Promoter for increasing transcription level of glycineamide ribonucleotide transformylase gene and application thereof
Patent Information
- Application Number
- CN202610132678.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-30
- Publication Date
- 2026-05-29
AI Technical Summary
In the prior art, the promoter efficiency for efficient expression of glycine nucleotide transformylase in microorganisms is low, which limits the yield of nucleotide products, and the selection of model strains is also crucial for improving expression.
We developed a potent promoter adapted to the glycine nucleotide transformylase gene. By performing specific nucleotide mutations on the Psod and Peftu promoters, we constructed a promoter library and screened for the highly efficient promoters PpurNH4 and PpurNH5, which were used to express the glycine nucleotide transformylase gene in Corynebacterium tumefaciens.
It significantly improved the transcription level of glycine nucleotide transformylase, enhanced the metabolic flux of nucleotide products, and increased the expression activity of α-amylase, thus achieving efficient production of nucleotide and purine products.
Smart Images

Figure CN122104695A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to promoters that can improve the transcription level of glycine nucleotide transformylase gene and their applications. Background Technology
[0002] Nucleotides are precursors to DNA and RNA synthesis, playing a crucial role in cell structure, energy production and consumption, metabolism, and functional regulation. Due to their many unique and important properties and functions, nucleotides have a wide range of applications, including in the food, agriculture, medical, animal feed, and fine chemical industries. The de novo nucleotide synthesis pathway involves the fermentation of nucleotides by microbial strains using simple substances such as phosphoribose, amino acids, and one-carbon units as raw materials. This pathway includes the synthesis of IMP (inosine monophosphate); the generation of AMP (adenine monophosphate) and GMP (guanine monophosphate) from IMP; and the phosphorylation of monophosphate nucleosides to generate diphosphate and triphosphate nucleosides. The IMP synthesis pathway in the de novo nucleotide synthesis pathway is illustrated below. Figure 1 As shown, the de novo synthesis of IMP involves 11 steps: (1) activation of 5-phosphate ribose; (2) acquisition of the N9 atom of purine; (3) acquisition of the C4, C5, and N7 atoms of purine; (4) acquisition of the C8 atom of purine; (5) acquisition of the N3 atom of purine; (6) formation of the purine imidazole ring; (7) acquisition of the C6 atom of purine; (8) acquisition of the N1 atom; (9) removal of fumaric acid; (10) acquisition of C2; and (11) cyclization to generate IMP. This synthetic pathway involves the participation of several key enzymes. Phosphoribosylglycinamide formyltransferase [EC:2.1.2.2] is the fourth step in the de novo synthesis of IMP and is responsible for catalyzing the conversion of glycinamide nucleotide (GAR) to formylglycinamide nucleotide (FGAR). The titer of the nucleotide end product can be increased by increasing its expression level.
[0003] With the development of metabolic engineering and synthetic biology, various methods have been developed for the high-titer production of target products by microorganisms. Among these, promoter engineering has become a key technology for regulating gene expression and optimizing the biosynthetic pathways of target products, and is widely used in the metabolic engineering modification of microorganisms. Promoters are important elements regulating gene expression; they are located in the non-coding region upstream of the 5' end of structural genes and are DNA fragments specifically recognized and bound by RNA polymerases. Promoter activity is affected by various factors, and in heterologous gene expression, promoters with different activities are often selected according to actual needs. Currently, there are few reported promoters that can be used for efficient expression of glycine nucleotide transformylase, and universal promoters used for endogenous expression of glycine nucleotide transformylase suffer from low expression efficiency. Furthermore, the selection of model strains is also crucial, which is one of the factors limiting the improvement of glycine nucleotide transformylase expression. Summary of the Invention
[0004] The purpose of this invention is to explore methods to enhance the expression of glycine nucleotide transformylase, thereby increasing the yield of nucleotide products, and further providing promoters and applications that can improve the transcription level of glycine nucleotide transformylase genes.
[0005] In the fermentation production of nucleotide products, increasing the gene expression levels of key enzymes in the metabolic pathway, i.e., the de novo nucleotide synthesis pathway, is one of the important methods to improve the titer of the final product. Glycine nucleotide transformylase (purNH gene) is the fourth key enzyme in the de novo synthesis pathway, and its expression level can be increased through promoter engineering. The two core issues addressed in this invention for improving the expression level of glycine nucleotide transformylase are: first, the selection of the model strain; and second, the screening of the promoter. Corynebacterium is an important genus of bacteria, and many Corynebacterium species serve as industrial model strains for the efficient production of various proteins and metabolites. Among them, *Corynebacterium tarda* is currently the main microbial strain used in the industrial fermentation production of nucleosides. Therefore, this invention initially selects *Corynebacterium tarda* as the model strain.
