A mutant of n-acetylglucosamine 2-epimerase and preparation and use thereof
By performing a K182R point mutation on N-acetylglucosamine 2-epimerase derived from Dictyoglomus thermophilum, a recombinant vector and recombinant bacteria were constructed, solving the problems of low conversion rate and high cost in lactulose preparation and achieving efficient, green and environmentally friendly lactulose preparation.
Patent Information
- Application Number
- CN202510467714.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2045-04-15
AI Technical Summary
Existing methods for preparing lactulose suffer from problems such as low conversion rate, byproduct generation, harsh reaction conditions, and complicated steps. Furthermore, the use of β-galactosidase increases production costs, and there are no reports of lactose being converted to lactulose via N-acetylglucosamine 2-epimerase catalysis.
The thermal stability of N-acetylglucosamine 2-epimerase from Dictyoglomus thermophilum was improved by point mutation at K182R. Recombinant vectors and recombinant bacteria were constructed, and the modified N-acetylglucosamine 2-epimerase mutant was used to catalyze the production of lactose from lactulose at high temperature.
The catalytic synthesis efficiency of lactulose has been improved, realizing efficient and environmentally friendly lactulose preparation with promising prospects for industrial application. The mutant enzyme has advantages such as better substrate affinity and catalytic efficiency than the wild-type enzyme at 85℃, fewer by-products, and higher product yield.
Smart Images

Figure CN120249262B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to an enzyme protein and its preparation and application, in particular to an N-acetylglucosamine 2-epimerase mutant and its preparation and application in catalyzing preparation of lactulose. BACKGROUND
[0002] Lactulose is a high-value derivative of lactose, which is formed by the connection of galactose and fructose through a β-1,4 glycosidic bond. Due to its unique probiotic function, lactulose has important application value in the fields of medicine, nutrition and functional food. Lactulose is metabolized into low molecular weight organic acids in the intestinal tract, thereby promoting colon peristalsis and relieving chronic constipation. In addition, lactulose also has the function of regulating intestinal flora ammonia metabolism and is used to treat hepatic encephalopathy. At present, the preparation of lactulose can be divided into chemical method and biological enzyme method. Acid-base synergistic catalysis is a common chemical method for producing lactulose. In alkaline conditions, lactose is first catalyzed to generate part of lactulose; then, by adding boric acid to the reaction system, lactulose-borate complex is generated, so that the reaction proceeds in the direction conducive to the generation of lactulose; then, the pH of the reaction system is adjusted to be acidic, so that the complex is decomposed into lactulose and boric acid; finally, by using ion exchange resin that specifically binds boric acid, boric acid in the system is removed to realize the production of lactulose. However, the chemical method for producing lactulose usually has the disadvantages of low conversion rate, generation of by-products, harsh reaction conditions and complicated steps. Therefore, the green and efficient biological enzyme method for producing lactulose has become a research hotspot.
[0003] Lactulose can be generated by hydrolysis of lactose by β-galactosidase to generate galactose and glucose, and then fructose is added to the reaction system to use the transglycosylation activity of β-galactosidase to catalyze the galactosyl to accept fructosyl through a β-1,4 glycosidic bond to prepare lactulose, but the addition of extra fructose substrate increases the production cost. Using the structural isomerization activity of cellobiose 2-epimerase to catalyze the structural transformation of the glucose group of lactose into the fructose group is a common biological enzyme method strategy for preparing lactulose. However, there is no report on the catalysis of lactose to lactulose by N-acetylglucosamine 2-epimerase. SUMMARY
[0004] Invention purposes: The purpose of the present application is to provide a N-acetylglucosamine 2-epimerase mutant with higher thermal stability. Another purpose of the present application is to provide a recombinant vector expressing the N-acetylglucosamine 2-epimerase mutant and a recombinant bacterium containing the recombinant vector, so as to solve the problem of how to clone and recombinantly express the N-acetylglucosamine 2-epimerase mutant protein. A third purpose of the present application is to provide a preparation method of the N-acetylglucosamine 2-epimerase mutant, so as to solve the problem of how to artificially prepare the N-acetylglucosamine 2-epimerase mutant. A fourth purpose of the present application is to provide the application of the N-acetylglucosamine 2-epimerase mutant in preparing lactulose, so as to solve the problem of how to prepare lactulose.
[0005] Technical solutions: The N-acetylglucosamine 2-epimerase mutant provided by the present application comprises the amino acid sequence shown in SEQ ID No. 3.
[0006] The N-acetylglucosamine 2-epimerase mutant is obtained by K182R point mutation of a wild-type N-acetylglucosamine 2-epimerase from Dictyoglomus thermophilum, and the amino acid sequence of the wild-type N-acetylglucosamine 2-epimerase is shown in SEQ ID No. 1. The K182R point mutation is located on the surface of the spatial structure of the wild-type N-acetylglucosamine 2-epimerase protein, and the mutation does not affect the correct expression and folding of the recombinant protein of the mutant. The mutation can effectively improve the thermal stability of the wild-type enzyme protein, and further improve the catalytic synthesis efficiency of lactulose.
[0007] The second aspect of the present application provides a recombinant vector expressing the N-acetylglucosamine 2-epimerase mutant.
[0008] Preferably, the recombinant vector comprises the nucleotide sequence shown in SEQ ID No. 4, which is the gene coding sequence of the N-acetylglucosamine 2-epimerase mutant.
[0009] The third aspect of the present application provides a recombinant bacterium containing the recombinant vector.
