A genetically engineered bacterium producing 1,3-butanediol and its application

Abstract

The present invention discloses a genetically engineered bacterium producing 1,3-butanediol and its application, belonging to the field of genetic engineering technology. A genetically engineered bacterium producing 1,3-butanediol disclosed in the present invention, with JM109 (DE3) as the starting strain, weakens the citrate synthase gene gltA; knocks out the D-lactate dehydrogenase gene ldhA and the pyruvate dehydrogenase ubiquinone gene poxB; overexpresses the phosphoketolase gene xfp, the phosphotransacetylase gene pta, PhaA, PhaB, Bld*, yqhd, fdh1, nadk, pntA, pntB gene. The genetically engineered bacterium constructed using the present invention produces 1,3-butanediol with high conversion rate, good economy, sustainability and ease of industrial production.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and more particularly to a genetically engineered bacterium for producing 1,3-butanediol and its application. Background Art

[0002] The molecular formula of 1,3-Butanediol is C4H 10 O2, with a chemical formula weight of 90.121, is a four-carbon diol widely used as a solvent in cosmetics and a monomer in the polymer industry. 1,3-Butanediol can also be used as a precursor for the direct synthesis of butadiene, which is then used in the manufacture of chemicals such as synthetic rubber, latex, and resins. Furthermore, R-type 1,3-Butanediol is an important intermediate in the synthesis of fragrances, insecticides, pheromones, and β-lactam antibiotics.

[0003] Currently, 1,3-butanediol is primarily produced by chemical synthesis. However, this method suffers from issues such as non-renewable petroleum-based feedstocks, numerous byproducts, low optical purity, and environmental pollution. Therefore, there is a need to develop a biosynthetic technology for 1,3-butanediol that offers high conversion rates, good economic efficiency, sustainability, and ease of industrial production.

[0004] Therefore, providing a genetically engineered bacterium that produces 1,3-butanediol and its application is an urgent problem that needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a genetically engineered bacterium for producing 1,3-butanediol and its application. The bacterium is a genetically engineered bacterium for producing 1,3-butanediol with high conversion rate and high yield. The production of 1,3-butanediol using the genetically engineered bacterium has high conversion rate, good economy and is easy for industrial production.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A genetically engineered bacterium that produces 1,3-butanediol,

[0008] Using JM109(DE3) as the starting strain, the citrate synthase gene gltA was weakened;

[0009] Knockout of the D-lactate dehydrogenase gene ldhA and the pyruvate dehydrogenase [ubiquinone] gene poxB;

[0010] Overexpression of the phosphoketolase gene xfp and the phosphotransacetylase genes pta, PhaA, PhaB, Bld*, yqhd, fdh1, nadk, pntA, and pntB to obtain the recombinant strain VT0006;

[0011] The pCDF-tbytp plasmid carries the PhaA, PhaB, Bld*, and yqhd genes; the pACYC-fnp plasmid carries the fdh1, nadk, pntA, and pntB genes;

[0012] For the pCDF-tbytp plasmid and the pACYC-fnp plasmid, please refer to the Chinese patent application number 202111158898.1;

[0013] The weakened citrate synthase gene gltA is to replace the upstream UTR sequence of the citrate synthase gene gltA with the UTR-1 sequence; the UTR sequence is shown in SEQ ID NO.4; the UTR-1 sequence is shown in SEQ ID NO.1;

[0014] The nucleotide sequence of the phosphoketolase gene xfp is shown in SEQ ID NO.34;

[0015] The nucleotide sequence of the phosphotransacetylase gene pta is shown in SEQ ID NO.39.

[0016] Furthermore, the genetically engineered bacteria producing 1,3-butanediol also includes overexpressing the glucose-6-phosphate dehydrogenase gene zwf and the 6-phosphogluconate dehydrogenase gene gnd; obtaining the recombinant strain VT0007;

[0017] The nucleotide sequence of the glucose-6-phosphate dehydrogenase gene zwf is shown in SEQ ID NO.44;

[0018] The nucleotide sequence of the 6-phosphogluconate dehydrogenase gene gnd is shown in SEQ ID NO.45.

[0019] Furthermore, the genetically engineered bacteria producing 1,3-butanediol further comprises a gene apfdh* that overexpresses a formate dehydrogenase mutant; obtaining a recombinant strain VT0008;

[0020] The nucleotide sequence of the gene apfdh* of the formate dehydrogenase mutant is shown in SEQ ID NO.46.

[0021] Furthermore, the genetically engineered bacteria producing 1,3-butanediol further comprises overexpressing the polyphosphate kinase gene ppk to obtain the recombinant strain VT0009;

[0022] The nucleotide sequence of the polyphosphate kinase gene ppk is shown in SEQ ID NO.57.

[0023] Furthermore, the genetically engineered bacteria producing 1,3-butanediol also includes knocking out the pyruvate dehydrogenase complex inhibitor gene pdhR to obtain the recombinant strain VT0011.

[0024] Furthermore, the genetically engineered bacteria producing 1,3-butanediol also includes knocking out the ATP-dependent 6-phosphofructokinase isoenzyme 2 gene pfkB to obtain the recombinant strain VT0013.

[0025] Furthermore, the genetically engineered bacteria producing 1,3-butanediol also includes knocking out the glyceraldehyde-3-phosphate dehydrogenase A gene gapA to obtain the recombinant strain VT0015.

[0026] Furthermore, in the genetically engineered bacteria producing 1,3-butanediol, the Bld* gene is replaced with the Bld** gene to obtain the recombinant strain VT0016;

[0027] The nucleotide sequence of the Bld** gene is shown in SEQ ID NO.92.

[0028] Furthermore, in the genetically engineered bacteria producing 1,3-butanediol, the PhaA gene is replaced with the PhaA* gene, and the PhaB gene is replaced with the PhaB* gene; and the recombinant strain VT0017 is obtained;

[0029] The nucleotide sequence of the PhaA* gene is shown in SEQ ID NO.97;

[0030] The nucleotide sequence of the PhaB* gene is shown in SEQ ID NO.98.

[0031] Furthermore, the genetically engineered bacteria are used in high-yield 1,3-butanediol.

