Endotoxin weakening escherichia coli expression strain as well as construction method and application thereof

Abstract

The invention belongs to the technical field of biology, and discloses an endotoxin attenuated escherichia coli expression strain which lacks WaaF, WaaC and LpxM and carries at least one of exogenous genes lpxE and lpxF. According to the invention, by preparing the escherichia coli expression strain lacking WaaF, WaaC and LpxM genes at the same time, the dephosphorylation rate of lipoid A of the expression strain is increased, the phosphorylation ability of lipoid A is reduced, and meanwhile, the phosphorylation ability of lipoid A is improved. Through common deletion of the genes, the resistance of the strain to polymyxin B is obviously improved. In addition, the invention further discloses a construction method of the endotoxin weakened escherichia coli expression strain and application of the endotoxin weakened escherichia coli expression strain.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to an endotoxin-attenuated Escherichia coli expression strain, a method for constructing the same, and an application thereof. Background Art

[0002] The advantages of Escherichia coli, such as fast growth rate, low culture cost, clear genetic background, high expression level of its expression system, easy scale-up and short turnover time, make it the main prokaryotic expression system for foreign genes and have been widely used in the expression and production of recombinant protein drugs. However, the application of the Escherichia coli expression system in the research and development and production of genetic engineering vaccines is affected by endotoxin contamination, which has become a bottleneck for its industrial-scale application.

[0003] Bacterial endotoxin is a component in the cell wall of Gram-negative bacteria, also known as lipopolysaccharide (LPS). The synthesis and transport of lipopolysaccharide molecules are essential conditions for the normal survival of bacteria and are composed of discontinuous structural regions such as lipid A, core polysaccharide, and O antigen units. Among them, lipid A is a hydrophobic glycolipid, which is the main component structure of the outer layer of the bacterial outer membrane and is the toxic active group of endotoxin, and is closely related to its pathogenicity. The core polysaccharide and O antigen are attached to the surface of the bacteria by de-lipid A linkage. When endotoxin enters the body, the lipid A released by the lipopolysaccharide molecule activates TLR-4 in the body. Different structures of lipid A can produce different types of cytokines in the body, causing different immune responses. Therefore, the structure of lipid A is an important factor determining the pathogenicity of bacteria.

[0004] Endotoxin can be released in large amounts through the lysis of dead bacteria, and can also be released in the form of live bacteria cell wall foaming. It is ubiquitous in the environment, small in volume, high in chemical stability, and has high thermal stability. Therefore, general filtration, heating, and chemical methods are not easy to remove or inactivate it. Therefore, it is best to achieve attenuation through genetic modification from the source.

[0005] Endotoxins can induce fever reactions and septic shock in mammals at high concentrations. Vaccines using the Escherichia coli expression system are easily contaminated with endotoxins. Therefore, the removal of residual endotoxins in products is essential for injectable drugs, biological products, etc. used in the treatment of human diseases, and is particularly important for the quality control of cell therapy products. Currently, there are various methods for removing endotoxins, including ultrafiltration, activated carbon, surfactants, anion exchange chromatography, and immobilized agarose. The use of these strategies can usually achieve endotoxin levels below 5 EU, but it will result in a significant reduction in yield, an increase in cost, or a loss of the biological activity of the required protein. However, for the development of veterinary vaccines, due to the limitation of the process cost, the endotoxin content can be as high as over 100 EU. Most of the currently approved poultry subunit vaccines are against Infectious Bursal Disease Virus (IBDV), and the surface antigen is the VP2 protein. It can be produced using a prokaryotic system. Developing a strain with attenuated endotoxin to achieve a balance between protein expression production and endotoxin attenuation has certain value for reducing the production cost of veterinary subunits, social development, and the national economy.

[0006] Chinese Patent Application 202310188656.X discloses a method for constructing Escherichia coli with low endotoxin, which involves knocking out genes related to lipopolysaccharide synthesis in Escherichia coli. It also discloses the corresponding Escherichia coli with low endotoxin, its application as a host bacterium for expressing low-endotoxin type proteins, and the corresponding genetically engineered Escherichia coli strain producing low-endotoxin recombinant human collagen.

[0007] The technical idea of this solution is to use genetic recombination to transform the strain to produce low-endotoxin recombinant human collagen. The obtained Escherichia coli has inhibited the lipopolysaccharide synthesis pathway by knocking out genes related to lipopolysaccharide synthesis, thereby reducing the endotoxin content of recombinant human collagen. Furthermore, it directly reduces the steps of acid hydrolysis and alkali hydrolysis in the original production chemical process, improves product purity and yield, and significantly reduces production costs, thus synthesizing cheap and highly efficient low-endotoxin recombinant human collagen.

[0008] Further observing the specification of this solution, the genes related to lipopolysaccharide synthesis knocked out are at least one of the following genes: lpxA gene, lpxB gene, lpxC gene, lpxD gene, lpxH gene, lpxK gene, lpxP gene, lpxL gene, lpxM gene, msbA gene, wzX gene, wzY gene, waaA gene, waaG gene, pagP gene, eptA gene, kdsD gene, gutQ gene, kdtA gene, waaL gene, waaF gene, and waaC gene.