[0010] The fourth aspect of the present application discloses a preparation method of the N-acetylglucosamine 2-epimerase mutant, comprising the following steps:
[0011] (1) using the recombinant vector containing the Sumo enhancement element and the wild-type N-acetylglucosamine 2-epimerase gene as a template, and using a mutant primer to perform PCR reaction, so as to obtain a mutant gene fragment;
[0012] (2) transforming the mutant gene fragment into an engineering bacterium to obtain a recombinant bacterium expressing N-acetylglucosamine 2-epimerase mutant protein;
[0013] (3) culturing the recombinant bacterium, collecting and crushing the bacterium, centrifuging the bacterium crushing liquid to obtain the supernatant containing N-acetylglucosamine 2-epimerase mutant.
[0014] In some embodiments, the engineering bacterium is Escherichia coli BL21.
[0015] Preferably, in step (1), the preparation method of the recombinant vector containing the Sumo enhancing element and the wild-type N-acetylglucosamine 2-epimerase gene is as follows: inserting the wild-type N-acetylglucosamine 2-epimerase gene into the multiple cloning site of pET22b plasmid to obtain pET22b-DithAGE, wherein the nucleotide sequence of the wild-type N-acetylglucosamine 2-epimerase gene is shown in SEQ ID No. 2; and then copying the nucleotide sequence of the Sumo enhancing element into pET22b-DithAGE, wherein the nucleotide sequence of the Sumo enhancing element is located at the 5' end of the wild-type N-acetylglucosamine 2-epimerase gene, to obtain the recombinant vector containing the Sumo enhancing element and the wild-type N-acetylglucosamine 2-epimerase gene.
[0016] In some embodiments, the insertion site of the exogenous gene in the pET22b plasmid is 5'(Nde I) and 3'(Xho I).
[0017] Preferably, in step (1), the mutant primer comprises:
[0018] Forward primer: 5'-TTGATGCACTTTAGTAAGTTAGCC CGT GAAAAATCAAA-3'
[0019] Reverse primer: 5'-TTTCCAAAATCTTTGATTTTTC ACG GGCTAACTTACTAA-3'
[0020] The annealing temperature of the PCR reaction is 53-57°C.
[0021] Preferably, in step (3), the method for culturing the recombinant bacterium is as follows: inoculating the recombinant Escherichia coli into LB liquid medium containing ampicillin, culturing the bacterium at 37°C until the logarithmic growth phase, and then adding IPTG with a final concentration of 2 mM into the culture solution to induce expression at 37°C.
[0022] In step (1), the recombinant vector contains a His tag, and in step (3), the crude enzyme solution is subjected to nickel column purification to obtain the purified N-acetylglucosamine 2-epimerase mutant.
[0023] The fifth aspect of the present application discloses the use of the N-acetylglucosamine 2-epimerase mutant in the preparation of lactulose.
[0024] The use specifically comprises the following steps: taking lactose as the substrate, taking a buffer solution with a pH of 7.0-8.0 as the reaction medium, adding the N-acetylglucosamine 2-epimerase mutant to form a reaction system, and reacting at 80-95℃ to obtain lactulose. The reaction temperature is preferably 85-90℃, and the reaction time is preferably 2-8h.
[0025] Advantages: Compared with the prior art, the present application has the following remarkable advantages:
[0026] The present application improves the thermal stability of N-acetylglucosamine 2-epimerase by point mutation of specific amino acid sites, and successfully obtains a strain of N-acetylglucosamine 2-epimerase mutant that can withstand high temperature for a long time. The K m of the mutant is 168.5mM, and the k cat is 2.64s -1 The substrate affinity and catalytic efficiency of the mutant are better than those of the wild-type enzyme, and the substrate conversion efficiency of the mutant is 3.9% higher than that of the wild-type enzyme under the optimal conditions. The mutant can be used as a biological catalyst for the efficient preparation of lactulose, has the advantages of green environmental protection, low toxicity, few by-products, and high product yield, and has the prospect of industrial application. BRIEF DESCRIPTION OF DRAWINGS
[0027] Figure 1 Screening results of the enhancer element of DithAGE recombinant expression;
[0028] Figure (A) is SDS-PAGE analysis of recombinant DithAGE (M: standard marker; 1: pET22b cell break supernatant; 2: pET22b cell break precipitate; 3: TTH cell break supernatant; 4: TTH cell break precipitate; 5: Trig cell break supernatant; 6: Trig cell break precipitate; 7: Tee cell break supernatant; 8: Tee cell break precipitate; 9: His cell break supernatant; 10: His cell break precipitate; 11: Sumo cell break supernatant; 12: Sumo cell break precipitate; 13: Mbp cell break supernatant; 14: Mbp cell break precipitate; 15: NusA cell break supernatant; 16: NusA cell break precipitate; 17: TrxA cell break supernatant; 18: TrxA cell break precipitate; 19: Gst cell break supernatant; 20: Gst cell break precipitate); Figure (B) is lactulose conversion rate of recombinant DithAGE.
[0029] Figure 2 Purification results of recombinant DithAGE and its mutants;
[0030] Figure (A) is SDS-PAGE analysis of recombinant DithAGE (M: standard marker; 1: K161R; 2: K126R; 3: K49R; 4: K329R; 5: K326R; 6: K351R; 7: K86R; 8: K179R; 9: K25R; 10: K332R; 11: K182R; 12: K242R; 13: K125R; 14: K108R; 15: K307R; 16: K29R; 17: K84R; 18: K190R; 19: K186R; 20: K155R; 21: K238R; 22: K196R; 23: K184R; 24: G27A; 25: G158A; 26: G252A; 27: G68A; 28: G245A; 29: Sumo-DithAGE).