[0032] It can be seen from the above technical solution that, compared with the prior art, the present invention discloses a genetically engineered bacterium for producing 1,3-butanediol and its application. The obtained genetically engineered bacterium is a genetically engineered bacterium with high 1,3-butanediol production. The production of 1,3-butanediol using the genetically engineered bacterium has a high conversion rate, good economy, sustainability and is easy to industrialize. DETAILED DESCRIPTION

[0033] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0034] Example 1 Module 1: Construction of a metabolic engineering platform centered around acetyl CoA and cofactors

[0035] 1. Discontinuation of collateral pathways

[0036] 1.1 Replace the upstream UTR sequence of the citrate synthase gene gltA to reduce acetyl-CoA diversion

[0037] Using the genome of Escherichia coli K-12 as a template, PCR amplification was performed on the 500 bp upstream (as shown in SEQ ID NO.3) of the citrate synthase gene gltA (as shown in SEQ ID NO.2) using primers do-gltA-F1 / R1 carrying the UTR-1 sequence (as shown in SEQ ID NO.1), replacing the native UTR sequence (as shown in SEQ ID NO.4) to obtain the do-gltA-1 gene fragment.

[0038] PCR amplification system: PrimeSTAR Premix 25 µL, upstream primer 2 µL, downstream primer 2 µL, template 1 µL, ddH2O 20 µL.

[0039] PCR amplification program: 98°C for 3 min; 98°C for 10 s, 58°C for 15 s, 72°C for 1 min / 1 kb, 34 cycles; 72°C for 10 min; 12°C hold.

[0040] Using the genome of Escherichia coli K-12 as a template, PCR amplification was performed on the 500 bp downstream of the citrate synthase gene gltA (as shown in SEQ ID NO. 5) using primers do-gltA-F2 / R2 to obtain the do-gltA-2 gene fragment.

[0041] Using the do-gltA-1 gene fragment and the do-gltA-2 gene fragment as templates, PCR amplification was performed using primers do-gltA-F1 / R2 to obtain the gltA homology arm do-gltA gene fragment (as shown in SEQ ID NO.6).

[0042] Using plasmid pECgRNA as a template, primers gRNA-gltA-F / gRNA-R were used for amplification to obtain the DNA fragment gRNA-gltA (SEQ ID NO. 7).

[0043] The primer sequences used are as follows:

[0044] do-gltA-F1:5'- CGCTGGGTGGCTCGGGAT -3'; SEQ ID NO.8.

[0045] do-gltA-R1:5'-GCAATAGCTCAAAGGAGCATCAGCA CGTAAGACTGCCGGAACTTAAAT -3'; SEQ ID NO.9.

[0046] do-gltA-F2:5'-TGCTGATGCTCCTTTGAGCTATTGC ATGGCTGATACAAAAGCAAAACTCACC -3'; SEQ ID NO.10.

[0047] do-gltA-R2:5'- GACAGCAGGCGGAACGCG -3'; SEQ ID NO.11.

[0048] gRNA-gltA-F: 5'- GGACTAGTAGCAAAACTCACCCTCAACGGTTTTAGAGCTAGAAATAGCAAGTT -3'; SEQ ID NO.12.

[0049] gRNA-R: 5'- CCGCTCGAGTAGGGATAACAGGGT -3'; SEQ ID NO.13.

[0050] The DNA fragment gRNA-phdR and plasmid pECgRNA were digested with restriction endonucleases speI-HF and Xhol, respectively.

[0051] Enzyme digestion system: DNA fragment gRNA-gltA / plasmid pECgRNA 40 µL, rCutsmart buffer 5 µL, speI-HF 1 µL, Xhol 1 µL, ddH2O 3 µL.

[0052] Enzyme digestion program: 37℃ 15min.

[0053] The DNA fragment gRNA-gltA recovered by enzyme digestion was ligated with the plasmid pECgRNA recovered by enzyme digestion by T4 to obtain plasmid gRNA-gltA.

[0054] Ligation system: T4 DNA Ligase 1 µL, 1 µL, gRNA-gltA DNA fragment recovered by enzyme digestion 2 µL, pECgRNA plasmid recovered by enzyme digestion 1 µL, ddH2O 5 µL.

[0055] Ligation procedure: 22℃ 3h.

[0056] Competent cells of the original strain VT0001 (Escherichia coli JM109 (DE3)) were prepared, and the plasmid gRNA-gltA, plasmid pEcCas9, and do-gltA gene fragment were electroporated into the competent cells of the original strain VT0001 to obtain the recombinant strain VT0002 with the gltA gene knocked out by CRISPR-Cas9.

[0057] The CRISPR-Cas9 gene knockout procedure is as follows:

[0058] First, the pEcCas9 plasmid was electroporated into the VT0001 host strain to be knocked out. Second, the Cas9 protein was expressed under 10 mM arabinose induction to prepare a chassis competent state with the plasmid pEcCas9. Next, the gRNA-gltA plasmid and the do-gltA gene fragment were co-electrotransferred into the above competent state to achieve gene knockout. Finally, one knockout colony was picked and transferred into LB medium containing 10 mM rhamnose and cultured at 37°C and 200 rpm for 12 h to eliminate gRNA-gltA. The colony was then transferred into LB medium containing 10 g / L sucrose and cultured at 37°C and 200 rpm for 12 h to eliminate the pEcCas9 plasmid.

[0059] 1.2 Knockout of the D-lactate dehydrogenase gene ldhA

[0060] Using the genome of Escherichia coli K-12 as a template, PCR amplification was performed on the 500 bp upstream (as shown in SEQ ID NO. 15) of the D-lactate dehydrogenase gene ldhA (as shown in SEQ ID NO. 14) using primers do-ldhA-F1 / R1 to obtain the do-ldhA-1 gene fragment.

[0061] Using the genome of Escherichia coli K-12 as a template, primers do-ldhA-F2 / R2 were used to amplify the 500 bp downstream of the D-lactate dehydrogenase gene ldhA (as shown in SEQ ID NO. 16) by PCR to obtain the do-ldhA-2 gene fragment.

[0062] Using the do-ldhA-1 gene fragment and the do-ldhA-2 gene fragment as templates, PCR amplification was performed using primers do-ldhA-F1 / R2 to obtain the ldhA homology arm do-ldhA gene fragment (as shown in SEQ ID NO. 17).

[0063] Using plasmid pECgRNA as a template, primers gRNA-ldhA-F / gRNA-R were used for amplification to obtain the DNA fragment gRNA-ldhA (SEQ ID NO. 18).