[0006] However, the number of potent constitutive promoters available in Corynebacterium tumefaciens is very limited. Psod and Peftu are the most commonly used promoters in Corynebacterium tumefaciens, but their activation efficiency for the target gene is affected by the sequence at the 5' end of the coding region and the different target genes they are linked to. This invention found that applying these two promoters to Corynebacterium tumefaciens resulted in low expression efficiency of endogenous glycine nucleotide transformylase, leading to low titers of nucleotide end products in the de novo synthesis pathway. Therefore, it is necessary to develop potent promoters adapted to the target gene.
[0007] To achieve the above technical objectives, the technical solution adopted in this application is as follows: In a first aspect, the present invention provides a promoter that can improve the transcriptional level of the glycine nucleotide transformylase gene, said promoter being obtained by at least one of the following mutations based on the sequence shown in SEQ ID NO:1: 1) Nucleotides 6-11, 18, 20, 22-23, 25, 31-36, 38, 40, 42-44, and 46 mutate from gataag, t, t, tt, c, ggagga, a, a, tgg, g to AGGTCA, G, C, GC, T, ACCCTT, T, T, GTA, T; 2) Nucleotides 7, 9-11, 18-22, 25-30, 32-34, 36, 38-39, 42-44, and 46-47 mutate from A, AAG, TCTTT, CGTGGT, GAG, A, AA, TGG, and GG to T, GGC, GAAAC, TTCCTC, AGT, T, GG, GAT, and AC.
[0008] Preferably, the promoter has a nucleotide sequence as described in any one of the following, or a nucleotide sequence having more than 70% homology with a nucleotide sequence as described in any one of the following and possessing promoter activity: 1) The sequence shown in SEQ ID NO:2; 2) The sequence shown in SEQ ID NO: 3.
[0009] More preferably, the promoter has a nucleotide sequence that is more than 90% homologous to the sequence shown in SEQ ID NO:2 or SEQ ID NO:3 and has promoter activity.
[0010] In a second aspect, the present invention provides a glycine nucleotide transformylase gene expression cassette, comprising the promoter described in the first aspect and a glycine nucleotide transformylase gene located downstream of the promoter.
[0011] Thirdly, the present invention provides a recombinant vector comprising the glycine nucleotide transformylase gene expression cassette described in the second aspect.
[0012] Preferably, the recombinant vector is expressed in Corynebacterium truncatum.
[0013] More preferably, the Corynebacterium stagnantum is selected from Corynebacterium stagnantum ATCC 6872 or its derivative strains.
[0014] Fourthly, the present invention provides a genetically engineered bacterium containing the promoter described in the first aspect, the glycine nucleotide transformylase gene expression cassette described in the second aspect, or the recombinant vector described in the third aspect.
[0015] Fifthly, the present invention provides the use of the promoter described in the first aspect, or the glycine nucleotide transformylase gene expression cassette described in the second aspect, or the recombinant vector described in the third aspect, or the genetically engineered bacteria described in the fourth aspect in at least one of the following: 1) increasing the transcription level of the glycine nucleotide transformylase gene; 2) increasing the expression activity of the α-amylase gene; 3) producing nucleotide products.
[0016] Preferably, the application uses Corynebacterium catarrhalis as the expression strain.
[0017] More preferably, the Corynebacterium stagnantum is selected from Corynebacterium stagnantum ATCC 6872 or its derivative strains.
[0018] Compared with the prior art, the present invention has the following beneficial effects: Firstly, the promoter of this invention is screened for the glycine nucleotide transformylase gene. Compared with the original promoter or the known potent promoter Psod, the promoter of this invention can enhance the transcriptional level of glycine nucleotide transformylase, thereby promoting the expression of glycine nucleotide transformylase in Corynebacterium tarda, and thus increasing the metabolic flux of nucleotide products.
[0019] Secondly, the promoter of this invention can enhance the expression of α-amylase amyE gene from heterologous genes such as Bacillus subtilis subsp. subtilisstr.168 in Corynebacterium tumefaciens, achieving α-amylase activity that is 2.4 times that of the original promoter PpurNH, 1.7 times that of the existing strong promoter Psod, and 1.5 times that of Peftu, respectively. Therefore, the promoter provided by this invention can be used as a universal promoter and has strong industrial applicability. Attached Figure Description
[0020] Figure 1 This is the first stage of the de novo nucleotide synthesis pathway: the synthesis of IMP (hypoxanthine nucleotide).
[0021] Figure 2 (A) shows the sequence of the original promoter PpurNH; (B) shows the design and construction strategy of the PpurNH promoter library.
[0022] Figure 3 The image shows a comparison of the fluorescence intensity of sfGFP started by the promoter mutant prepared in Example 1, the original promoter, and a known strong promoter.