[0031] Figure 3 Lactulose conversion rates of wild type DithAGE and its mutants;
[0032] Figure 4 Optimum pH of wild type DithAGE and mutant K182R;
[0033] Figure 5 Optimum reaction temperature of wild type DithAGE and mutant K182R;
[0034] Figure (A) is SDS-PAGE analysis of recombinant DithAGE (M: standard marker; 1: K161R; 2: K126R; 3: K49R; 4: K329R; 5: K326R; 6: K351R; 7: K86R; 8: K179R; 9: K25R; 10: K332R; 11: K182R; 12: K242R; 13: K125R; 14: K108R; 15: K307R; 16: K29R; 17: K84R; 18: K190R; 19: K186R; 20: K155R; 21: K238R; 22: K196R; 23: K184R; 24: G27A; 25: G158A; 26: G252A; 27: G68A; 28: G245A; 29: Sumo-DithAGE).
[0035] Figure 6 Thermal stability of wild type DithAGE and mutant K182R;
[0036] wherein (A) is wild type DithAGE and (B) is mutant K182R.
[0037] Figure 7 Circular dichroism curves and secondary structure content analysis of wild type DithAGE and mutant K182R;
[0038] wherein (A) is circular dichroism curve and (B) is protein secondary structure content analysis result.
[0039] Figure 8 Galactinol conversion rate of wild type DithAGE and mutant K182R under 90℃. DETAILED DESCRIPTION
[0040] The technical solutions of the present application will be further described below in combination with the drawings.
[0041] Example 1: A mutant of N-acetylglucosamine 2-epimerase, whose amino acid sequence is shown in SEQ ID No. 3:
[0042] MKVVSIVGARPQFIKLAPFSAELRKNGIKEVILHTGQHYDENMSELFFKELEIPEPDYNLGIGSGSHGEQTGRMLIGIEEVLVKEKPDVVIVYGDTNSTLAGALASAKIHIPLAHVEAGLRSFNKKMPEEINRIVADHLSDILFCPTETAVENLKREGIEKGVYLVGDVMFDALMHFSKLAREKSKILEKLSLNPKDYYLITVHRAENTDNPERLKNIFSAISELDKEVIFPIHPRTKNRLKELGLEGYLRGRVRIIDPVGYLDMIELEKNALAILTDSGGVQKEAFWLRVPCITLREETEWVETLKYGWNILVGSNKERILEAIKNIKNGKEISFENDYASPKMREVLIKELERRREDDR
[0043] The preparation method of the above-mentioned mutant of N-acetylglucosamine 2-epimerase is as follows:
[0044] (1) Construct a recombinant expression vector containing Sumo enhancement element and wild type N-acetylglucosamine 2-epimerase gene from Streptococcus thermophilus, the method is as follows:
[0045] Wild-type N-acetylglucosamine 2-epimerase from Streptococcus thermophilus D. thermophilum AGE, referred to as DithAGE, has an amino acid sequence as shown in SEQ ID No. 1 (NCBI Accession Number: WP_149122648.1):
[0046] MKVVSIVGARPQFIKLAPFSAELRKNGIKEVILHTGQHYDENMSELFFKELEIPEPDYNLGIGSGSHGEQTGRMLIGIEEVLVKEKPDVVIVYGDTNSTLAGALASAKIHIPLAHVEAGLRSFNKKMPEEINRIVADHLSDILFCPTETAVENLKREGIEKGVYLVGDVMFDALMHFSKLAKEKSKILEKLSLNPKDYYLITVHRAENTDNPERLKNIFSAISELDKEVIFPIHPRTKNRLKELGLEGYLRGRVRIIDPVGYLDMIELEKNALAILTDSGGVQKEAFWLRVPCITLREETEWVETLKYGWNILVGSNKERILEAIKNIKNGKEISFENDYASPKMREVLIKELERRREDDR
[0047] A restriction site 5' (Nde I) and 3' (Xho I) was added to both ends of the nucleotide sequence of the gene encoding wild-type N-acetylglucosamine 2-epimerase, and the codons were optimized according to the codon bias of E. coli, to obtain a recombinant gene encoding wild-type DithAGE, which has a sequence as shown in SEQ ID No. 2:
[0048] GGAATTC CATATG ATGAAAGTTGTTAGTATTGTTGGTGCTCGGCCACAATTTATTAA
[0049] ATTAGCTCCATTTAGTGCTGAATTACGGAAGAATGGTATCAAAGAAGTCATTTTACA
[0050] TACGGGCCAACATTACGATGAAAATATGAGTGAATTATTTTTTAAAGAATTGGAGAT
[0051] TCCGGAACCGGATTATAATTTAGGTATTGGTAGTGGTAGTCATGGTGAACAAACGG
[0052] GTCGGATGTTAATTGGTATTGAAGAAGTTTTGGTTAAAGAAAAACCGGATGTTGTT
[0053] ATTGTTTATGGTGATACGAATAGTACGTTAGCTGGTGCTTTAGCTAGTGCTAAAATT
[0054] CATATTCCATTAGCTCATGTTGAAGCTGGTTTACGGAGTTTTAATAAAAAAATGCCG
[0055] GAAGAAATTAATCGGATTGTTGCTGATCATTTAAGTGATATTTTATTTTGTCCAACGG
[0056] AAACGGCTGTTGAAAATTTAAAACGGGAGGGTATTGAGAAAGGTGTCTATTTAGTT
[0057] GGTGATGTCATGTTTGACGCCTTGATGCACTTTAGTAAGTTAGCCAAGGAAAAATC
[0058] AAAGATTTTGGAAAAATTGTCATTAAATCCGAAAGATTATTATTTAATTACGGTTCAT
[0059] CGGGCTGAAAATACGGATAATCCGGAACGGTTAAAAAACATTTTTAGTGCTATTAG
[0060] TGAGTTAGATAAAGAAGTTATTTTCCCAATTCATCCACGGACGAAAAATCGGTTAA
[0061] AAGAATTAGGTTTAGAAGGTTATTTACGGGGTCGGGTTCGGATTATTGATCCGGTTG
[0062] GTTATTTAGACATGATTGAGTTAGAGAAAAATGCTTTAGCTATTTTAACGGATAGTG
[0063] GTGGTGTTCAAAAAGAAGCTTTTTGGTTACGGGTTCCATGTATTACGTTACGGGAA
[0064] GAAACGGAATGGGTTGAAACTTTGAAATATGGCTGGAATATCTTAGTTGGTTCAAA
[0065] TAAGGAACGGATCTTAGAAGCCATTAAAAATATTAAAAACGGTAAAGAAATTAGTT
[0066] TTGAAAATGATTATGCTAGTCCAAAAATGCGGGAAGTTTTAATCAAAGAATTAGAA
[0067] CGGCGTCGGGAAGATGATCGGTAA CTCGAG CGG