[0064] The primer sequences used are as follows:

[0065] do-ldhA-F1:5'- CAAGCAGAATCAAGTTCTACCGTG -3'; SEQ ID NO.19.

[0066] do-ldhA-R1: 5'-AATGCAGGGAGCGGCAAGA AAGACTTTCTCCAGTGATGTTGAATC -3'; SEQ ID NO.20.

[0067] do-ldhA-F2:5'- TCTTGCCGCTCCCCTGCATTC -3'; SEQ ID NO.21.

[0068] do-ldhA-R2:5'- TGTCTGTTTTGCGGTCGC -3'; SEQ ID NO.22.

[0069] gRNA-ldhA-F: 5'- GGACTAGTGATACGCGCGGTGAATACGGGTTTTAGAGCTAGAAATAGCAAGTT -3'; SEQ ID NO.23.

[0070] gRNA-R: Same as SEQ ID NO.13.

[0071] The DNA fragment gRNA-ldhA and plasmid pECgRNA were digested with restriction endonucleases speI-HF and Xhol, respectively.

[0072] The DNA fragment gRNA-ldhA recovered by enzyme digestion was ligated with the plasmid pECgRNA recovered by enzyme digestion by T4 to obtain plasmid gRNA-ldhA.

[0073] Competent cells of the recombinant strain VT0002 were prepared, and the plasmid gRNA-ldhA, plasmid pEcCas9, and do-ldhA gene fragment were electroporated into the competent cells of the recombinant strain VT0002 to obtain the recombinant strain VT0003 with CRISPR-Cas9 knockout of the ldhA gene.

[0074] 1.3 Knockout of the pyruvate dehydrogenase [ubiquinone] gene poxB

[0075] Using the genome of Escherichia coli K-12 as a template, PCR amplification of the 500 bp upstream (as shown in SEQ ID NO. 25) of the pyruvate dehydrogenase (ubiquinone) gene poxB (as shown in SEQ ID NO. 24) was performed using primers do-poxB-F1 / R1 to obtain the do-poxB-1 gene fragment.

[0076] Using the genome of Escherichia coli K-12 as a template, PCR amplification of the 500 bp downstream of the pyruvate dehydrogenase (ubiquinone) gene poxB (as shown in SEQ ID NO. 26) was performed using primers do-poxB-F2 / R2 to obtain the do-poxB-2 gene fragment.

[0077] Using the do-poxB-1 gene fragment and the do-poxB-2 gene fragment as templates, PCR amplification was performed using primers do-poxB-F1 / R2 to obtain the poxB homology arm do-poxB gene fragment (as shown in SEQ ID NO. 27).

[0078] Using plasmid pECgRNA as a template, primers gRNA-poxB-F / gRNA-R were used for amplification to obtain the DNA fragment gRNA-poxB (SEQ ID NO. 28).

[0079] The primer sequences used are as follows:

[0080] do-poxB-F1:5'- GCGGCCCGGCTCCGTATAT -3'; SEQ ID NO.29.

[0081] do-poxB-R1:5'-GACGGGAAATGCCACCCTTT GGTTCTCCATCTCCTGAATGTGAT -3'; SEQ ID NO.30.

[0082] do-poxB-F2:5'- AAAGGGTGGCATTTCCCGTCAT -3'; SEQ ID NO.31.

[0083] do-poxB-R2:5'- AATTCCCATGCTTCTTTCAGGTATTCCC -3'; SEQ ID NO.32.

[0084] gRNA-poxB-F :5'- GGACTAGTGCCAAAACACTCGAATCGGCGTTTTAGAGCTAGAAATAGCAAGTT -3'; SEQ ID NO.33.

[0085] gRNA-R: Same as SEQ ID NO.13.

[0086] The DNA fragment gRNA-poxB and plasmid pECgRNA were digested with restriction endonucleases speI-HF and Xhol, respectively.

[0087] The DNA fragment gRNA-poxB recovered by enzyme digestion was ligated with the plasmid pECgRNA recovered by enzyme digestion by T4 to obtain plasmid gRNA-poxB.

[0088] Competent cells of the recombinant strain VT0003 were prepared, and the plasmid gRNA-poxB, plasmid pEcCas9, and do-poxB gene fragment were electroporated into the competent cells of the recombinant strain VT0003 to obtain the recombinant strain VT0004 with CRISPR-Cas9 knockout of the poxB gene.

[0089] 2 Construction of the phosphoketolase pathway

[0090] 2.1 Construction of phosphoketolase gene overexpression plasmid and strain

[0091] Using the codon-optimized phosphoketolase gene xfp (as shown in SEQ ID NO. 34) from Clostridium acetobutylicum synthesized by BGI as a template, PCR amplification was performed with primers xfp-ca-F / R to obtain the xfp gene fragment.

[0092] Using plasmid pCOLADuet-1 as a template, primers cola-ca-F / R were used for amplification to obtain linearized plasmid pCOLADuet-1.

[0093] The xfp gene fragment was ligated with the linearized plasmid pCOLADuet-1 by homologous recombination to obtain the plasmid pCOLA-xfpCA.

[0094] The plasmids pCOLA-xfpCA, pACYC-fnp, and pCDF-tbytp were electroporated into competent cells of the recombinant strain VT0004 to obtain a new recombinant strain VT0005.

[0095] The homologous recombination system and procedures are shown in the Beijing Quanshijin Biotechnology Basic Edition Homologous Recombination Seamless Cloning Kit.

[0096] The primer sequences used are as follows:

[0097] xfp-ca-F: 5'-AAGGAGATATACAT ATGCAGAGCATCATTGGTAAGCATAAGG -3'; SEQ ID NO.35.

[0098] xfp-ca-R:5'-GAGATCTGC TTAAACATGCCACTGCCAATTGGTAATTTC -3'; SEQ ID NO.36.

[0099] cola-ca-F: 5'-GGCATGTTTAAGCAGATCTCAATTGGATATCGGCCG-3'; SEQ ID NO. 37.

[0100] cola-ca-R: 5'-GCTCTGCATATGTATATCTCCTTCTTATACTTAACTAATATACTAAGATGGGGAATT-3'; SEQ ID NO. 38.