[0009] Moreover, this solution does not consider starting from the aspect of inserting new foreign genes to further weaken the toxicity of endotoxin.

[0010] Chinese Patent Application No. 202310404567.4 discloses a recombinant Escherichia coli capable of efficiently producing monophosphoryl lipid A vaccine adjuvant. This solution knocked out 132 genes related to cell wall surface molecules, phospholipid and glucose transport, phosphoethanolamine modification, and enoyl-ACP reductase in Escherichia coli MG1655, expressed lipid A modification genes FnlpxE, SepagP, and SepagL, and constructed the strain MW021 / pTEPL.

[0011] The growth performance of MW021 / pTEPL was significantly improved, and antibiotics and inducers were no longer required during the fermentation process; in a 2-L fermenter system, the highest OD600 nm of MW021 / pTEPL could reach 38.54, and it could produce 13.84 g / L of dry cells and approximately 88.99 mg / L of total lipid A;

[0012] The total lipid A only contained two structures, namely MPL and D-MPLA;

[0013] Further observing the specification of this solution, it can be seen that the purpose of this solution is to enhance the expression of MPL and D-MPLA. Since MPL and D-MPLA belong to derivatives of lipid A, the purpose of this solution is to enhance the expression of specific derivatives of lipid A;

[0014] At the same time, although this solution discloses the overexpression of the lipid A modification gene FnlpxE, the purpose of overexpressing this gene in this solution should be to improve the growth performance of MW021 / pTEPL.

[0015] The problem to be solved by this solution: how to provide a new Escherichia coli expression strain with low endotoxin toxicity. Summary of the Invention

[0016] The purpose of the present invention is to provide a method for constructing an Escherichia coli expression strain with weakened endotoxin. By knocking out key genes related to endotoxin toxicity, obtaining relevant gene deletion strains, and introducing foreign genes into the relevant gene deletion strains respectively, the toxicity of the endotoxin in the strain is further weakened.

[0017] To achieve the above purpose, the present application discloses an Escherichia coli expression strain with weakened endotoxin, which lacks at least one of WaaF, WaaC, and LpxM, and carries at least one of the foreign genes lpxE and lpxF.

[0018] By knocking out the key genes WaaF, WaaC or LpxM that affect the toxicity of endotoxin, the related gene deletion strains are obtained, and the exogenous genes lpxE and lpxF are introduced into the related defective strains respectively and lpxE and lpxF are induced to express, so as to further modify and weaken the endotoxin produced by Escherichia coli. The expression strain constructed by this method, from the perspective of cell physiology, has a significantly decreased growth rate compared with the wild-type strain; from the chemical structure, the lipid A extracted from this strain shows structural defects and dephosphorylation; in the MIC experiment of polymyxin B, the MIC value of the strain increases, which means that this strain has weakened the amount of surface anions by removing phosphate groups, thus reducing the binding with polymyxin B.

[0019] Preferably, it lacks WaaF, WaaC and LpxM and carries at least one of the exogenous genes lpxE and lpxF.

[0020] Preferably, the lpxE is specifically FtlpxE or FnlpxE;

[0021] The lpxF is specifically FtlpxF or FnlpxF.

[0022] Preferably, it lacks WaaF, WaaC and LpxM and carries the exogenous gene lpxE.

[0023] Preferably, it lacks WaaF, WaaC and LpxM and carries the exogenous gene FtlpxE.

[0024] In addition, the present application also discloses a construction method for constructing the above-mentioned endotoxin-attenuated Escherichia coli expression strain, which is characterized by including the following steps:

[0025] Step 1: Using BL21 competent bacteria as the basic strain, knocking out the genes of WaaF, WaaC and / or LpxM of the BL21 competent bacteria to obtain a gene deletion strain lacking the genes of WaaF, WaaC and / or LpxM;

[0026] Step 2: Inserting the exogenous genes lpxE and / or lpxF into the gene deletion strain obtained in Step 1; obtaining a gene deletion strain capable of expressing lpxE and / or lpxF.

[0027] Preferably, the Step 1 specifically includes the following sub-steps:

[0028] Step A1: Using BL21 competent bacteria as the basic strain to perform heat shock transformation of the pKD46 plasmid to obtain BL21 / pKD46 electrocompetent bacteria;

[0029] Step A2: Use the gene knockout cassette of WaaFC and the gene knockout cassette of lpxM to knockout the WaaF, WaaC, and lpxM genes of the electrocompetent BL21 / pKD46 bacteria, respectively, to obtain a gene deletion strain lacking the WaaF, WaaC, and LpxM genes.

[0030] Preferably, the preparation method of the gene knockout cassette of WaaFC is as follows:

[0031] Using pKD4 as a DNA template, add it to the PCR reaction system designed for the WaaF and WaaC genes, and amplify to obtain a nucleic acid fragment with FRT flanks and a kanamycin resistance gene. After the amplified PCR product is identified by nucleic acid gel electrophoresis, use the HiPure Gel Pure DNA Mini Kit to recover the PCR product to obtain the gene knockout cassette of WaaFC;

[0032] The preparation method of the gene knockout cassette of lpxM is as follows: Using pKD4 as a DNA template, add it to the PCR reaction system designed for the lpxM gene, and amplify to obtain a nucleic acid fragment with FRT flanks and a kanamycin resistance gene. After the amplified PCR product is identified by nucleic acid gel electrophoresis, use the HiPure Gel Pure DNA Mini Kit to recover the PCR product to obtain the gene knockout cassette of lpxM.