[0068] The single underlined part in the above sequence is Nde I restriction site, and the double underlined part is Xho I restriction site.
[0069] The DithAGE recombinant coding gene fragment was obtained by total synthesis according to the sequence shown in SEQ ID No. 2, and the DithAGE recombinant coding gene fragment and pET22b empty plasmid were subjected to Nde I and Xho I double digestion respectively, and then connected to obtain the recombinant expression plasmid pET22b-DithAGE.
[0070] The pET22b-DithAGE was transformed into E. coli BL21 recipient bacteria, spread on LB agar plates containing 100 mM ampicillin at a final concentration, and incubated at 37°C for 12 h. Colonies growing on the plates were randomly picked and plasmid was extracted, and agarose gel electrophoresis identification and nucleotide sequence determination were performed respectively to obtain the recombinant bacteria BL21 / pET22b-DithAGE. The BL21 / pET22b-DithAGE was inoculated into LB liquid medium containing ampicillin, and incubated at 37°C, 200 r / min until OD 600 = 0.6-0.8, and then 2 mM IPTG was added to the culture medium at a final concentration. After 12 h of induction at 37°C, the supernatant was discarded by centrifugation at 4°C, 8000 r / min for 10 min, and the wet bacteria were collected. The wet bacteria were washed with 50 mM PBS (pH 7.4) buffer for three times, and then resuspended with 50 mM PBS (pH 7.4) buffer at 25:1 (v / w). The cells were broken by using an ultrasonic disrupter at a power of 300 w, 3 s-7 s cycle (total 45 min), and the broken supernatant was obtained by centrifugation at 4°C, 10,000 rpm for 10 min, which was the crude enzyme solution.
[0071] Enzyme activity assay: The crude enzyme solution was mixed with 200 g / L aqueous solution of lactose at a volume ratio of 1:1 (v / v), and the total volume was 10 mL. The reaction conditions were as follows: 80℃ for 8 h, and the reaction was terminated by ice bath for 30 min. The reaction solution was taken and the lactulose content was detected by high performance liquid chromatography (HPLC).
[0072] HPLC detection conditions: HPLC was used to detect the contents of lactulose, lactose, fructose and galactose in the fermentation process. The fermentation broth was centrifuged at 12,000 rpm for 10 min, and then filtered with a 0.22 μm water phase needle filter for HPLC detection. The chromatographic column was AllChrom NH2 (250 mm x 4.6 mm, 5 μm) with a column temperature of 30℃. The HPLC analysis conditions were as follows: the mobile phase was acetonitrile: water = 70:30 (v / v), the injection volume was 5 μL, and the flow rate was 0.8 mL / min. The detector was an evaporative light scattering detector with a drift tube temperature of 95℃. The yield of lactulose was determined according to the retention time and peak area of the peak.
[0073] HPLC test showed that no lactulose was generated in the reaction system, indicating that pET22b-DithAGE could not express active recombinant DithAGE protein in BL21.
[0074] In order to make the recombinant bacteria normally express active DithAGE protein, the present application fuses a translation enhancer element, such as Trig-Tee-His tandem sequence (hereinafter referred to as TTH), Trig, Tee, His, and protein tags Mbp, Gst, NusA, TrxA, Sumo, to the N-terminus of the recombinant DithAGE. The amino acid sequences of the above translation enhancer elements are as follows:
[0075]
[0076]
[0077]
[0078] The specific method is as follows:
[0079] The nucleotide sequence of the enhancing element was optimized according to the codon bias of E. coli and synthesized by Suzhou Jinyuzhi Biotechnology Co., Ltd. to the N-terminus of recombinant DithAGE, and the nucleotide sequence of the enhancing element was located at the 5' end of the DithAGE coding gene, to obtain N-acetylglucosamine 2-epimerase recombinant expression vectors pET22b-TTH-DithAGE, pET22b-Trig-DithAGE, pET22b-Tee-DithAGE, pET22b-His-DithAGE, pET22b-Mbp-DithAGE, pET22b-Gst-DithAGE, pET22b-NusA-DithAGE, pET22b-TrxA-DithAGE, pET22b-Sumo-DithAGE, corresponding to the sizes of the recombinant enzymes TTH-DithAGE (36.2 kDa), Trig-DithAGE (90.5 kDa), Tee-DithAGE (42.8 kDa), His-DithAGE (42 kDa), Mbp-DithAGE (82.7 kDa), Gst-DithAGE (67.5 kDa), NusA-DithAGE (96.4 kDa), TrxA-DithAGE (53.6 kDa), and Sumo-DithAGE (53.9 kDa).