[0101] Shake flask fermentation of recombinant strain VT0005

[0102] A shake flask fermentation system was used in a 250 mL Erlenmeyer flask. A single colony was inoculated into 4 mL of LB liquid medium and activated at 37°C, 250 rpm, for 12 h to obtain a seed solution. A 1% inoculum of the seed solution (initial OD600 = 0.01) was transferred to M9 medium and cultured at 37°C, 250 rpm, with shaking until the OD600 reached approximately 0.8. 0.05 mM IPTG was added to induce exogenous gene expression. The culture temperature was then adjusted to 30°C and fermentation continued. The time of induction was designated as 0 h. After 48 h of continuous culture, samples were collected to determine 1,3-butanediol production and conversion.

[0103] M9 medium: 30 g / L glucose monohydrate, 5 g / L yeast extract, 11.3 g / L M9 low salt medium (5-fold concentrated), 0.25 g / L MgCl2·7H2O, 0.11 g / L CaCl2, 0.05 g / L EDTA, 8.3 mg / L FeCl2·6H2O, 0.83 mg / L ZnCl2, 0.13 mg / L CuCl2·2H2O, 0.1 mg / L CoCl2·2H2O, 0.1 mg / L H3BO3, 0.016 mg / LMnCl2·4H2O.

[0104] Conversion rate calculation formula:

[0105] Conversion rate = 1,3-butanediol concentration g / L / (initial glucose concentration g / L-residual glucose concentration g / L).

[0106] Fermentation results: 1,3-Butanediol production was 11.18 g / L, and the conversion rate was 0.388 g / g.

[0107] 2.2 Construction of phosphotransacetylase gene overexpression plasmid and strain

[0108] The genome of Escherichia coli (E. coli) K-12 was used as a template to amplify the phosphate acetyltransferase gene pta (shown in SEQ ID NO. 39) by PCR using primers pta-ec-F / R to obtain the pta gene fragment.

[0109] Using plasmid pCOLA-xfpCA as a template, primers co-xpEC-F / R were used for amplification to obtain linearized plasmid pCOLA-xfpCA.

[0110] The PCR amplification system and amplification procedure were the same as above.

[0111] The pta gene fragment was ligated with the linearized plasmid pCOLA-xfpCA by homologous recombination to obtain the plasmid pCOLA-xfpCA-ptaEC.

[0112] The plasmids pCOLA-xfpCA-ptaEC, pACYC-fnp, and pCDF-tbytp were electroporated into competent cells of the recombinant strain VT0004 to obtain a new recombinant strain VT0006.

[0113] The primer sequences used are as follows:

[0114] pta-ec-F:5'-CATGTTTAATAAAGGAGATATACC ATGCTGATCCCTACCGGAACC -3'; SEQ ID NO.40.

[0115] pta-ec-R:5'- TTACTGCTGCTGTGCAGACTGAAT -3'; SEQ ID NO.41.

[0116] co-xpEC-F: 5'-GTCTGCACAGCAGCAGTAAGCAGATCTCAATTGGATATCGGCCG-3'; SEQ ID NO. 42.

[0117] co-xpEC-R: 5'-GGGATCAGCATGGTATATCTCCTTTATTAAACATGCCACTGCCAATTGGTAATTTC-3'; SEQ ID NO. 43.

[0118] Shake flask fermentation of recombinant strain VT0006: The shake flask fermentation system and process were the same as above.

[0119] Fermentation results: 1,3-Butanediol production was 11.98 g / L, and the conversion rate was 0.412 g / g.

[0120] 3 Rational construction of cofactor regeneration networks

[0121] 3.1 Construction of overexpression plasmids and strains for enhanced cofactor NADPH

[0122] Using the genome of Escherichia coli K-12 as a template, the glucose-6-phosphate 1-dehydrogenase gene zwf (shown in SEQ ID NO. 44) was amplified by PCR using primers zwf-F / R to obtain the zwf gene fragment.

[0123] The genome of Escherichia coli K-12 was used as a template, and the 6-phosphogluconate dehydrogenase (decarboxylating) gene gnd (shown as SEQ ID NO. 45) was amplified by PCR using primers gnd-F / R to obtain the gnd gene fragment.

[0124] The gene from Azospirillum palustris ( The apfdh* gene fragment was obtained by PCR amplification using the gene apfdh D222Q-A199G / H380S-C256A / C146S (shown in SEQ ID NO. 46) (hereinafter referred to as apfdh*) of the formate dehydrogenase (Formate dehydrogenase) mutant of the same species as the genotype of the present invention as a template using primers apdfh-F / R.

[0125] Using plasmid pCOLA-xfpCA-ptaEC as a template, primers cola-zg-F / R were used for amplification to obtain the linearized plasmid pCOLA-xfpCA-ptaEC.

[0126] The PCR amplification system and amplification procedure were the same as above.

[0127] The zwf and gnd gene fragments were ligated with the linearized plasmid pCOLA-xfpCA-ptaEC by homologous recombination to obtain the plasmid pCOLA-zgxp.

[0128] The plasmids pCOLA-zgxp, pACYC-fnp, and pCDF-tbytp were electroporated into competent cells of the recombinant strain VT0004 to obtain a new recombinant strain VT0007.

[0129] Using plasmid pACYC-fnp as a template, primers op-apf-F / R were used for amplification to obtain linearized plasmid pACYC-fnp.

[0130] The apfdh* gene fragment was ligated with the linearized plasmid pACYC-fnp by homologous recombination to obtain the plasmid pACYC-fapnp.

[0131] The plasmids pCOLA-zgxp, pACYC-fapnp, and pCDF-tbytp were electroporated into competent cells of the recombinant strain VT0004 to obtain a new recombinant strain VT0008.

[0132] The primer sequences used are as follows:

[0133] zwf-F:5'-GTTTAACTTTAATAAGGAGATATACC ATGGCGGTAACGCAAACAGC -3'; SEQ ID NO.47.

[0134] zwf-R: 5'-TGGACATGTATATCCTTCTCCTT TTACTCAAACTCATTCCAGGAACGACCAT -3'; SEQ ID NO.48.

[0135] gnd-F: 5'-GAGTAAAAGGAGAAGGATATAC ATGTCCAAGCAACAGATCGGCGTAG -3'; SEQ ID NO.49.