[0023] Figure 4This is a comparison of the transcriptional levels of the glycine nucleotide transformylase gene in *Corynebacterium ATCC 6872 / pEC-PpurNH-purNH*, *Corynebacterium ATCC 6872 / pEC-Psod-purNH*, *Corynebacterium ATCC 6872 / pEC-Peftu-purNH*, *Corynebacterium ATCC 6872 / pEC-PpurNH4-purNH*, and *Corynebacterium ATCC 6872 / pEC-PpurNH5-purNH* in Example 2. Detailed Implementation
[0024] In this embodiment of the invention, the culture medium formulation is as follows: 1) LB seed culture medium: 1% peptone, 0.5% yeast extract, 1% NaCl, and the remainder is water.
[0025] 2) LB solid medium: 1% peptone, 0.5% yeast extract, 1% NaCl, 50ug / mL kanamycin, 2% agarose, and the remainder is water.
[0026] 3) Fermentation medium: 20 g / L glucose; 3 g / L urea; 2 g / L NH4Cl; 1 g / L KH2PO4; 3 g / L K2HPO4; 5 g / L asparagine; 0.04 g / L L-cysteine; 0.001 g / L MnSO4·H2O; 0.001 g / L ZnSO4·7H2O; 2 × 10⁻⁶ -4 g / L CuSO4·2H2O; 0.02 g / L calcium pantothenate; 0.01 g / L CaCl2; 0.3 g / L MgSO4; 0.01 g / L FeSO4·7H2O; 6 × 10 -5 g / L biotin; 0.01 g / L thiamine-HCl, balance water.
[0027] In this embodiment of the invention, plasmid pEC-XK99E: can be synthesized by a commercial company based on the sequence of NCBI GenBank number AY219683.1 (update: 05-SEP-2003).
[0028] In this embodiment of the invention, all primer synthesis and sequencing were outsourced to a gene technology company in Guangzhou.
[0029] In this embodiment of the invention, pSenPutsfGFP is a plasmid containing the superfolded green fluorescent protein sfGFP gene, which is derived from: Development of a Transcription Factor-Based Diamine Biosensor in Corynebacterium glutamicum. Nanna Zhao, etc. ACSSynth. Biol. 2021, 10, 11, 3074-3083.
[0030] In this embodiment of the invention, the GenBank number of phosphoribosylglycinamideformyltransferase [EC:2.1.2.2] is AW169_RS09505.
[0031] In this embodiment of the invention, Corynebacterium tumefaciens ATCC 6872, GenBank accession number GCA_001561975.1, was used.
[0032] See Figure 2 To improve the compatibility between the promoter and the glycine nucleotide transformylase gene, this invention constructs a promoter library using the original promoter (named PpurNH) in the glycine nucleotide transformylase gene genome as a template. Using sfGFP as a reporter protein, a 180bp sequence from the 5' end of the glycine nucleotide transformylase gene is added before the reporter protein sfGFP via the GGGGS linker. In this way, potent promoters are screened to significantly increase the expression of the glycine nucleotide transformylase gene.
[0033] The sequence of the original promoter PpurNH is shown in SEQ ID NO:1: gaggggataagttgtcctcttttccgtggtggaggaaaaattggcggcatcgtttcgtcctcgaaagggctacagactagtctttaacac.
[0034] Furthermore, the promoter sequences of the present invention can be modified by conventionally known mutagenesis. Therefore, the promoter may include, but is not limited to, any nucleotide sequence having 70% or higher, specifically 80% or higher, more specifically 90% or higher, even more specifically 95% or higher, even more specifically 98% or higher, and most specifically 99% or higher homology to the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:3, and having similar promoter activity. Any nucleotide sequence having the above-mentioned homology, wherein a portion of the sequence is deleted, modified, substituted, or inserted, should be understood to be included within the scope of the nucleic acid molecules of the present invention, provided that the sequence has promoter activity.
[0035] In this invention, promoter activity refers to the ability of a promoter to initiate the transcription of a target gene.
[0036] For example, polynucleotides that have a meaningless sequence added inside or at the end of the corresponding SEQ ID NO: 2 or SEQ ID NO: 3 nucleotide sequence, or that have a partial sequence deleted inside or at the end of the corresponding SEQ ID NO: 2 or SEQ ID NO: 3 nucleotide sequence, are obviously also included in the scope of this invention, as long as they have the same or corresponding activity as the polynucleotide.
[0037] The promoter of this invention is screened for the glycine nucleotide transformylase gene and can also be used to express other target genes, thus serving as a universal promoter.
[0038] Another aspect of the present invention provides a glycine nucleotide transformylase gene expression cassette, which includes the aforementioned promoter and a glycine nucleotide transformylase gene located downstream thereof.