[0033] Preferably, the specific operation of step 2 is: Prepare the gene deletion strain obtained in step 1 into an electrocompetent gene deletion strain, and then introduce the plasmid carrying the exogenous gene lpxE and / or lpxF into the electrocompetent gene deletion strain to obtain a gene deletion strain capable of expressing lpxE and / or lpxF.

[0034] In addition, the present application also discloses the use of the endotoxin-attenuated Escherichia coli expression strain as described above for expressing low-endotoxin proteins.

[0035] The beneficial effects of the present application are:

[0036] The present application provides a method for constructing an endotoxin-attenuated Escherichia coli expression strain. By knocking out the key genes WaaF, WaaC, and LpxM that affect endotoxin toxicity, the corresponding gene deletion strains are obtained, and the exogenous genes lpxE and lpxF are introduced into the relevant defective strains and induced to express lpxE and lpxF, thereby further modifying and weakening the endotoxin produced by Escherichia coli. The expression strain constructed by this method shows a significantly decreased growth rate compared to the wild-type strain from the perspective of cell physiology; from the chemical structure perspective, the lipopolysaccharide A extracted from this strain shows structural defects and dephosphorylation; in the MIC experiment of polymyxin B, the MIC value of this strain is increased; in the in vitro cell immune stimulation experiment, both this strain and its protein products show a significant decrease in the production of the inflammatory cytokine TNF-α. Description of the Drawings

[0037] Figure 1 It is the electrophoresis test chart of the WaaFC gene knockout cassette;

[0038] Figure 2 It is the electrophoresis test chart of the wild-type WaaFC gene and the WaaFC positive deletion strain, where lane 1 is the band of the wild-type WaaFC gene, and lanes 2 and 3 are the bands of the WaaFC positive deletion strain;

[0039] Figure 3 It is the electrophoresis test chart of the WaaFC positive deletion strain after eliminating kanamycin resistance, where lanes 1 and 2 are the bands of the WaaFC positive deletion strain that has eliminated kanamycin resistance;

[0040] Figure 4 It is the electrophoresis test chart of the LpxM gene knockout cassette;

[0041] Figure 5 It is the electrophoresis test chart of the wild-type LpxM gene and the LpxM positive deletion strain, where lane 1 is the band of the wild-type LpxM gene, and lanes 2 and 3 are the bands of the LpxM positive deletion strain;

[0042] Figure 6 It is the electrophoresis test chart of the LpxM positive deletion strain after eliminating kanamycin resistance;

[0043] Figure 7 It is the growth status comparison chart of BL21(DE3) with DKO and TKO;

[0044] Figure 8 It is the test result chart of the calcium ion sensitivity of DKO;

[0045] Figure 9 It is the test result chart of the calcium ion sensitivity of TKO;

[0046] Figure 10 Comparison chart of the growth status differences among TKO / pACYCduet-FtlpxE, TKO / pACYCduet-FnlpxE, and TKO;

[0047] Figure 11 Chart showing the changes in the growth status of TKO induced by 1 mM IPTG to express FtlpxE and the comparison results of its calcium ion sensitivity;

[0048] Figure 12 Chart showing the changes in the growth status of TKO induced by 1 mM IPTG to express FnlpxE and the comparison results of its calcium ion sensitivity;

[0049] Figure 13 Lipid A mass spectrum of BL21(DE3);

[0050] Figure 14 Chart showing the conversion rate results of lipid A dephosphorylation of DKO / FtlpxE under the induction of 1 mM IPTG;

[0051] Figure 15 Chart showing the conversion rate results of lipid A dephosphorylation of DKO / FnlpxE under the induction of 1 mM IPTG;

[0052] Figure 16 Chart showing the conversion rate results of lipid A dephosphorylation of TKO / FtlpxE without IPTG induction;

[0053] Figure 17 Chart showing the conversion rate results of lipid A dephosphorylation of TKO / FtlpxE under the induction of 1% IPTG;

[0054] Figure 18 Chart showing the conversion rate results of lipid A dephosphorylation of TKO / FtlpxE under the induction of 1 mM IPTG;

[0055] Figure 19 Chart showing the conversion rate results of lipid A dephosphorylation of TKO / FtlpxF without IPTG induction;

[0056] Figure 20 Chart showing the conversion rate results of lipid A dephosphorylation of TKO / FtlpxF under the induction of 1% IPTG;

[0057] Figure 21 Chart showing the conversion rate results of lipid A dephosphorylation of TKO / FtlpxF under the induction of 1 mM IPTG. Detailed implementation methods

[0058] The embodiments of the present invention will be described clearly and completely below. In the description of the present invention, it should be noted that for those conditions not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained by commercial purchase.

[0059] Product information:

[0060] BL21(DE3) competent cells: BL21(DE3) Chemically Competent Cell, 100 μl / vial, General Biosystems Co., Ltd.

[0061] LB Broth: Beijing Coolaber Technology Co., Ltd.

