrap with sealing film and centrifuge at 37°C and 2000 rpm for 90 min.

[0076] (3) After centrifugation, remove the sealing film and place the cells in an incubator. After 12 h, change to the induction differentiation medium: RPMI-1640 + 10% fetal bovine serum (FBS) + 1% penicillin-streptomycin combined antibiotic (P / S) + 50 ng / mL 12-myristoylphorbol-13-acetate (PMA).

[0077] (4) Sort GFP + cells by flow cytometry and induce them to differentiate into Mk. The cell density is 1x10 5 cells / mL / well. Change the medium every 3 days and culture until Day 6. Collect the excess cells during each medium change. Part of the cells are used for protein extraction to detect the gene knockdown effect by Western Blot; the other part is used to incubate with CD41a-APC and CD42b-PE flow antibodies to detect the proportion of cells differentiating into Mk.

[0078] 2. Enrichment of cord blood-derived CD34 + hematopoietic stem / progenitor cells (HSPCs).

[0079] Dilute the fresh cord blood sample 1:1 with sorting buffer (phosphate buffered saline (PBS) + 2% FBS + 1% P / S + 2 mM ethylenediaminetetraacetic acid (EDTA)). Add 1 / 2 volume of human lymphocyte separation solution to a 15 mL centrifuge tube, and slowly add the diluted sample along the tube wall, keeping the lymphocyte separation solution at the bottom and the diluted sample on top. Centrifuge at 680 g for 20 min with a slow acceleration and deceleration. Aspirate the buffy coat layer into a new 15 mL centrifuge tube, add 10 mL of sorting buffer, and centrifuge at 1600 rpm for 5 min. Discard the supernatant, repeat centrifugation at 1400 rpm once, discard the supernatant, and resuspend and count with sorting buffer. Add 10 µL of blocking agent and 10 µL of CD34 7 magnetic beads to every 1x10 + cells, and incubate at 4 °C in the dark for 30 min. Add 10 mL of sorting buffer to wash the cells, centrifuge at 300 g for 5 min, and discard the supernatant. Prepare a magnetic adsorption column and fix it to a magnetic stand. Add 200 µL of sorting buffer to resuspend every 1x10 7 cells and transfer them to the adsorption column. After thoroughly washing the column with sorting buffer to remove unbound cells, remove the adsorption column from the magnetic stand and place it in a 15 mL centrifuge tube. Add 2 mL of sorting buffer to the adsorption column, and use the accompanying extrusion rod to push the adsorbed CD34 + cells into the centrifuge tube. Repeat this step, then centrifuge and count, discard the supernatant, and the enriched CD34 + HSPCs are obtained.

[0080] 3. Infect the cord blood-derived CD34 + HSPCs with the virus obtained in Example 1.

[0081] (1) Prepare cells at a density of 7x10 5 cells / mL, calculate the volume of virus to be added according to the virus titer, and add 8 mg / mL polybrene at a ratio of 1:2000.

[0082] (2) Wrap it with sealing film and centrifuge at 37 °C and 2000 rpm for 90 min.

[0083] (3) After centrifugation, remove the sealing film and place it in the incubator. After 12 h, change it to Mk differentiation medium.

[0084] 4. Induce the differentiation of CD34 + HSPCs into Mk.

[0085] (1) Prepare the differentiation medium for Day 0 / Day 3: Stemspan + 20 ng / mL IL-3 + 20 ng / mL SCF + 50 ng / mL TPO + 1% P / S; the differentiation medium for Day 6 / Day 9: Stemspan + 20 ng / mL IL-11 + 50 ng / mL TPO + 1% P / S.

[0086] (2) Sort GFP + cells by flow cytometry and induce their differentiation into Mk. The cell density is 1x10 5 cells / mL / well, and change the medium every 3 days. When changing the medium each time, collect the excess cells. Part of them is used for RNA extraction, and the gene knockdown effect is detected by RT-qPCR; the other part is used to incubate the flow antibodies of CD41a-APC and CD42b-PE to detect the proportion of CD34 + cells differentiating into Mk.

[0087] Results: Knock down the expression of the FASN gene and detect the effect of knocking down this gene on Mk differentiation.

[0088] To achieve specific knockdown of the FASN gene, a corresponding shRNA lentiviral vector was constructed in Example 1 of this embodiment. First, use this vector to knock down the expression of the FASN gene in the MEG-01 cell line, and it was found that on Day 3 and Day 6, compared with the control group Scramble, knocking down this gene would significantly reduce the proportion of Mk (CD41a + CD42b + ) (the results are shown in Figure 1 ). Further verification was carried out in human primary samples, and CD34 derived from umbilical cord blood was used +After gene knockdown in HSPCs, they were induced to differentiate into Mk. On Day 9 and Day 12 of the differentiation process, compared with the control group Scramble, the proportion of Mk (CD41a + CD42b + ) in the FASN gene knockdown group was significantly reduced (the results are shown in Figure 2 ). The above results indicate that inhibiting the expression of the FASN gene can significantly inhibit the differentiation of HSPCs into Mk, suggesting that this gene may play an important role in promoting the abnormal increase of Mk and platelets in ET.