[0039] Another aspect of the present invention provides a recombinant vector comprising the above-described glycine nucleotide transformylase gene expression cassette, preferably a recombinant vector suitable for expression in Corynebacterium telogen efflux.
[0040] In another aspect, the present invention provides an engineered strain of Corynebacterium tarda, which comprises the above-described promoter, or the above-described glycine nucleotide transformylase gene expression cassette, or the above-described recombinant vector.
[0041] The method for constructing the above-mentioned engineered Corynebacterium tumefaciens may include the following steps: Using gene editing technology, 90 bases upstream of the glycine nucleotide transformylase gene (GTG) promoter in the genome of Corynebacterium telogen efflux were replaced with the promoter described in SEQ ID NO: 2 or SEQ ID NO: 3, and positive clones were screened. Alternatively, gene editing technology can be used to integrate the aforementioned glycine nucleotide transformylase expression cassette into the genome of Corynebacterium truncatum and screen for positive clones. Alternatively, a plasmid containing a glycine nucleotide transformylase gene expression cassette can be transformed into competent cells of Corynebacterium telogen efflux and positive clones can be screened.
[0042] The aforementioned gene editing technologies can employ systems such as Cre / loxp, CRISPR / Cas9, and CRISPR / Cpf1.
[0043] The term "transformation" refers to the process of introducing a vector containing a polynucleotide encoding a target protein into a host cell, thereby enabling the expression of the protein-encoded polynucleotide within the host cell. Transformation methods may include any method capable of introducing nucleic acids into cells, and transformation can be performed according to the host cell by selecting appropriate standard techniques known in the art, such as electroporation, but are not limited thereto.
[0044] Furthermore, in the description of this invention, it should be noted that unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0045] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These descriptions are for illustrative purposes only and are not intended to limit the scope of the invention.
[0046] Example 1: The preparation of promoter mutants is as follows: (1) Construction of plasmids characterized by promoter strength Using the Escherichia coli-Corynebacterium shuttle plasmid pEC-XK99E (NCBI Gen Bank number AY219683.1, synthesized by a commercial company) as a template, the plasmid backbone DNA fragment was amplified using pEC-XK99E1-S and pEC-XK99E1-A primers; the sfGFP fragment was amplified using PSenPutsfGFP as a template and sfGFP-S and sfGFP-A primers. The two fragments were ligated using a commercially available one-step recombinant cloning kit to obtain the pEC-XK99E-sfGFP vector. Using the recombinant plasmid pEC-XK99E-sfGFP as a template, and pEC-XK99E-S and pEC-XK99E-A as primers, the DNA fragments of the plasmid backbone and the superfolded green fluorescent protein gene were amplified. Using the Corynebacterium stationis ATCC 6872 genome as a template, and purNH-S and purNH-A as primers, the DNA fragments of the PpurNH promoter (nucleotide sequence as shown in SEQ ID NO:2) and the first 180 bp of the purNH gene were amplified. The two fragments were then ligated using a one-step recombinant cloning kit to obtain the pEC-PpurNH-sfGFP recombinant plasmid.
[0047] Using the recombinant plasmid pEC-PpurNH-sfGFP as a template, and pEC-XK99EN-S and pEC-XK99E-A as primers, the vector fragments were amplified. These fragments were then used for one-step recombination cloning with the Psod fragment amplified from Psod-S and Psod-purNH-A, and the Peftu fragment amplified from Peftu-S and Peftu-purNH-A, respectively, to obtain the recombinant plasmids pEC-Psod-sfGFP and pEC-Peftu-sfGFP. The primer sequences are shown in Table 1.
[0048] Table 1 Primer sequence listing (2) Preparation of transformant strains The plasmids (vectors) pEC-PpurNH-sfGFP, pEC-Psod-sfGFP, pEC-Peftu-sfGFP, and pEC-XK99E prepared in step (1) were transformed into Corynebacterium stationis ATCC 6872 competent cells by electroporation, and the following recombinant strains were obtained on BHISG solid plates containing 25 μg / mL kanamycin: Corynebacterium stationis ATCC 6872 / pEC-purNH-sfGFP, Corynebacterium stationis ATCC 6872 / pEC-Psod-sfGFP, Corynebacterium stationis ATCC 6872 / pEC-Peftu-sfGFP, and Corynebacterium stationis ATCC 6872 / pEC-XK99E.