[0062] 2×Phanta Flash Master Mix: 2×Phanta Flash Master Mix (Dye Plus), Novoprotein Scientific Inc.

[0063] SOB Medium: Beijing Coolaber Technology Co., Ltd.

[0064] HiPure Gel Pure DNA Mini Kit: HiPure Gel Pure DNA Mini Kit, an agarose gel DNA recovery kit, Shanghai Magigene Biotechnology Co., Ltd.

[0065] Example 1

[0066] 1.1 Preparation of BL21(DE3) / pKD46 strain

[0067] Heat shock transformation: First, adjust the temperature of the constant temperature water bath to 42 °C. Take out a tube (100 μl) of BL21(DE3) competent cells from the -80 °C ultra-low temperature freezer, immediately warm it with your finger to melt and then insert it on ice, and perform ice bath for 5 - 10 min. Add 5 μl of pKD46 plasmid mixture (DNA content does not exceed 100 ng), gently shake and then place it on ice for 30 min. Gently shake well and then insert it into the 42 °C water bath for 90 s for heat shock, and then quickly put it back on ice and let it stand for 3 min. Add 1 ml of LB liquid medium (without antibiotics) to it in the ultra-clean workbench, gently mix well, and then fix it on the spring frame of the shaker and shake it at 37 °C for 1 h. Take 100 μl of the bacterial solution in the ultra-clean workbench and spread it evenly on the LB solid medium containing ampicillin, and place it in the 30 °C incubator for overnight culture.

[0068] Screening for positive clone strains: Prepare the PCR reaction system in advance (as shown in Table 1). Pick a single colony and transfer it to the LB solution. Take 1 μl of the bacterial solution and add it to the 20 μl PCR reaction system as the DNA template. Place it in a PCR amplifier and set the reaction conditions as follows: pre-denaturation at 98°C for 2 min, denaturation at 98°C for 10 sec, annealing at 55°C for 10 sec, extension at 72°C for 10 sec, 35 cycles, final extension at 72°C for 2 min, and end the reaction at 16°C. Detect the PCR products by 1% agarose gel electrophoresis and observe the results. According to the results of agarose gel electrophoresis, streak the corresponding bacterial solution onto a plate and place it in an incubator at 30°C for overnight culture for secondary testing. Repeat the above steps to finally obtain the BL21(DE3) strain carrying the pKD46 plasmid.

[0069] Table 1

[0070] Component Volume (μL) Forward Primer 1 (10 μmol / L) 1 Reverse Primer 1 (10 μmol / L) 1 DNA Template 1 <![CDATA[ddH2O]]> 7 2×Phanta Flash Master Mix 10 Total Volume 20

[0071] The nucleotide sequence of the upstream primer 1 is: TTCCTAATCAGCCCGGCATTTC;

[0072] The nucleotide sequence of the downstream primer 1 is: ACGACATAATGCAGGCCTTC.

[0073] 1.2 Preparation of electrocompetent BL21(DE3) / pKD46

[0074] Resuscitation of the strain: Inoculate the strain BL21(DE3) / pKD46 on an LB solid medium containing ampicillin and penicillin and place it in an incubator at 30°C for overnight culture.

[0075] Preparation of the bacterial solution: Use an inoculation loop to scrape 1 loop of the strain and inoculate it into a 50 ml shake flask of SOB liquid medium containing ampicillin, penicillin, and 1 mM L-arabinose. Place it in a shaker at 30°C and shake until OD 600nm = 0.5 - 0.6, then immediately place it on ice, balance it, centrifuge at 4000 g for 10 min at 4°C, discard the supernatant, and collect the bacterial cells.

[0076] Elution of salt ions: Resuspend the bacterial cells in 10% glycerol on ice. After thorough mixing by pipetting, centrifuge at 4000 g for 10 min at 4°C, discard the supernatant, and collect the bacterial cells. Repeat this process 3 times.

[0077] Obtain electrocompetent BL21(DE3) / pKD46: Resuspend the bacterial cells in 1 ml of 10% glycerol on ice. Add 100 μl of the competent cells to a 1.5 ml EP tube and repeat to dispense a total of 10 tubes of 100 μl of competent cells for standby.

[0078] 1.3 Preparation of the target gene knockout cassette

[0079] 1.3.1 Preparation of the gene knockout cassette of WaaFC:

[0080] Obtaining the resistance gene: Using pKD4 as the DNA template, add it to the prepared 50 μl PCR reaction system. Set the reaction conditions as pre-denaturation at 98°C for 2 min, 98°C for 10 sec, 55°C for 5 sec / kb, 72°C for 10 sec, 35 cycles, extension at 72°C for 2 min, and end the reaction at 16°C. Detect the PCR product by 1% agarose gel electrophoresis, observe the results, and obtain the nucleic acid fragment band with FRT flanks and Km resistance;

[0081] The specific formula of the above PCR reaction system is shown in Table 2:

[0082] Table 2

[0083] Component Volume (μL) Forward Primer 2 (10 μmol / L) 2 Reverse Primer 2 (10 μmol / L) 2 DNA Template 1 <![CDATA[ddH2O]]> 20 2×Phanta Flash Master Mix 25 Total Volume 50