[0136] gnd-R: 5'-TCGAATTCGGATCCTGGCT TTAATCCAGCCATTCGGTATGGAACAC -3'; SEQ ID NO.50.

[0137] apfdh-F: 5'-CAAATCACTCGAACAACCTGAATAAAAGGAGAAGGATATAC ATGGCCAAGATTGTGT GTGTTCTGTAT -3'; SEQ ID NO.51.

[0138] apfdh-R:5'- TGCCGGAACTGCTGCTTTAAAAC -3'; SEQ ID NO.52.

[0139] cola-zg-F: 5'-AGCCAGGATCCGAATTCGAGC-3'; SEQ ID NO. 53.

[0140] cola-zg-R: 5'-GGTATATCTCCTTATTAAAGTTAAACAAAATTATTTCTACAGGGGAAT-3'; SEQ ID NO. 54.

[0141] op-apf-F: 5'-TTAAAGCAGCAGTTCCGGCATGCAGGTCGACAAGCTTGCG-3'; SEQ ID NO. 55.

[0142] op-apf-R: 5'-TTATTCAGGTTGTTCGAGTGATTTGATGTAGTCATAAATC-3'; SEQ ID NO. 56.

[0143] Shake flask fermentation of recombinant strains VT0007 and VT0008: The shake flask fermentation system and process were the same as above.

[0144] Fermentation results: The yield of 1,3-butanediol in VT0007 was 12.32 g / L, and the conversion rate was 0.423 g / g; the yield of 1,3-butanediol in VT0008 was 12.60 g / L, and the conversion rate was 0.433 g / g.

[0145] 3.2 Construction of overexpression plasmid and strain for enhanced cofactor ATP

[0146] The polyphosphate kinase gene ppk (shown in SEQ ID NO. 57) was amplified by PCR using the genome of Escherichia coli K-12 as a template using primers ppk-F / R to obtain the ppk gene fragment.

[0147] Using plasmid pACYC-fapnp as a template, primers over-ppk-F / R were used for amplification to obtain linearized plasmid pACYC-fapnp.

[0148] The PCR amplification system and amplification procedure were the same as above.

[0149] The ppk gene fragment was ligated with the linearized plasmid pACYC-fapnp by homologous recombination to obtain the plasmid pACYC-fpapnp.

[0150] The plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tbytp were electroporated into competent cells of the recombinant strain VT0004 to obtain a new recombinant strain VT0009.

[0151] The primer sequences used are as follows:

[0152] ppk-F:5'-AACTTTAATAAGGAGATATA ATGGGTCAGGAAAAGCTATACATCGAAAAAG -3'; SEQ ID NO.58.

[0153] ppk-R: 5'-CGCAAGCTTGTCGACCTGCA TTATTCAGGTTGTTCGAGTGATTTGATGTA -3'; SEQ ID NO.59.

[0154] over-ppk-F: 5'-TGCAGGTCGACAAGCTTGCG-3'; SEQ ID NO. 60.

[0155] over-ppk-R: 5'-CCCATTATATCTCCTTATTAAAGTTTTATTTCTTCTGTCCATAAGCTCTGGTGGC-3'; SEQ ID NO. 61.

[0156] Shake flask fermentation of recombinant strain VT0009: The shake flask fermentation system and process were the same as above.

[0157] Fermentation results: The yield of 1,3-butanediol in VT0009 was 12.75 g / L, and the conversion rate was 0.438 g / g.

[0158] 4. Release of metabolic feedback inhibition nodes

[0159] 4.1 Construction of plasmids and strains to knock out pdhR and relieve feedback inhibition of acetyl-CoA

[0160] Using the genome of Escherichia coli K-12 as a template, 500 bp upstream (as shown in SEQ ID NO. 63) of the pyruvate dehydrogenase complex repressor gene pdhR (as shown in SEQ ID NO. 62) were amplified by PCR using primers do-pdhR-F1 / R1 to obtain the do-pdhR-1 gene fragment.

[0161] Using the genome of Escherichia coli K-12 as a template, 500 bp downstream of the pyruvate dehydrogenase complex repressor gene pdhR (as shown in SEQ ID NO. 64) were amplified by PCR using primers do-pdhR-F2 / R2 to obtain the do-pdhR-2 gene fragment.

[0162] Using the do-pdhR-1 gene fragment and the do-pdhR-2 gene fragment as templates, PCR amplification was performed using primers do-pdhR-F1 / R2 to obtain the pdhR homology arm do-pdhR gene fragment (as shown in SEQ ID NO.65).

[0163] Using plasmid pECgRNA as a template, primers gRNA-pdhR-F / gRNA-R were used for amplification to obtain the DNA fragment gRNA-phdR (SEQ ID NO. 66).

[0164] The primer sequences used are as follows:

[0165] do-pdhR-F1:5'- ATGCGTGTGTAAGTTTGCAATTCCGT -3'; SEQ ID NO.67.

[0166] do-pdhR-R1: 5'-AATTTTTACCAGAAAAATCA GAGTTCCTGTCTTAAGCCACTTGCC -3'; SEQ ID NO.68.

[0167] do-pdhR-F2:5'-TTAAGACAGGAACTC TGATTTTTCTGGTAAAAATTATCCAGAAGATGTTGTAAA TCAAG -3'; SEQ ID NO.69.

[0168] do-pdhR-R2:5'- AAGACTGGAAGGACGCCATATGG -3'; SEQ ID NO.70.

[0169] gRNA-pdhR-F: 5'- GGACTAGTTCAGATTGCCGTCACCGAAGGTTTTAGAGCTAGAAATAGCAAGTT -3'; SEQ ID NO.71.

[0170] gRNA-R: Same as SEQ ID NO.13.

[0171] The DNA fragment gRNA-phdR and plasmid pECgRNA were digested with restriction endonucleases speI-HF and Xhol, respectively.

[0172] Enzyme digestion system: DNA fragment gRNA-phdR / pECgRNA plasmid 40 µL, rCutsmart buffer 5 µL, speI-HF 1 µL, Xhol 1 µL, ddH2O 3 µL.

[0173] Enzyme digestion program: 37℃ 15min.

[0174] The DNA fragment gRNA-phdR recovered by enzyme digestion was ligated with the plasmid pECgRNA recovered by enzyme digestion by T4 to obtain plasmid gRNA-pdhR.