[0049] (3) Start the construction and screening of sub-libraries Using the recombinant plasmid pEC-PpurNH-sfGFP prepared in step (1) as a template, the promoter fragments were amplified using primers M-purNH-F-1, M-purNH-F-2, M-purNH-F-3, M-purNH-F-4 and M-promoter-R (containing mutant bases as shown in Table 2), respectively. The plasmid backbone was amplified using primers M-XK99E-purNH-F and M-XK99E-purNH-R. The promoter fragments were ligated to the plasmid backbone in 2-3 tubes using a one-step recombinant cloning kit, 10 μL per tube, to obtain the recombinant plasmids. These plasmids were then transformed into Escherichia coli TOP10 competent cells. The cells were plated on LB solid medium containing 50 μg / mL kanamycin, and the total volume collected was approximately 10 μL. 6 A single clone of bacteria was used to extract recombinant plasmids, which yielded the PpurNH promoter library plasmid.
[0050] Approximately 1 μg of the library plasmid was electroporated into *Corynebacterium truncatum* ATCC 6872 competent cells. The cells were plated onto approximately 20 BHISG solid plates containing 25 μg / mL kanamycin, with each plate containing approximately 400-700 clones, resulting in approximately 10,000 clones. All clones on the plates were washed off with PBS buffer and subjected to flow cytometry sorting (FACS). Clones with enhanced fluorescence were sorted and plated onto BHISG solid plates containing 25 μg / mL kanamycin, yielding recombinant strains with enhanced fluorescence intensity: ATCC 6872 / pEC-purNH1-sfGFP, ATCC 6872 / pEC-purNH2-sfGFP, ATCC 6872 / pEC-purNH3-sfGFP, ATCC 6872 / pEC-purNH4-sfGFP, and ATCC 6872 / pEC-purNH5-sfGFP.
[0051] Table 2 Primer sequence listing (4) Characterization of promoter library strength The recombinant strains with enhanced fluorescence intensity obtained in step (3) and the recombinant strains constructed in step (2) were inoculated into 48-well plates, each containing 800 μL of fermentation medium containing 25 μg / mL kanamycin. After incubation at 30℃ and 800 r / min for 24 h, the samples were transferred to new 48-well plates, each containing 900 μL of fermentation medium containing 25 μg / mL kanamycin. Each sample was tested in triplicate. After incubation at 30℃ and 800 r / min for 24 h, the OD600 and fluorescence values were measured (excitation wavelength 488 nm, emission wavelength 520 nm). The fluorescence intensity was the measured fluorescence value / OD600, i.e., GFU / OD600.
[0052] Combining the data in Table 3 and the results in Figure 3, the promoter mutants purNH4 and purNH5 were found to have corresponding recombinant strains named ATCC 6872 / pEC-purNH4-sfGFP and ATCC 6872 / pEC-purNH5-sfGFP. These recombinant strains exhibited at least 10 times the fluorescence intensity of ATCC 6872 / pEC-purNH-sfGFP (i.e., the recombinant strain with the original promoter), and also showed higher fluorescence sensitivity than Psod and Peftu, which are known to be potent promoters, at least 2.5 times that of Psod and 1.2 times that of Peftu.
[0053] Table 3. Fluorescence intensity of Corynebacterium tarda Using the primers Promoter-CX-F and Promoter-CX-R shown in Table 4, single colonies of ATCC 6872 / pEC-PpurNH4-sfGFP (PpurNH4) and ATCC 6872 / pEC-PpurNH5-sfGFP (PpurNH5) were amplified by PCR, and the amplified PCR fragments were sequenced. The results showed that the nucleotide sequences of PpurNH4 and PpurNH5 differed from the original promoter PpurNH in the following ways: Nucleotides 6-11, 18, 20, 22-23, 25, 31-36, 38, 40, 42-44, and 46 of PpurNH4 (sequence shown in SEQ ID NO:2) are mutated from gataag, t, t, tt, c, ggagga, a, a, tgg, g to AGGTCA, G, C, GC, T, ACCCTT, T, T, GTA, T; Nucleotides 7, 9–11, 18–22, 25–30, 32–34, 36, 38–39, 42–44, and 46–47 of PpurNH5 (sequence shown in SEQ ID NO:3) are mutated from A, AAG, TCTTT, CGTGGT, GAG, A, AA, TGG, and GG to T, GGC, GAAAC, TTCCTC, AGT, T, GG, GAT, and AC.
[0054] PpurNH4 (SEQ ID NO:2): GAGGGAGGTCATTGTCCGCCTGCCTGTGGTACCCTTATATTGTACTGCATCGTTTCGTCCTCGAAAGGGCTACAGACTAGTCTTTAACAC; PpurNH5 (SEQ ID NO:3): GAGGGGTTGGCTTGTCCGAAACTCTTCCTCGAGTGTAGGATGATCACCATCGTTTCGTCCTCGAAAGGGCTACAGACTAGTCTTTAACAC.