[0084] The nucleotide sequence of the upstream primer 2 is: ATGAAAATACTGGTGATCGGCCCGTC TTGGGTTGGCGACATGATGATGTCATATGAATATCCTCCTTAG;

[0085] The nucleotide sequence of the downstream primer 2 is: CTGTTAAGCGATTCATTGAAGAAAACGCT GAAAACGCTGCTATGATTTAATGTAGGCTGGAGCTGCTTCG;

[0086]

[0087] The sequence of WaaC is: Atgaaaatactggtgatcggcccgtcttgggttggcgacatgatgatgtcgcaaagtctctatcgcacgctccaggcgcgctatccccaggcgataatcgatgtgatggcaccggcatggtgccgtccattattatcgcggatgccggaagttaacgaagctattcctatgcctctcggtcacggagcgctggaaatcggcgaacgccgtaaactgggtcatagcctgcgtgaaaagcgctacgaccgcgcctacgtcttacccaactccttcaaatctgcattagtgcctttcttcgcgggtattcctcatcgcaccggctggcgcggcgagatgcgctacggtttactcaacgatgtacgcgtgctcgataaagaagcctggccgctaatggtggaacgctatgtcgcgctggcctatgacaaaggcgtgatgcgtaccgcacaagatctaccaaaaccgttgttatggccgcaattgcaggtgagcgaaggtgaaaaatcatatacctgtaatcaattttcgctttcatcagaacgtccgatgattggtttttgcccgggggcggagtttggtccggcaaaacgctggccacattaccactatgctgagctggcaaagcagctgattgatgaaggttatcaggtggttctgtttggctcggcgaaagatcatgaggcgggcaatgagattcttgccgctttgaataccgagcagcaggcatggtgtcggaacctggcgggggaaacacagcttgatcaagcggttatcctgattgcagcctgtaaagccattgtcactaacgattctggcctgatgcacgttgcggcggcgctcaatcgtccgctggttgccttgtatggtccgagtagcccggacttcacaccgccgctatcccataaagcgcgcgtgatccgtctgattaccggctatcacaaagtgcgtaaaggtgacgctgcggagggttatcaccagagcttgatcgacattactccccagcgcgtactggaagaactcaacgcgctattgttacaagaggaagtctga;

[0088] Meanwhile, since the WaaF gene is relatively close to the WaaC gene, a gene knockout cassette (WaaFC gene knockout cassette) capable of synchronous knockout is designed for the two in this application.

[0089] Recovery and purification of nucleic acid fragments: The remaining PCR system products were recovered according to the instructions of the HiPure Gel Pure DNA MiniKit (kit). The specific method is as follows: Briefly centrifuge the PCR products, measure their volume with a pipette, and transfer them to a sterilized 2 ml centrifuge tube. Add an equal volume of Buffer GDP, and invert or vortex to mix evenly. Place the HiPure DNA column on the collection tube. Transfer the mixture to the DNA column and centrifuge at 12,000×g for 30 - 60 seconds. Discard the filtrate, put the column back into the 2 ml centrifuge tube, add 600 μl of Buffer DW2 (diluted with absolute ethanol) to the column, and centrifuge at 12,000×g for 30 - 60 seconds. Repeat this step once. Discard the filtrate, open the lid of the column, air dry for 5 minutes to completely remove ethanol, then place it in a new 1.5 ml centrifuge tube, and add 15 - 30 μl of ddH2O to the center of the column membrane. Let it stand for 2 minutes, centrifuge at 12,000×g, discard the column, obtain the WaaFC gene knockout cassette, detect the nucleic acid concentration, and store it at -20°C for standby.

[0090] 1.3.2 Preparation of the lpxM gene knockout cassette:

[0091] Obtaining of the resistance gene: Using pKD4 as the DNA template, add it to the prepared 50 μl PCR reaction system, set the reaction conditions as pre-denaturation at 98°C for 2 min, 98°C for 10 sec, 55°C for 10 sec, 72°C for 5 sec / kb, 35 cycles, extension at 72°C for 2 min, and end the reaction at 16°C. The PCR products were detected by 1% agarose gel electrophoresis, observe the results, and obtain the nucleic acid fragment band with FRT flanks and Km resistance;

[0092] The specific formula of the above PCR reaction system is shown in Table 3:

[0093] Table 3

[0094] Component Volume (μL) Forward Primer 3 (10 μmol / L) 2 Reverse Primer 3 (10 μmol / L) 2 DNA Template 1 <![CDATA[ddH2O]]> 20 2×Phanta Flash Master Mix 25 Total Volume 50

[0095] The nucleotide sequence of the upstream primer 3 is: TTATTTGATGGGATAAAGATCTTTGCG CTTATACGGCTGGATTTCGCCCGATATGAATATCCTCCTTAG;

[0096] The nucleotide sequence of the downstream primer 3 is: GATTTATCAAACTCAGGAATGTATTCGCTATTATTTTTTTTCGTTTCCATTGTAGGCTGGAGCTGCTTCG;