[0175] Ligation system: T4 DNA Ligase 1 µL, 1 µL, gRNA-phdR DNA fragment recovered by enzyme digestion 2 µL, pECgRNA plasmid recovered by enzyme digestion 1 µL, ddH2O 5 µL.

[0176] Ligation procedure: 22℃ 3h.

[0177] The plasmid gRNA-pdhR, plasmid pEcCas9, and do-pdhR gene fragment were electroporated into the competent cells of the recombinant strain VT0004 to obtain the recombinant strain VT0010 with CRISPR-Cas9 knockout of the pdhR gene.

[0178] Competent cells of the recombinant strain VT0010 were prepared, and the plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tbytp were electroporated into competent cells of the recombinant strain VT10 to obtain a new recombinant strain VT0011.

[0179] Shake flask fermentation of recombinant strain VT0011: The shake flask fermentation system and process were the same as above.

[0180] Fermentation results: The yield of 1,3-butanediol in VT0011 was 13.31 g / L, and the conversion rate was 0.458 g / g.

[0181] 5. Optimization of carbon metabolic flux diversion

[0182] 5.1 CRISPR-Cas9 knockout of the pfkB gene

[0183] Using the genome of Escherichia coli K-12 as a template, PCR amplification of the 500 bp upstream (as shown in SEQ ID NO. 73) of the ATP-dependent 6-phosphofructokinase isozyme 2 gene pfkB (as shown in SEQ ID NO. 72) was performed using primers do-pfkB-F1 / R1 to obtain the do-pfkB-1 gene fragment.

[0184] Using the genome of Escherichia coli K-12 as a template, 500 bp downstream of the pfkB gene of ATP-dependent 6-phosphofructokinase isozyme 2 (ATP-dependent 6-phosphofructokinase isozyme 2) (as shown in SEQ ID NO. 74) were amplified by PCR using primers do-pfkB-F2 / R2 to obtain the do-pfkB-2 gene fragment.

[0185] Using the do-pfkB-1 gene fragment and the do-pfkB-2 gene fragment as templates, PCR amplification was performed using primers do-pfkB-F1 / R2 to obtain the pfkB homology arm do-pfkB gene fragment (as shown in SEQ ID NO.75).

[0186] Using plasmid pECgRNA as a template, primers gRNA-pfkB-F / gRNA-R were used for amplification to obtain the DNA fragment gRNA-pfkB (SEQ ID NO. 76).

[0187] The primer sequences used are as follows:

[0188] do-pfkB-F1:5'- ACCAGGTCATGGTGGTGTCAGC -3'; SEQ ID NO.77.

[0189] do-pfkB-R1:5'- CATTTCCTCCTATAGGCTGATTTCAGTCTGG -3'; SEQ ID NO.78.

[0190] do-pfkB-F2:5'-CTGAAATCAGCCTATAGGAGGAAATG CAAAAACATTCCCCCAGCATTGGG -3'; SEQ ID NO.79.

[0191] do-pfkB-R2:5'- ACATGATGTCTCTCCCATGTTGTCTGC -3'; SEQ ID NO.80.

[0192] gRNA-pfkB-F: 5'- GGACTAGTCACGTACATGTGGAAGCAAGGTTTTAGAGCTAGAAATAGCAAGTT -3'; SEQ ID NO.81.

[0193] gRNA-R: Same as SEQ ID NO.13.

[0194] The DNA fragment gRNA-pfkB and plasmid pECgRNA were digested with restriction endonucleases speI-HF and Xhol, respectively.

[0195] The enzyme digestion system and procedure were the same as above.

[0196] The DNA fragment gRNA-pfkB recovered by enzyme digestion was ligated with the plasmid pECgRNA recovered by enzyme digestion by T4 to obtain plasmid gRNA-pfkB.

[0197] The connection system and procedure are the same as above.

[0198] The plasmid gRNA-pfkB, plasmid pECCas9, and do-pfkB gene fragment were electroporated into the competent cells of the recombinant strain VT0010 to obtain the recombinant strain VT0012 with CRISPR-Cas9 knockout of the pfkB gene.

[0199] Competent cells of the recombinant strain VT0012 were prepared, and the plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tbytp were electroporated into the competent cells of the recombinant strain VT0012 to obtain a new recombinant strain VT0013.

[0200] Shake flask fermentation of recombinant strain VT0013: The shake flask fermentation system and process were the same as above.

[0201] Fermentation results: The yield of 1,3-butanediol was 13.68 g / L and the conversion rate was 0.470 g / g.

[0202] 5.2 CRISPR-Cas9 knockout of the gapA gene

[0203] Using the genome of Escherichia coli K-12 as a template, PCR amplification of the 500 bp upstream (as shown in SEQ ID NO. 83) of the glyceraldehyde-3-phosphate dehydrogenase A gene gapA (as shown in SEQ ID NO. 82) was performed using primers do-gapA-F1 / R1 to obtain the do-gapA-1 gene fragment.

[0204] Using the genome of Escherichia coli K-12 as a template, 500 bp downstream of gapA of the glyceraldehyde-3-phosphate dehydrogenase A gene (as shown in SEQ ID NO. 84) were amplified by PCR using primers do-gapA-F2 / R2 to obtain the do-gapA-2 gene fragment.

[0205] The downstream 500 bp fragment of gapA encoding glyceraldehyde-3-phosphate dehydrogenase A from Escherichia coli K-12 is do-gapA-2:

[0206] Using the do-gapA-1 gene fragment and the do-gapA-2 gene fragment as templates, PCR amplification was performed using primers do-gapA-F1 / R2 to obtain the gapA homology arm do-gapA gene fragment (as shown in SEQ ID NO.85).

[0207] Using plasmid pECgRNA as a template, primers gRNA-gapA-F1 / gRNA-R were used for amplification to obtain the DNA fragment gRNA-gapA (SEQ ID NO. 86).

[0208] The primer sequences used are as follows:

[0209] do-gapA-F1:5'- CAGCGGGGCATCGCAGATCAAAC -3'; SEQ ID NO.87.

[0210] do-gapA-R1:5'-TCACAGTGTCATCTCAAC ATATTCCACCAGCTATTTGTTAGTGAATAAAAGGT TG -3'; SEQ ID NO.88.

[0211] do-gapA-F2: 5'-GGTGGAATAT GTTGAGATGACACTGTGATCTAAAAAGAGCG -3'; SEQ ID NO.89.