[0080] The above recombinant expression vectors carrying the N-acetylglucosamine 2-epimerase gene were transformed into E. coli BL21, respectively, and the recombinant bacteria were cultured and induced to express the target protein. After collecting the bacterial cells, the cells were broken, and the target protein bands in the cell break supernatant and cell break precipitate were detected by SDS-PAGE electrophoresis, and the conversion rate of recombinant DithAGE catalyzing lactose to lactulose was analyzed. The results are shown in Figure 1 SDS-PAGE electrophoresis showed that when the N-terminus of DithAGE was fused with a Sumo tag, the expression level was the highest; the conversion rate of recombinant Sumo-DithAGE catalyzing lactose to lactulose was 31.2%, which was higher than that of other recombinant enzymes.
[0081] (2) Using the Sumo recombinant expression vector pET22b-Sumo-DithAGE as a template, a mutant was constructed by PCR reaction with a mutant primer, as follows:
[0082] (2.1) Selecting the mutation site
[0083] The crystal structure of 2,3-diacetamido-2,3-dideoxyglucuronate 2-epimerase from Thermus thermophilus HB27 (PDB: 8sxy.1.A) was used as a template to construct a three-dimensional structure model of DithAGE by SWISS-MODEL (https: / / www.swissmodel.expasy.org). The surface amino acids of DithAGE were analyzed using the bioinformatics analysis tool GetArea (https: / / curie.utmb.edu / getarea.htmL). The lysine (K) on the surface of DithAGE was mutated to arginine (R), and the glycine (G) was mutated to alanine (A) to screen mutants that can improve the thermal stability and lactulose conversion rate of DithAGE. The specific point mutations and corresponding mutation primers include:
[0084]
[0085]
[0086]
[0087] The annealing temperature of the PCR reaction of the above point mutation primer is in the range of 58-66°C.
[0088] (2.2) According to the gene sequence of DithAGE, the mutation primer was designed using the recombinant vector pET22b-Sumo-DithAGE as the template, and the full-plasmid PCR technology was used to perform single mutation on the 182nd amino acid of DithAGE. The primer sequence is:
[0089] Forward primer (5'→3'): (underlined is the mutation base)
[0090] Reverse primer (5'→3'): (underlined is the mutation base)
[0091] The PCR reaction system and PCR amplification conditions are shown in Table 1 and Table 2:
[0092] Table 1: Components and amounts of PCR reaction system
[0093]
[0094] Table 2: PCR reaction program
[0095]
[0096] The nucleotide sequence of the mutant gene fragment in the PCR product is shown in SEQ ID No. 4:
[0097]
[0098] AAAGAAGTTATTTTCCCAATTCATCCACGGACGAAAAATCGGTTAAAAGAATTAGG
[0099] TTTAGAAGGTATTTACGGGGTCGGGTTCGGATTATTGATCCGGTTGGTTATTTAGA
[0100] CATGATTGAGTTAGAGAAAAATGCTTTAGCTATTTTAACGGATAGTGGTGGGTGTTCA
[0101] AAAAGAAGCTTTTTGGTTACGGGTTCCATGTATTACGTTACGGGAAGAAACGGAAT
[0102] GGGTTGAAACTTTGAAATATGGCTGGAATATCTTAGTTGGTTCAAATAAGGAACGG
[0103] ATCTTAGAAGCCATTAAAAATATTAAAAACGGTAAAGAAATTAGTTTTGAAAATGA
[0104] TTATGCTAGTCCAAAAATGCGGGAAGTTTTAATCAAAGAATTAGAACGGCGTCGGG
[0105] AAGATGATCGGTAA
[0106] (3) The recombinant plasmid carrying the mutant gene fragment was transformed into Escherichia coli BL21 to obtain recombinant bacteria expressing the N-acetylglucosamine 2-epimerase mutant protein, as follows:
[0107] Take 8 μL PCR product, add 1 μL Dpn I and 1 μL 10 x QuickCut buffer, 37 °C for 2 h, then add the reaction solution to 100 μL ice-bath E. coli DH5α competent cells, stand on ice for 30 min, then heat shock at 42 °C for 90 s, quickly cool on ice for 5 min, add 700 μL LB liquid medium, 37 °C, 200 r / min for 1 h, 4000 r / min centrifugation for 1 min, discard the supernatant, mix the bacterial slurry with the small amount of liquid left at the bottom of the tube, spread on LB solid plate containing 100 μg / mL ampicillin, 37 °C, inverted culture for 12 h, pick colonies and inoculate in 10 mL LB liquid medium containing 100 μg / mL ampicillin, 37 °C for 12 h. The bacterial solution was sent to Suzhou Genewiz Biotechnology Co., Ltd. for gene sequencing, and the recombinant plasmid pET22b-K182R was obtained. The recombinant plasmid with correct sequencing was transformed into E. coli BL21 to obtain the recombinant bacteria BL21 / pET22b-K182R. Since the whole plasmid PCR product is linear DNA, there is only one gap at 5' and 3', which will be linked into a circle in E. coli after direct transformation.