[0097] It should be noted that the nucleotide sequence of lpxM is: ttatttgatgggataaagatctttgcgcttatacggct ggatttcgcccggtttgcgagttttcagcaattttagtatccaggtgtattgttctggtcgcggaccaacaaaaatctcgacttcttcattcatccgccgcgcaatcgtatgatcatccgcctctaacagatcatccatcggtgggcgcacctgaatcgtcagacgatgcgtcttgccatcataaatcggaaacagcggtacaacgcgcgcacggcacactttcatcaaacgaccaatcgcgggcaacgtcgctttataggtggcaaagaaatccacaaattcgctgtgctctgggccatgatcctgatcgggtaaataatatccccagtacccctgacgtaccgactggatgaatggtttaataccgtcatttctcgcatgcagacgaccgccaaagcgacgacgcaccgtgttccagacataatcaaaaaccgggttgccctgattatggaacatcgctgccattttctgcccttgcgaggccatcagcatggcaggaatatcgacggcccaaccgtgcggcaccagaaagataactttctcgttattacgccgcatctcttcgatgatctccagcccttgccagtcaacgcgcggctgaattttctccggcccgcgtattgccaactcagccatcattgccatcgcttgcggcgcggtggcaaacatctcatcaacaatcgcttcgcgttcagcttcactacgttctggaaagcagagcgacagattgattaacgcacgacggcgtgagctttttcccagtcgtccggcaaaacgtcccagccgtgccagaatgggatcacggaactttggcggcgttaaagcgatacccgccatcgctgctacgcccagccatgctccccagtagcgcgggtggcgaaaggatttatcaaactcaggaatgtattcgctattattttttttcgtttccat。

[0098] Recovery and purification of nucleic acid fragments: The remaining PCR system products were recovered according to the instructions of the HiPure Gel Pure DNA MiniKit (kit). The specific method is as follows: Briefly centrifuge the PCR products, measure their volume with a pipette, and transfer them to a sterilized 2 ml centrifuge tube. Add an equal volume of Buffer GDP and mix well by inverting or vortexing. Place the HiPure DNA column in the collection tube. Transfer the mixture to the DNA column and centrifuge at 12,000×g for 30 - 60 seconds. Discard the filtrate, put the column back into the 2 ml centrifuge tube, add 600 μl of Buffer DW2 (diluted with absolute ethanol) to the column, and centrifuge at 12,000×g for 30 - 60 seconds. Repeat this step once. Discard the filtrate, open the lid of the column, air dry for 5 minutes to completely remove ethanol, then place it in a new 1.5 ml centrifuge tube, and add 15 - 30 μl of ddH2O to the center of the column membrane. Let it stand for 2 minutes and centrifuge at 12,000×g. Discard the column to obtain the gene knockout cassette of lpxM, detect the nucleic acid concentration, and store it at -20°C for later use.

[0099] 1.4 Knockout of the target gene

[0100] Preparation of the DKO strain (the strain with waaF and waaC genes knocked out):

[0101] Electroporation: Take out the prepared BL21(DE3) / pKD46 electrocompetent cells from the -80°C refrigerator and place them on ice. Add the recovered waaFC gene knockout cassette fragment, mix well, transfer it to the electroporation cuvette. Set the parameters of the electroporator and perform electroporation under the conditions of voltage 2500 V, resistance 200 Ω, and capacitance 25 μF. Then add 1 ml of SOC liquid medium containing 1 mM L-arabinose, transfer it to a 1.5 ml centrifuge tube, and incubate it overnight at 30°C in a shaker. The next day, spread it on the LB solid medium containing kanamycin and ampicillin and incubate it overnight in a 30°C incubator to obtain the strain with waaF and waaC genes knocked out, as Figure 1 - 3 shown.

[0102] Preparation of the SKO strain (the strain with lpxM gene knocked out):

[0103] It is basically the same as the preparation method of the above DKO strain, except that the lpxM gene knockout cassette fragment is used to replace the waaFC gene knockout cassette fragment to obtain the strain with lpxM gene knocked out, as Figure 4 - 6 shown.

[0104] Preparation of the TKO strain (the strain with waaF, waaC, and lpxM genes knocked out):

[0105] Basically the same as the preparation method of the above SKO strain, except that after lpxM knockout, the waaF and waaC genes are further knocked out using the waaFC gene knockout cassette.

[0106] 1.5 Screening for positive clone strains: Prepare the PCR reaction system in advance. Pick a single colony and resuspend it in the LB solution. Take 1 μl of the bacterial solution and add it to the 20 μl PCR reaction system as the DNA template. Put it into the PCR amplifier, and set the reaction conditions as pre-denaturation at 98°C for 2 min, denaturation at 98°C for 10 sec, annealing at 55°C for 10 sec, extension at 72°C for 5 sec / kb, 35 cycles, final extension at 72°C for 2 min, and end the reaction at 16°C. Detect the PCR product by 1% agarose gel electrophoresis and observe the results. According to the results of agarose gel electrophoresis, pick the corresponding bacterial solution and streak it on a plate, and place it in an incubator at 30°C for overnight culture for secondary inspection. Repeat the above steps to finally obtain the DKO strain containing pKD46;

[0107] The screening methods for SKO and TKO positive clone strains refer to the above screening method for DKO positive strains.