[0212] do-gapA-R2:5'- CGCTAACAGCGTAAAGTCGTGCG -3'; SEQ ID NO.90.

[0213] gRNA-gapA-F: 5'-GGACTAGTTCTCACAAAGACTGGCGCGGGTTTTAGAGCTAGAAATAGCAAGTT-3'; SEQ ID NO. 91.

[0214] gRNA-R: Same as SEQ ID NO.13.

[0215] The DNA fragment gRNA-gapA and plasmid pECgRNA were digested with restriction endonucleases speI-HF and Xhol, respectively.

[0216] The enzyme digestion system and procedure were the same as above.

[0217] The DNA fragment gRNA-gapA recovered by enzyme digestion was ligated with the plasmid pECgRNA recovered by enzyme digestion by T4 to obtain plasmid gRNA-gapA.

[0218] The connection system and procedure are the same as above.

[0219] The plasmid gRNA-gapA, plasmid pECCas9, and do-gapA gene fragment were electroporated into the competent cells of the recombinant strain VT0012 to obtain the recombinant strain VT0014 with the gapA gene knocked out by CRISPR-Cas9.

[0220] Competent cells of the recombinant strain VT0014 were prepared, and the plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tbytp were electroporated into the competent cells of the recombinant strain VT0014 to obtain a new recombinant strain VT0015.

[0221] Shake flask fermentation of recombinant strain VT0015: The shake flask fermentation system and process were the same as above.

[0222] Fermentation results: The yield of 1,3-butanediol was 14.17 g / L and the conversion rate was 0.487 g / g.

[0223] 6 Continuous fed-batch scale-up experiment in a 5 L fermenter

[0224] 6 L fermentor fermentation process: The fermentor scale-up system uses a 5 L bioreactor for scale-up culture. It is prepared through two-stage seed amplification: the first stage seed is a single colony activation solution cultured in LB liquid medium at 37°C for 12 hours, and the second stage seed is transferred to fresh LB liquid medium at a 2.5% inoculum and continued to culture overnight. The second stage seed is inoculated into TB medium at a 5% inoculum, and this time is marked as 0 hours. When the culture is cultured at 37°C to the mid-to-late logarithmic stage (OD600≈1.5), 0.05 mM IPTG is added for induction. At the same time, the fermentation temperature is maintained at 30°C by a temperature control system. At this time, feeding (800 g / L monohydrate glucose) is started to control the sugar concentration at 10-20 g / L. The total fermentation time is kept within 100 hours.

[0225] TB medium: 20 g / L glucose monohydrate, 24 g / L yeast extract, 12 g / L peptone, 4 mL glycerol, 2.31 g / L KH2PO4, 12.54 g / L K2HPO4.

[0226] The fermentation results of the recombinant strain VT0015 in the fermenter are shown in Table 1.

[0227] Table 1

[0228]

[0229] After 57 h of fermentation, the conversion rate of 1,3-butanediol was 0.462 g / g; after 68 h of fermentation, the conversion rate of 1,3-butanediol was 0.450 g / g.

[0230] 7 Directed evolution and orthogonal assembly of 1,3-butanediol synthesis modules

[0231] 7.1 Directed evolution to obtain the butyraldehyde dehydrogenase mutant Bld D113N

[0232] The codon-optimized butyraldehyde dehydrogenase mutant gene bld from Clostridium saccharoperbutylacetonicum N1-4 (HMT) synthesized by BGI D113N / L273T (as shown in SEQ ID NO.92, hereinafter referred to as bld**) was used as a template and primers bld**-F / R were used for PCR amplification to obtain the bld** gene fragment.

[0233] Using plasmid pCDF-tbytp as a template, primers cdf-bld**-F / R were used for amplification to obtain linearized plasmid pCDF-tbytp.

[0234] The bld** gene fragment was ligated with the linearized plasmid pCDF-tbytp by homologous recombination to obtain the plasmid pCDF-tb**ytp.

[0235] The plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tb**ytp were electroporated into competent cells of the recombinant strain VT0014 to obtain a new recombinant strain VT0016.

[0236] The homologous recombination system and procedures are shown in the Beijing Quanshijin Biotechnology Basic Edition Homologous Recombination Seamless Cloning Kit.

[0237] The primer sequences used are as follows:

[0238] bld**-F: 5'-ATGATTAAAGATACCCTGGTTAGCATCACG-3'; SEQ ID NO. 93.

[0239] bld**-R: 5'-TTTAACCAGCCAGTACGCAGC-3'; SEQ ID NO. 94.

[0240] cdf-bld**-F: 5'-GCGTACTGGCTGGTTAAAAGGAGATATACCATGAACAACTTTAATCT-3'; SEQ ID NO.95.

[0241] cdf-bld**-R: 5'-CTAACCAGGGTATCTTTAATCATGTATATCCTTCTCCTTAAAGTTAAACAAAATTATTTCTAG-3'; SEQ ID NO. 96.

[0242] Shake flask fermentation of recombinant strain VT0016: The shake flask fermentation system and process were the same as above.

[0243] Fermentation results: The yield of 1,3-butanediol was 14.94 g / L and the conversion rate was 0.515 g / g.

[0244] 7.2 Orthogonal assembly of the acetyl-CoA acetyltransferase mutant PhaA F219Y and the acetoacetyl-CoA reductase mutant PhaB Q47L

[0245] The codon-optimized acetyl-CoA acetyltransferase mutant gene phaA from Cupriavidus necator ATCC 17699 synthesized by BGI F219Y(as shown in SEQ ID NO.97, hereinafter referred to as phaA*) was used as a template and PCR amplification was performed using primers 219-F / R to obtain the phaA* gene fragment.

[0246] The codon-optimized acetoacetyl-CoA reductase mutant gene phaB from Cupriavidus necator ATCC 17699 synthesized by BGI Q47L (as shown in SEQ ID NO.98, hereinafter referred to as phaB*) was used as a template and PCR amplification was performed using primers 47-F / R to obtain the phaB* gene fragment.

[0247] Using plasmid pCDF-tb**ytp as a template, primers p**-F / R were used for amplification to obtain linearized plasmid pCDF-tb**ytp.