[0108] (4) Culturing the recombinant bacteria, collecting and crushing the bacterial bodies, and centrifuging the bacterial body crushing solution to obtain the supernatant to obtain a crude enzyme solution containing the N-acetylglucosamine 2-epimerase mutant.
[0109] The above mutant was subjected to initial screening of thermal stability. The recombinant bacteria of step 3 were inoculated into LB liquid medium containing 100 μg / mL ampicillin at an inoculation amount of 2% (v / v), and cultured at 37 °C, 200 r / min until the OD 600 = 0.6-0.8, then 2 mM IPTG was added to the culture medium, and after induction at 37 °C for 12 h, the bacterial bodies were collected by centrifugation at 4 °C, 8000 r / min for 10 min, and the supernatant was discarded. The bacterial bodies were washed three times with 50 mM PBS (pH 7.4) buffer, and the cells were crushed using an ultrasonic crusher [power 300 w, 3 s-7 s cycle (total 45 min)], and the crushing supernatant was obtained by centrifugation at 4 °C, 10,000 rpm for 10 min, and then incubated at 90 °C for 30 min to detect the residual enzyme activity of the mutant. The enzyme activity before incubation was defined as 100%, and after incubation at 95 °C for 30 min, the residual enzyme activity of the mutant K182R was 60.2%, and that of the wild type was 42.1%, indicating that the mutant K182R had better thermal stability than the wild type.
[0110] Other mutants were prepared according to the above recombination method, and mutants with lactulose conversion rate higher than that of the wild type enzyme were screened, and the results are shown in Figure 3 Figure 3 The conversion rate of lactulose for 29 mutants, wherein the conversion rate of lactulose for K182R is 35.1% higher than the wild type 31.2%, and K182R is selected for subsequent experiments.
[0111] Example 2: Purification of wild type and mutant K182R, the method is as follows:
[0112] (1) Recombinant bacteria culture and cell disruption
[0113] The BL21 / pET22b-DithAGE and BL21 / pET22b-K182R constructed in Example 1 were streaked on LB solid medium, and cultured at 37°C for 12h, and a single colony was picked into LB liquid medium containing ampicillin, and cultured at 37°C, 200r / min to OD 600 =0.6-0.8, and 2mM IPTG was added to the culture medium, and the expression was induced at 37°C for 8h, and then centrifuged at 4°C, 8000r / min for 10min, and the supernatant was discarded and the bacterial cells were collected. The obtained bacterial cells were washed three times with 50mM PBS (pH 7.4) buffer, and 2g of bacterial cells were resuspended in 50mL of 50mM PBS (pH 7.4) buffer to obtain a bacterial cell suspension. The cells were broken using an ultrasonic disrupter [power 300w, 3s-7s cycle (total 45min)], and the broken supernatant was obtained by centrifugation at 4°C, 10,000rpm for 10min, and the precipitate was removed after centrifugation, which was the crude enzyme solution.
[0114] (2) Purification of recombinant enzyme using nickel column
[0115] The lysis buffer was added at a ratio of 4mL per gram of bacterial precipitate, and the bacterial cells were resuspended. Lysozyme was added at a final concentration of 1mg / mL and mixed well, and the ice water bath was maintained for 30min, and the cells were broken by ultrasonic disruption. The ultrasonic power was 300w, each ultrasonic treatment was 10s, and the interval was 10s, and the total ultrasonic treatment was 6 times. Centrifugation was performed at 4°C, 10,000r / min for 30min, and the cell disruption supernatant was collected. 1mL of 50% (v / v) BevoGold TM (resistant to reduction chong type His-tag Purification Resin), centrifugation was performed at 4°C, 2000r / min for 10s to discard the storage solution, 0.5mL of non-denaturing lysis buffer was added to the gel and mixed well to balance the gel, and the liquid was discarded, and the balancing was repeated twice, and the liquid was discarded. 4mL of cell disruption supernatant was added, and the shaking was performed at 4°C, 50r / min for 1h. The cell disruption supernatant and BeyoGold TMThe mixture of His-tag Purification Resin was loaded into the affinity chromatography column, the cover at the bottom of the purification column was opened, the liquid in the column was allowed to flow out under the action of gravity, and about 20 μL of the flow-through was collected for subsequent analysis. The column was washed 5 times, 1 mL of non-denaturing washing liquid was added each time, and about 20 μL of the eluate passing through the column was collected each time for subsequent analysis, that is, the pure enzyme liquid (the enzyme protein concentration was 125 μg·mL -1 ).
[0116] Example 3: Optimum pH determination of wild type and mutant K182R
[0117] 200 g / L lactose was dissolved in 50 mM Na2HPO4-NaH2PO4 (pH 6.8-7.8) and 50 mM Briton-Robinson (pH 7.8-8.5) buffer, and the pure enzyme liquid prepared in Example 2 was used as the experimental enzyme to determine the optimum pH of the enzyme. The enzyme and the substrate were mixed at a volume ratio of 1:1 (v / v), incubated at 85°C for 8 h, and the enzyme activities of the wild type and the mutant K182R under different pH conditions were detected. It can be seen from Figure 4 that the optimum pH of the wild type and the mutant K182R is 7.4, and the difference in enzyme activity between the two is not significant under the same pH environment.