[0108] 1.6 Elimination of the pKD46 plasmid: Inoculate the identified DKO, SKO, and TKO strains into 10 ml of LB liquid medium, place them in a shaker at 42°C, shake, and culture overnight. The next day, spread them on LB solid media containing ampicillin and kanamycin respectively, and place them in an incubator at 42°C for overnight culture. Then observe whether there are colonies growing on the LB medium containing ampicillin until no bacteria grow on the LB medium containing ampicillin but bacteria grow on the LB medium containing kanamycin. Transfer the plate to finally obtain the DKO, SKO, and TKO strains and preserve the strains.

[0109] 1.7 Elimination of resistance genes

[0110] Prepare the electrocompetent cells of DKO, SKO, and TKO respectively, add the pCP20 plasmid for electrotransformation, add 1 ml of SOC recovery solution, place it in a shaker at 30°C for overnight culture. After screening out the strains carrying pCP20 using the LB solid medium containing chloramphenicol, inoculate them into 1 ml of LB culture medium containing chloramphenicol, shake at 30°C for overnight culture. The next day, spread them on LB solid media containing kanamycin and chloramphenicol respectively, and repeat the operation until no colonies grow on the LB solid medium containing kanamycin. After identification, obtain the DKO, SKO, and TKO strains without kanamycin resistance carrying pCP20. Inoculate them into 1 ml of LB culture medium respectively, shake at 42°C for overnight culture. The next day, spread them on LB solid media containing chloramphenicol and drug-free respectively, and observe whether there are colonies growing on the LB solid medium containing chloramphenicol until no colonies grow to obtain the final target strains without resistance.

[0111] 1.8 Construction of exogenous gene expression strains

[0112] Prepare electrocompetent cells from TKO and transform them with pACYCDuet-FtlpxE and pACYCDuet-FtlpxF respectively to obtain TKO / pACYCDuet-FtlpxE, TKO / pACYCDuet-FtlpxF and strains. Preserve them with glycerol and store at -80 °C for later use;

[0113] Prepare electrocompetent cells from SKO and transform them with pACYCDuet-FtlpxE and pACYCDuet-FtlpxF respectively to obtain SKO / pACYCDuet-FtlpxE, SKO / pACYCDuet-FtlpxF and strains. Preserve them with glycerol and store at -80 °C for later use.

[0114] Example 2

[0115] 2.1 Determination of growth curve

[0116] Inoculate BL21(DE3), DKO, TKO, TKO / pACYCDuet-FtlpxE, and TKO / pACYCDuet-FnlpxE into LB culture medium for resuscitation. After overnight culture, dilute them 100 times and inoculate them into LB culture medium, LB culture medium containing 1 M CaCl2, LB culture medium containing 1 mM IPTG, and LB culture medium containing both 1 mM IPTG and 1 M CaCl2 respectively. Incubate at 37 °C, 250 rpm / min. Use a microbial growth curve analyzer to detect the OD600nm value of the bacterial solution every hour and shake culture for 72 h to plot the growth curve of the strains. Compare the differences in the growth status of the strains before and after dephosphorylation and the changes in their sensitivity to calcium ions.

[0117] 2.2 Determination of MIC value of polymyxin B

[0118] The MIC values of polymyxin B against BL21(DE3), SKO, TKO, SKO / pACYCDuet-Ft lpxE, SKO / pACYCDuet-FtlpxF, TKO / pACYCDuet-FtlpxE, and TKO / pACYCDuet-Ft lpxF were determined using the microdilution method. A 96-well cell culture plate was taken, and a drug sensitivity plate with PB concentrations of 128, 64, 32, 16, 8, 4, 2, 1, 0.5, 0.25, 0.125, and 0 mg / L from column 1 to column 7 was prepared. Equal amounts of the bacterial suspensions of BL21(DE3), SKO, TKO, SKO / pACYCDuet-FtlpxE, SKO / pACYCDuet-FtlpxF, TKO / pACYCDuet-FtlpxE, and TKO / pACYCDuet-FtlpxF were added to each row. After thorough mixing, the plate was placed in an incubator at 37 °C and incubated statically for 16 h. The results were observed, the OD600nm was measured, and the MIC values of each strain were calculated and compared.

[0119] 2.3 Extraction and mass spectrometry analysis of lipid A

[0120] BL21(DE3), DKO / pACYCDuet-FtlpxE, DKO / pACYCDuet-FnlpxE, DKO / pACYCDuet-FtlpxF, TKO / pACYCDuet-FtlpxE, TKO / pACYCDuet-FnlpxE, and TKO / pACYCDuet-FtlpxF were taken. After expanded culture, the precipitate was collected by centrifugation. An appropriate amount of 0.1 M citric acid solution (pH 2.9) was added, and the precipitate was resuspended and vortexed to mix thoroughly. Then, it was placed in a boiling water bath at 100 °C for 90 min for sufficient hydrolysis to release lipid A. The acid-hydrolyzed sample was cooled and centrifuged at 8000 rpm / min for 5 min. The supernatant was discarded, 10 ml of pure water was added to resuspend the precipitate, and it was vortexed to mix thoroughly. Then, it was centrifuged again, and the supernatant was discarded. After repeating this process 2 - 3 times, the precipitate was taken and dried overnight to obtain the lipid A samples of each strain. Using the MALDI mass spectrometry analysis method, the spectrum was scanned to analyze the structural differences of lipid A in the strains.