[0055] Table 4 Primer sequence listing Example 2: The efficacy of the promoter mutant was verified as follows: (1) Construction of recombinant strains Based on the results of Example 1, the mutant purNH5 exhibited the highest fluorescence intensity, followed by the mutant purNH4. Therefore, recombinant vectors pEC-PpurNH-purNH, pEC-Psod-purNH, pEC-Peftu-purNH, pEC-PpurNH4-purNH, and pEC-PpurNH5-purNH were constructed using the glycine nucleotide transformylase gene (purNH) of Corynebacterium truncatum ATCC 6872 as the reporter protein. These recombinant vectors were electroporated into competent cells of Corynebacterium truncatum ATCC 6872 to construct the corresponding recombinant strains: ATCC 6872 / pEC-PpurNH-purNH, ATCC 6872 / pEC-Psod-purNH, ATCC 6872 / pEC-Peftu-purNH, ATCC 6872 / pEC-PpurNH4-purNH, and ATCC 6872 / pEC-PpurNH5-purNH.
[0056] The construction method is as follows: Using the genome of ATCC 6872 strain as a template, the purNH gene fragment was amplified using purNH-F / purNH-R primers. The plasmids pEC-PpurNH-sfGFP, pEC-Psod-sfGFP, pEC-Peftu-sfGFP, pEC-PpurNH4-sfGFP, and pEC-PpurNH5-sfGFP were amplified using PEC-purNH-A / pEC-XK99E1-S to obtain backbone plasmids. The amplified purNH gene fragment and the aforementioned backbone plasmids were ligated using a commercially available one-step recombinant cloning kit to obtain the vectors pEC-PpurNH-purNH, pEC-Psod-purNH, pEC-Peftu-purNH, pEC-PpurNH4-purNH, and pEC-PpurNH5-purNH.
[0057] Table 5 Primer sequence listing (2) Extraction of total RNA Recombinant strains ATCC 6872 / pEC-PpurNH-purNH, ATCC 6872 / pEC-Psod-purNH, ATCC6872 / pEC-Peftu-purNH, ATCC6872 / pEC-PpurNH4-purNH, and ATCC6872 / pEC-PpurNH5-purNH were inoculated into LB seed culture medium and cultured at 30℃ and 250 rpm for 20 h to obtain seed culture. The initial OD600 was controlled at 1, and the seed culture was transferred to basal medium and cultured for 24 h. 4 mL of fermentation broth from each strain was centrifuged at 6000 rpm for 3 min, and the supernatant was discarded to collect the bacterial cells.
[0058] RNA extraction and reverse transcription were performed using TRNzol Universal Total RNA Extraction Reagent and FastKing cDNA First-Strand Synthesis Kit from Tiangen Biotech.
[0059] (3) Real-time PCR Quantitative real-time PCR was performed using an ABI Q1 PCR instrument and the SYBR Green Pro Taq HS premixed qPCR kit (containing tracer dye and Rox) from Aikerui Biotechnology. 20 μL of the PCR reaction mixture was added to a 96-well plate and placed inside the PCR instrument for the reaction. The PCR reaction mixture is shown in Table 6, the PCR reaction program is shown in Table 7, and the primers used for PCR are shown in Table 8.
[0060] Table 6. Real-time PCR reaction system Table 7 PCR reaction procedure Table 8 Primer Sequence List for Quantitative Real-Time PCR 16S rRNA was selected as the internal reference gene, and the transcriptional levels of other related genes were measured using a 23Tabulation method. -△△Ct Method calculation.
[0061] The results of quantitative real-time PCR are as follows Figure 4As shown, after 24 hours of fermentation, compared with the recombinant strain ATCC 6872 / pEC-PpurNH-purNH, the transcription levels of the purNH gene in the recombinant strains ATCC 6872 / pEC-PpurNH5-purNH and ATCC 6872 / pEC-PpurNH4-purNH were significantly increased, with the increase being more significant in the recombinant strain ATCC 6872 / pEC-PpurNH5-purNH. This demonstrates that the promoter mutant PpurNH5 can significantly increase the transcription level of the purNH gene in Corynebacterium tarda, thereby increasing the expression of the glycine nucleotide transformylase gene. As a key enzyme in the nucleotide / purine biosynthesis pathway, increased expression of glycine nucleotide transformylase can increase the metabolic flux of nucleotide products, thereby increasing the yield of nucleotides.