[0089] Example 3: Effect of FASN inhibitor C75 on the differentiation of MEG-01 cell line into Mk.

[0090] Induce the MEG-01 cell line to differentiate into Mk, and treat the MEG-01 cells with C75 throughout the process. The cell density is 1x10 5 cells / mL / well, and the medium is changed every 3 days, and cultured until Day 6. When changing the medium each time, part of the cells are taken out for incubation with CD41a-APC and CD42b-PE flow antibodies to detect the proportion of cells differentiating into Mk.

[0091] Example 4: Effect of FASN inhibitor C75 on the phenotype of murine ET.

[0092] 1. Screen mice with ET phenotype.

[0093] Take the tail blood of JAK2 V617F gene mutant mice, and detect the blood picture parameters with the SYSMEX XN-1000 full-automatic modular blood and body fluid analyzer. Taking other parameters as normal and platelets > 1700×10 9 / L as the standard, identify as ET mice.

[0094] 2. Intraperitoneal injection of FASN inhibitor C75.

[0095] Divide the ET mice into a control group and an experimental group, with 5 mice in each group. Each mouse in the experimental group is intraperitoneally injected with C75 at 30 mg / Kg, once every two days for 14 days; the control group mice are given DMSO at the same dose and frequency. The blood picture of the mice is detected every 7 days.

[0096] Results of Example 3 and 4:

[0097] To explore whether the FASN inhibitor C75 can improve the ET phenotype, in this Example 3, C75 was first applied in the MEG-01 to Mk differentiation system, and concentration gradients of 0 μM (DMSO), 10 μM, and 20 μM were set. It was found that C75 could significantly inhibit the differentiation of MEG-01 into Mk (CD41a + CD42b +Differentiation of (), suggesting that C75 may improve the ET phenotype by inhibiting the differentiation process of Mk (see the results in Figure 3 ). To further explore the possibility of C75 as a potential drug for treating ET, in this Example 4, an intraperitoneal injection experiment of C75 was conducted on an ET mouse model. The experimental results showed that 14 days after administration, compared with the control DMSO group, the peripheral blood platelet parameters of the experimental group mice were significantly reduced, and the ET-related phenotypes were improved (see the results in Figure 4 ). The above results indicate that C75 can significantly improve the ET phenotype of mice and has potential application value for treating ET.

[0098] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of an active inhibitor of fatty acid synthase (FASN) or its gene in the preparation of a medicament for treating essential thrombocythemia (ET).

2. The use according to claim 1, characterized in that, The active inhibitor is a product that blocks or reduces the expression of the gene, or a product that blocks or reduces the activity of the fatty acid synthase.

3. The use according to claim 1 or 2, characterized in that, The active inhibitor is an active inhibitor containing a polypeptide that specifically binds to FASN.

4. The use according to claim 3, characterized in that, The active inhibitor is an antibody that specifically binds to FASN or an antigen-binding portion of the antibody, a complex containing an E3 ubiquitin ligase that specifically binds to FASN, an antibody-drug conjugate that specifically binds to FASN, or a chimeric antigen receptor that specifically binds to FASN.

5. The use according to claim 1 or 2, characterized in that, The active inhibitor is a small molecule compound inhibitor, and the small molecule compound inhibitor is selected from C75 or its enantiomer, FASN-IN-1, FASN-IN-3, FASN-IN-4, FASN-IN-4 tosylate, FASN-IN-5, FASN-IN-6, Denifanstat, Fasnall or its enantiomer, Fasnall benzenesulfonate, Orlistat, FT113, GSK837149A, TVB-3166, UCM05, Desoxyrhaponticin, IPI-9119, TVB-3664, Cerulenin, GSK2194069, PFM046, Androsin, CTL-06, CTL-12, YW1128, BI 99179 or Niga-ichigoside F1, or at least one of salts of the above small molecule compounds.

6. The use according to claim 1 or 2, characterized in that, The active inhibitor is an inhibitory nucleic acid of the gene of FASN or a gene editor targeting the gene of FASN.

7. The use according to claim 6, characterized in that, The gene editor includes sgRNA.

8. The use according to claim 7, characterized in that, The sgRNA is Fasn Mouse Pre-designed siRNA Set A (Genbank ID: 14104), FASN Human Pre-designed siRNA Set A (Genbank ID: 2194), Fasn Rat Pre-designed siRNA Set A (Genbank ID: 50671).

9. The use according to claim 6, characterized in that, The inhibitory nucleic acid includes shRNA, and the shRNA includes nucleotide pairs shown in SEQ ID No.1 or 2, or nucleotide pairs shown in SEQ ID No.3 or 4.

10. Use of a composition in the preparation of a medicament for treating essential thrombocythemia (ET), characterized in that, The composition includes an active inhibitor of FASN or its gene.

11. Use of an active inhibitor of fatty acid synthase (FASN) or its gene in the preparation of a product for reducing the level of differentiation of hematopoietic stem / progenitor cells into megakaryocytes (Mk).

Images