[0118] Example 4: Optimum reaction temperature determination of wild type and mutant K182R
[0119] 200 g / L lactose was dissolved in 50 mM Na2HPO4-NaH2PO4 (pH 7.4) buffer, and the pure enzyme liquid prepared in Example 2 was used as the experimental enzyme to determine the optimum reaction temperature. The enzyme and the substrate were mixed at a volume ratio of 1:1 (v / v), and the enzyme reaction system was incubated at 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, and 90°C for 8 h, and the enzyme activities of the wild type and the mutant K182R under different temperatures were detected. It can be seen from Figure 5 that the optimum reaction temperature of the wild type and the mutant K182R is 85°C, and the enzyme activity of the mutant K182R is higher than that of the wild type under the conditions of 85°C-90°C.
[0120] Example 5: Thermal stability analysis of wild type and mutant K182R
[0121] A certain concentration of the pure enzyme liquid of the wild type and the mutant K182R prepared in Example 2 was incubated at 85°C, 90°C, and 95°C, respectively, and the residual enzyme activity of the wild type and the mutant after incubation was detected to characterize the thermal stability. The enzyme activity without heat treatment was defined as the initial enzyme activity (i.e. the enzyme activity measured at 85°C, which has been confirmed), and the relative enzyme activity was defined as the ratio of the residual enzyme activity to the initial enzyme activity. It can be seen from Figure 6It can be seen that the wild type enzyme and mutant K182R still retain nearly 100% activity after incubation at 85°C for 5h; as the incubation temperature increases, the remaining enzyme activity begins to decrease, the wild type only remains 42% enzyme activity after incubation at 90°C for 5h, and K182R remains 64%, indicating that the thermal stability of mutant K182R is improved compared with the wild type; after incubation at 95°C for 5h, the wild type and mutant K182R almost lost all activity.
[0122] Example 6: Kinetic parameter analysis of wild type and mutant K182R
[0123] Prepare 50g / L, 100g / L, 150g / L, 200g / L, 250g / L, 300g / L lactose substrate solutions respectively, mix different concentrations of lactose solution with wild type and mutant K182R pure enzyme solution prepared in Example 2 at a volume ratio of 1:1 (v / v) respectively, and react at 85°C for 8h. Determine the enzyme activity of wild type and mutant, draw the nonlinear regression equation of substrate concentration and specific enzyme activity, and calculate the Michaelis constant K m value, catalytic constant k cat and catalytic efficiency k cat / K m value. The results are shown in the following table: the K m value of mutant K182R is 168.50mM, which is lower than that of wild type (205.10mM), indicating that the mutant has higher affinity for substrate; the catalytic efficiency k cat / K m of mutant K182R (1.56×10 -2 s -1 ·mM -1 ) is 1.28 times that of wild type (1.22×10 -2 s -1 ·mM -1 ).
[0124] Table 3 Kinetic parameter analysis of wild type and mutant K182R
[0125]
[0126] Example 7: Secondary structure analysis and melting temperature determination of wild type and mutant K182R
[0127] At 25°C, the secondary structure content of wild type and mutant K182R prepared in Example 2 was analyzed by circular dichroism spectroscopy. The data was collected at a scanning speed of 1nm / s from wavelength 190nm to 260nm. The circular dichroism curve of mutant K182R has certain changes compared with the wild type, as shown in Figure 7The secondary structure content of the wild type and the mutant was analyzed, and the results showed that the contents of random coil and beta-turn structure of the wild type and the mutant were similar, the content of alpha-helix structure of the mutant was 9% lower than that of the wild type, and the content of beta-sheet structure of the mutant was 5% higher than that of the wild type, as shown in Figure 2A. Figure 7 The increase of the content of beta-sheet structure of the mutant may be an important reason for the improvement of the thermal stability.
[0128] The wild type and the mutant prepared in Example 2 were taken as samples, and a temperature gradient from 20℃ to 90℃ was set, and the samples were heated at a rate of 0.5℃ / min, and the melting temperature T m of the wild type and the mutant was detected. m It was determined that the T m of the mutant K182R was 83.2℃, which was higher than that of the wild type (82.9℃), indicating that the mutant K182R had higher thermal stability than the wild type.