[0062] Example 3: The ability of promoter mutants to express heterologous α-amylase genes was evaluated as follows: (1) Construction of recombinant strains Recombinant vectors pEC-PpurNH-amyE, pEC-Psod-amyE, pEC-Peftu-amyE, pEC-PpurNH4-amyE, and pEC-PpurNH5-amyE were constructed using the α-amylase amyE gene (derived from Bacillus subtilis subsp. subtilis str. 168) as the reporter protein. These recombinant vectors were electroporated into competent cells of Corynebacterium ATCC 6872 to construct the corresponding recombinant strains ATCC 6872 / pEC-PpurNH-amyE, ATCC 6872 / pEC-Psod-amyE, ATCC 6872 / pEC-Peftu-amyE, ATCC 6872 / pEC-PpurNH4-amyE, and ATCC 6872 / pEC-PpurNH5-amyE.
[0063] The construction method is as follows: Using the genome of Bacillus subtilis subsp. subtilis str.168 as a template, the α-amylase amyE gene was amplified using amyE-F / amyE-R primers. The pEC-PpurNH-purNH, pEC-Psod-purNH, and pEC-Peftu-purNH vectors were amplified using PpurNH-amyE-A, Psod-amyE-A, Peftu-amyE-A, and pEC-XK99E1-S primers to obtain the plasmid backbone. Similarly, the pEC-PpurNH4-purNH and pEC-PpurNH5-purNH vectors were amplified using PpurNH-amyE-A and pEC-XK99E1-S primers to obtain the plasmid backbone. The fragment obtained from amplifying the α-amylase amyE gene was ligated to the aforementioned plasmid backbone using a commercially available one-step recombinant cloning kit to obtain recombinant vectors pEC-PpurNH-amyE, pEC-Psod-amyE, pEC-Peftu-amyE, pEC-PpurNH4-amyE, and pEC-PpurNH5-amyE. Primers are shown in the table below. Table 9 Primer sequence listing (2) Expression induced by α-amylase activity Recombinant bacterial strains ATCC 6872 / pEC-PpurNH-amyE, ATCC 6872 / pEC-Psod-amyE, ATCC6872 / pEC-Peftu-amyE, ATCC6872 / pEC-PpurNH4-amyE, and ATCC6872 / pEC-PpurNH5-amyE were cultured in seed culture for 20 h. The initial OD600 was controlled at 0.1 before being transferred to fermentation medium. After 24 h of fermentation, the bacterial cells were collected. 1 mL of the fermentation broth was collected in a 2 mL centrifuge tube, centrifuged at 7000 rpm for 3 min, and washed three times with PBS buffer (pH 7.4). The cells were resuspended in 1 mL of PBS buffer (pH 7.4) and transferred to a disruption tube containing 0.5 g of zirconia beads. Disruption was performed using a BeadRuptor 12 instrument (Omni International, Inc., USA). Each lysis was performed for 30 seconds, followed by 1 minute on ice. This process was repeated for 10 cycles. The sample was then centrifuged at 4°C, 14,000 rpm for 3 minutes. Finally, the supernatant was slowly aspirated for subsequent protein concentration and α-amylase activity assays.
[0064] (3) α-Amylase activity detection Protein concentration was determined using the Bradford method, and amylase activity was determined using the α-amylase (α-AL) activity assay kit from Beijing Box Biotechnology Co., Ltd. The assay method is as follows: Dilute the 10 mg / mL glucose standard solution with distilled water to obtain standard diluents of 0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, and 0.00625 mg / mL. Dilute the supernatant from step (2) with an appropriate multiple to obtain amylase stock solution. Take an appropriate amount of amylase stock solution and treat it in a boiling water bath for 5 min (sealed to prevent water loss), then cool to room temperature to obtain inactivated enzyme stock solution.
[0065] The assay system is shown in Table 10. Add 250 μL of amylase stock solution, 250 μL of inactivated enzyme stock solution, 250 μL of standard diluent, and 250 μL of distilled water to the assay tube, control tube, standard tube, and blank tube, respectively. Mix thoroughly and incubate at 70℃ for 15 min. Cool to room temperature. Add 250 μL of reagent II to the assay tube, mix thoroughly, and react accurately at 40℃ for 5 min. Then add 500 μL of reagent I to the assay tube, and simultaneously add 500 μL of reagent I and 250 μL of reagent II to the control tube, standard tube, and blank tube, respectively. Mix thoroughly, incubate in a boiling water bath for 10 min, and cool to room temperature. Transfer the reaction solution to a 96-well microplate and measure the absorbance at 540 nm using a microplate reader. Record these values as A assay, A control, A standard, and A blank. Calculate ΔA assay = A assay - A control, ΔA standard = A standard - A blank. Each assay tube should include a control tube.
[0066] Table 10 α-Amylase Activity Assay System A standard curve was plotted with the concentrations of the standard dilutions (0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, and 0.00625 mg / mL) as the abscissa (x) and their corresponding ΔA standard as the ordinate (y). The linear regression equation y = kx + b was obtained. Substituting the ΔA measurement into the formula, x (mg / mL) was obtained.