[0248] The phaA* gene fragment and the phaB* gene fragment were ligated with the linearized plasmid pCDF-tb**ytp by homologous recombination to obtain the plasmid pCDF-tb**ytp**.

[0249] The plasmids pCOLA-zgxp, pACYC-fpapnp, and pCDF-tb**ytp** were electroporated into competent cells of the recombinant strain VT0014 to obtain a new recombinant strain VT0016.

[0250] The homologous recombination system and procedures are shown in the Beijing Quanshijin Biotechnology Basic Edition Homologous Recombination Seamless Cloning Kit.

[0251] The primer sequences used are as follows:

[0252] 219-F:5'-CGGCTTACATATGGGCTAAAGGAGATATACC ATGACTGACGTTGTTATTGTTTCCG -3'; SEQ ID NO.99.

[0253] 219-R: 5'- TTATTTACGCTCTACGGCCAGTGC -3'; SEQ ID NO.100.

[0254] 47-F: 5'-AGAAATAATTTTGTTTAACTTTAAGGAGAAGGATATAC ATGACCCAGCGCATTGCGT -3'; SEQ ID NO.101.

[0255] 47-R: 5'- TTAGCCCATATGTAAGCCGCC -3'; SEQ ID NO.102.

[0256] p**-F: 5'-CTGGCCGTAGAGCGTAAATAACGAATTCGAGCTCCGTCGAC-3'; SEQ ID NO. 103.

[0257] p**-R: 5'-GTATATCCTTCTCCTAAAGTTAAACAAAATTATTTCT-3'; SEQ ID NO. 104.

[0258] Shake flask fermentation of recombinant strain VT0017: The shake flask fermentation system and process were the same as above.

[0259] Fermentation results: The yield of 1,3-butanediol was 15.29 g / L, and the conversion rate was 0.527 g / g, reaching 105% of the theoretical conversion rate.

[0260] The reaction formula for the maximum conversion of glucose to 1,3-butanediol in strains VT001~VT004 is:

[0261] 1 Glucose+3 NADPH→1 1,3-BDO+4 NADH+2 ATP+2 CO2

[0262] Therefore, the theoretical conversion rate = (1 mol 1,3-BDO*M1) / (1 mol Glucose*M2) = 0.5 g / g.

[0263] The reaction formula for the maximum conversion of glucose to 1,3-butanediol in strains VT004~VT017 is:

[0264] Glu+ATP→1.09 1,3-BDO+1.64 CO2

[0265] Therefore, the new theoretical conversion = (1.09 mol 1,3-BDO*M1) / (1 mol Glucose*M2) = 0.545 g / g.

[0266] Where M1 is the molar mass of 1,3-BDO, which is 90 g / mol; M2 is the molar mass of glucose, which is 180 g / mol.

[0267] 8 Continuous fed-batch scale-up experiment in a 5 L fermenter

[0268] The fermentation results of the recombinant strain VT0017 in the fermenter are shown in Table 2.

[0269] Table 2

[0270]

[0271] The conversion rate of 1,3-butanediol was 0.470 g / g at 57 h of fermentation and 0.465 g / g at 67 h of fermentation.

[0272] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A genetically engineered bacterium producing 1,3-butanediol, characterized in that: Using JM109(DE3) as the starting strain, the citrate synthase gene gltA was weakened; Knockout of the D-lactate dehydrogenase gene ldhA and the pyruvate dehydrogenase-ubiquinone gene poxB; Overexpression of phosphoketolase gene xfp, phosphotransacetylase genes pta, PhaA, PhaB, Bld*, yqhd, fdh1, nadk, pntA, and pntB genes; The weakened citrate synthase gene gltA is to replace the upstream UTR sequence of the citrate synthase gene gltA with the UTR-1 sequence; the UTR sequence is shown in SEQ ID NO.4; the UTR-1 sequence is shown in SEQ ID NO.1; The nucleotide sequence of the phosphoketolase gene xfp is shown in SEQ ID NO.34; The nucleotide sequence of the phosphotransacetylase gene pta is shown in SEQ ID NO.

39.

2. A genetically engineered bacterium producing 1,3-butanediol according to claim 1, characterized in that: It also includes overexpression of the glucose-6-phosphate dehydrogenase gene zwf and the 6-phosphogluconate dehydrogenase gene gnd; The nucleotide sequence of the glucose-6-phosphate dehydrogenase gene zwf is shown in SEQ ID NO.44; The nucleotide sequence of the 6-phosphogluconate dehydrogenase gene gnd is shown in SEQ ID NO.

45.

3. A genetically engineered bacterium for producing 1,3-butanediol according to claim 2, characterized in that: Also included are the genes apfdh* that overexpress a formate dehydrogenase mutant; The nucleotide sequence of the gene apfdh* of the formate dehydrogenase mutant is shown in SEQ ID NO.

46.

4. A genetically engineered bacterium for producing 1,3-butanediol according to claim 3, characterized in that: It also includes overexpression of the polyphosphate kinase gene ppk; The nucleotide sequence of the polyphosphate kinase gene ppk is shown in SEQ ID NO.

57.

5. A genetically engineered bacterium for producing 1,3-butanediol according to claim 4, characterized in that: It also includes knocking out the pyruvate dehydrogenase complex repressor gene pdhR.

6. A genetically engineered bacterium for producing 1,3-butanediol according to claim 5, characterized in that: It also includes knocking out the ATP-dependent 6-phosphofructokinase isoenzyme 2 gene pfkB.

7. A genetically engineered bacterium for producing 1,3-butanediol according to claim 6, characterized in that: It also includes knocking out the glyceraldehyde-3-phosphate dehydrogenase A gene gapA.

8. A genetically engineered bacterium for producing 1,3-butanediol according to claim 7, characterized in that: Replace the Bld* gene with the Bld** gene; The nucleotide sequence of the Bld** gene is shown in SEQ ID NO.

92.

9. A genetically engineered bacterium for producing 1,3-butanediol according to claim 8, characterized in that: Replace the PhaA gene with the PhaA* gene, and replace the PhaB gene with the PhaB* gene; The nucleotide sequence of the PhaA* gene is shown in SEQ ID NO.97; The nucleotide sequence of the PhaB* gene is shown in SEQ ID NO.

98.

10. Use of the genetically engineered bacteria according to any one of claims 1 to 9 in high-yield 1,3-butanediol.

Images