[0129] Example 8: Application of the wild type and the mutant K182R
[0130] 200g / L lactose was dissolved in 50mM Na2HPO4-NaH2PO4 (pH 7.4) buffer, and the wild type and the mutant K182R prepared in Example 2 were mixed with the substrate at a volume ratio of 1:1 (v / v) to construct an enzymatic reaction system for synthesizing lactulose, and the reaction was incubated at 90℃ for 8h, and the generation amount of lactulose was analyzed. As shown in Figure 3, with the extension of the reaction time, the conversion rate of lactose to lactulose catalyzed by the wild type and the mutant K182R increased; after 8h of reaction, the conversion rate of lactulose catalyzed by the mutant K182R reached 30.8%, which was higher than that of the wild type (25.0%), indicating that the mutant K182R was more suitable for catalyzing the conversion of lactulose under high temperature conditions. Figure 8
[0131] In summary, the N-acetylglucosamine 2-epimerase DithAGE from Streptococcus thermophilus was expressed by using the E. coli expression system through the fusion protein or short peptide tag strategy, and when the N-terminal of DithAGE was fused with Sumo tag, the conversion rate of lactose to lactulose catalyzed by the recombinant enzyme was the highest, reaching 31.2%; then, the mutant K182R was constructed by surface amino acid modification strategy, and the optimal pH and the optimal temperature thereof were 7.4 and 85℃, respectively, which were the same as those of the wild type, and the specific activity and the catalytic efficiency thereof were 1.15 times and 1.28 times of those of the wild type, respectively, and the conversion rate of lactose to lactulose catalyzed by the mutant K182R under the optimal conditions was 35.1%, which was 3.9% higher than that of the wild type; the melting temperature T m The value was 83.2℃, higher than that of the wild type (82.9℃), indicating that the mutant K182R had higher thermal stability than the wild type; incubation at 90℃ for 8h, the amount of lactulose was analyzed, and it was found that the conversion rate of lactulose by the mutant K182R reached 30.8%, higher than that of the wild type (25.0%), indicating that the mutant K182R was more suitable for catalyzing the conversion of lactulose under high temperature conditions; the secondary structure content of the wild type and the mutant K182R was analyzed, and it was found that the β-sheet content of the mutant increased by 5% compared with the wild type, and the increase of β-sheet content of the mutant may be an important reason for the improvement of thermal stability. Wild type DithAGE and mutant K182R can be used as biological catalysts for efficient preparation of lactulose, with the advantages of green environmental protection, low toxicity, less by-products and high product yield, and has the prospect of industrial application.
Claims
1. A kind N -acetylglucosamine 2-epimerase mutant, characterized by The amino acid sequence of the mutant is shown as SEQ ID No.
3.
2. An expression vector according to claim 1 wherein the nucleic acid sequence is operably linked to a promoter. N - a recombinant vector of an acetylglucosamine 2-epimerase mutant.
3. The recombinant vector of claim 2, wherein, comprising the sequence of SEQ ID No. 4 N - acetylglucosamine 2-epimerase mutant gene sequence.
4. A recombinant bacterium comprising the recombinant vector of claim 2.
5. The method of claim 1 N - Process for the preparation of acetylglucosamine 2-epimerase mutants, characterized in that, The method comprises the following steps: (1) using a recombinant vector containing Sumo enhancer element and wild type N - The mutant gene fragment was obtained by PCR reaction using the recombinant vector of acetylglucosamine 2-epimerase gene as template and mutation primer. (2) The mutant gene fragment is transformed into an engineering bacterium to obtain expression N - Recombinant bacteria of acetylglucosamine 2-epimerase mutant protein; (3) cultivating the recombinant bacteria, collecting and crushing the bacterial bodies, centrifuging the bacterial body crushing solution to obtain the supernatant containing the acetylglucosamine 2-epimerase, and then purifying the acetylglucosamine 2-epimerase from the supernatant to obtain the acetylglucosamine 2-epimerase. N - a crude enzyme solution of an acetylglucosamine 2-epimerase mutant.
6. The method of claim 5 N - Process for the preparation of acetylglucosamine 2-epimerase mutants, characterized in that, In step (1), the Sumo enhancer element and the wild type N The method for preparing the recombinant vector of the acetylglucosamine 2-epimerase gene is as follows: inserting the wild type N The nucleotide sequence of the acetylglucosamine 2-epimerase gene is shown in SEQ ID No.
2. N The nucleotide sequence of the acetylglucosamine 2-epimerase gene is shown in SEQ ID No.
2. The nucleotide sequence of the Sumo enhancer element, which is located in the 5' end of the wild type N - acetylglucosamine 2-epimerase gene, to obtain a recombinant vector containing the Sumo enhancer element and the wild type N - acetylglucosamine 2-epimerase gene.
7. The method of claim 5 N - Process for the preparation of acetylglucosamine 2-epimerase mutants, characterized in that, In step (1), the mutant primer comprises: Forward primer: 5'-TTGATGCACTTTAGTAAGTTAGCC CGT GAAAAATCAAA-3' Reverse primer: 5'-TTTCCAAAATCTTTGATTTTTC ACG GGCTAACTTACTAA-3' The annealing temperature of the PCR reaction is 53-57°C.
8. The method of claim 5 N - Process for the preparation of acetylglucosamine 2-epimerase mutants, characterized in that, In step (3), the method for culturing the recombinant bacterium is as follows: inoculate the recombinant E. coli into Luria-Bertani (LB) liquid medium containing ampicillin, shake culture at 37°C until the bacteria are in the logarithmic growth phase, then add Isopropyl β-D-thiogalactopyranoside (IPTG) to the culture solution, and induce expression at 37°C. In step (1), the recombinant vector contains a His tag, and in step (3), the crude enzyme solution is subjected to nickel column purification to obtain purified N - acetylglucosamine 2-epimerase mutants.
9. The method of claim 1 N - Use of an acetylglucosamine 2-epimerase mutant for the preparation of lactulose.
10. Use according to claim 9, characterized in that, The method comprises the following steps: taking lactose as a substrate, taking a buffer solution with a pH of 7.0-8.0 as a reaction medium, adding the lactose 6-phosphate 1-phosphatase, and adding the lactose 6-phosphate 1-kinase N An acetylglucosamine 2-epimerase mutant is added to form a reaction system, and lactulose is obtained by reacting at 80-95 DEG C.
Citation Information
Patent Citations
Cellobiose epimerase mutant and application thereof in galactopoiesis fructose
CN109628435A
Cellobiose epimerase mutant, engineering bacterium and application
CN117778364A