[0067] The enzyme activity unit of α-amylase (α-AL) is defined as: the production of 1 mg of reducing sugar per minute from 1 mg of tissue protein is defined as one enzyme activity unit.
[0068] The formula for calculating the activity of α-amylase (α-AL) is: where Vsample is the volume of enzyme solution added to the reaction system, i.e., 0.25 mL; Cpr (mg / mL) is the protein concentration of the sample; and T is the reaction time, i.e., 5 min.
[0069] Substitute the x and Cpr values measured for each recombinant strain into the enzyme activity calculation formula above, and the calculated enzyme activities are shown in Table 11.
[0070] Table 11 α-Amylase activities in various recombinant strains of ATCC 6872 Referring to Table 11, the α-amylase amyE gene derived from Bacillus subtilis subsp. subtilis str. 168 can be heterologously expressed in Corynebacterium stationis. Compared with Corynebacterium stationis ATCC6872 / pEC-PpurNH-amyE, Corynebacterium stationis ATCC 6872 / pEC-Psod-amyE, and Corynebacterium stationis ATCC 6872 / pEC-Peftu-amyE, Corynebacterium stationis ATCC6872 / pEC-PpurNH4-amyE showed significantly increased α-amylase activity, increasing by approximately 1.4-fold, 0.7-fold, and 0.5-fold, respectively, indicating that PpurNH4 is a universal and potent promoter.
[0071] In summary, compared with the original promoter PpurNH and existing strong promoters Psod and Petfu, the promoter mutant PpurNH5 provided by this invention can enhance the transcriptional level of glycine nucleotide transformylase, thereby promoting the expression of glycine nucleotide transformylase in Corynebacterium tarda, and thus increasing the metabolic flux of nucleotide / purine products. PpurNH4 showed a better level of overexpression of α-amylase amyE, achieving α-amylase activity approximately 2.4 times that of the original promoter PpurNH, 1.7 times that of the existing strong promoter Psod, and 1.5 times that of Peftu, respectively. Therefore, the promoter provided by this invention can be used as a universal promoter and has strong industrial applicability.
[0072] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.
Claims
1. A promoter that can increase the transcriptional level of the glycine nucleotide transformylase gene, characterized in that, The promoter is obtained by mutating at least one of the following based on the sequence shown in SEQ ID NO:1: 1) Nucleotides 6-11, 18, 20, 22-23, 25, 31-36, 38, 40, 42-44, and 46 mutate from gataag, t, t, tt, c, ggagga, a, a, tgg, g to AGGTCA, G, C, GC, T, ACCCTT, T, T, GTA, T; 2) Nucleotides 7, 9-11, 18-22, 25-30, 32-34, 36, 38-39, 42-44, and 46-47 mutate from A, AAG, TCTTT, CGTGGT, GAG, A, AA, TGG, and GG to T, GGC, GAAAC, TTCCTC, AGT, T, GG, GAT, and AC.
2. The promoter according to claim 1, characterized in that, The promoter has a nucleotide sequence as described in any one of the following, or a nucleotide sequence that has more than 70% homology with a nucleotide sequence as described in any one of the following and has promoter activity: 1) The sequence shown in SEQ ID NO:2; 2) The sequence shown in SEQ ID NO:
3.
3. The promoter according to claim 2, characterized in that, The promoter has a nucleotide sequence that is more than 90% homologous to the sequence shown in SEQ ID NO:2 or SEQ ID NO:3 and has promoter activity.
4. A glycine nucleotide transformylase gene expression cassette, characterized in that, It includes the promoter according to any one of claims 1 to 3 and a glycine nucleotide transformylase gene located downstream of the promoter.
5. A recombinant vector, characterized in that, The recombinant vector comprises the glycine nucleotide transformylase gene expression cassette of claim 4.
6. The recombinant vector according to claim 5, characterized in that, The recombinant vector was expressed in Corynebacterium truncatum.
7. The recombinant vector according to claim 6, characterized in that, The Corynebacterium catarrhalis is selected from Corynebacterium catarrhalis ATCC6872 or its derivative strains.
8. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria contain the promoter as described in any one of claims 1 to 3, or the glycine nucleotide transformylase gene expression cassette as described in claim 4, or the recombinant vector as described in any one of claims 5 to 7.
9. The use of the promoter according to any one of claims 1 to 3, or the glycine nucleotide transformylase gene expression cassette according to claim 4, or the recombinant vector according to any one of claims 5 to 7, or the genetically engineered bacteria according to claim 8, in at least one of the following: 1) increasing the transcription level of the glycine nucleotide transformylase gene; 2) increasing the expression activity of the α-amylase gene; 3) producing nucleotide products.
10. The application according to claim 9, characterized in that, The application uses Corynebacterium tarda as the expression strain.