[0121] 2.4 ELISA determination of cytokines

[0122] BL21(DE3), SKO, DKO, TKO, SKO / pACYCDuet-FtlpxE, SKO / pA CYCDuet-FtlpxF, TKO / pACYCDuet-FtlpxE, and TKO / pACYCDuet-FtlpxF were taken, revived, and cultured to OD600 nm= 0.323. The cells were collected by centrifugation and endotoxin samples were prepared by boiling for 90 min for later use. Electrocompetent cells of BL21(DE3), SKO, TKO, SKO / pACYCDuet-FtlpxE, SKO / pACYCDuet-FtlpxF, TKO / pACYCDuet-FtlpxE, and TKO / pACYCDuet-FtlpxF were transformed with the pET28a(+)-IBDV-VP2 plasmid, induced for expression, and the IBDV-VP2 protein was overexpressed using 1 M IPTG at 37 °C to obtain its inclusion body protein. Endotoxin samples of VP2 were prepared by boiling for 90 min for later use. After reviving and subculturing Raw264.7 cells to a stable state, high-glucose DMEM medium without serum was added, and endotoxin samples were added to the cell supernatant at a ratio of 1:10 for serum-free starvation culture for 16 h. The cell supernatant was taken and centrifuged at 2500 rpm for 5 min at 4 °C to obtain cytokine samples. According to the instructions of the ELISA kit, the differences in the response of TNF-α after stimulating cells with different endotoxin samples were compared.

[0123] Example 3

[0124] 3.1 Changes in the growth status of wild-type and mutant strains

[0125] It can be seen from Figure 7 - 12 that compared with BL21(DE3), the DKO, TKO and their expression strains of FtlpxE and FnlpxE all showed a decrease in growth rate, and the OD600 at the growth plateau nm value was significantly decreased and basically could not reach OD600 nm = 1.00; The expression of FnlpxE in the TKO strain compared with the expression of FtlpxE significantly led to a decrease in the growth titer of TKO to less than OD600 nm = 0.8; For the stimulation of 10 mM CaCl2, the DKO, TKO and their expression strains of FtlpxE and FnlpxE all showed a significant decrease in the OD600 nm value at the growth plateau, even as low as less than 0.4, showing extremely sensitivity to calcium ion stimulation. However, after about 40 h of shaking culture, the TKO and its expression strains of FtlpxE and FnlpxE began to show "secondary growth".

[0126] 3.2 Changes in the drug sensitivity of strains to polymyxin B

[0127] The results of the changes in the drug sensitivity of strains to polymyxin B are shown in Table 4 specifically

[0128] Table 4

[0129] Stain Vector MIC (mg / L) BL21(DE3) - 0.07 SKO - 0.09 SKO pACYCduet-FtlpxE 0.86 SKO pACYCduet-FtlpxF 1.00 TKO - 0.24 TKO pACYCDuet-FtlpxE 2.76 TKO pACYCDuet-FtlpxF 6.17

[0130] 3.3 Lipid A Structural Changes in Strains

[0131] As Figure 13 - 21 shown, under the induction of 1 mM IPTG, the dephosphorylation rate of Lipid A was the highest when expressing FtlpxF, which was 23.2%, 33.7% and 3.06% higher than that of DKO / pACYCDuet-FtlpxE, DKO / pACYCDuet-FnlpxE and TKO / pACYCDuet-FtlpxE, respectively; when expressing FtlpxE under the induction of 1 mM IPTG, the dephosphorylation rate of Lipid A in TKO was 20.14% higher than that in DKO; when the strain DKO was induced to express FtlpxE and FnlpxE respectively under 1 mM IPTG, the dephosphorylation rate of Lipid A was 10.5% higher when expressing FtlpxE than when expressing FnlpxE; under 1 mM IPTG, when expressing the same phosphatase, the dephosphorylation rate was higher when using 1 mM IPTG than when using 1% IPTG; when not induced by IPTG, the dephosphorylation rate of Lipid A could be as low as 17.17%.

[0132] 3.4 Response Changes of Cytokines

[0133] The ELISA assay results of cytokines are shown in Table 5:

[0134] Table 5

[0135] Stain Vector TNF-α (mg / L) BL21(DE3) - <![CDATA[5.02×10 8 > SKO - <![CDATA[4.67×10 8 > SKO pACYCduet-FtlpxE <![CDATA[3.43×10 8 > SKO pACYCduet-FtlpxF <![CDATA[3.14×10 8 > DKO - <![CDATA[4.39×10 8 > TKO - <![CDATA[2.56×10 8 > TKO pACYCDuet-FtlpxE <![CDATA[2.81×10 7 > TKO pACYCDuet-FtlpxF <![CDATA[1.16×10 8 >

[0136] As can be seen from Table 5, the contents of TNF-α in SKO, DKO and TKO all showed a downward trend to varying degrees compared with the wild strain, and TKO had a more significant inhibitory effect on TNF-α compared with SKO and DKO;

[0137] At the same time, the TNF-α in SKO inserted with FtlpxE decreased by 1.24×10 8 ;

[0138] while the TNF-α in TKO inserted with FtlpxE decreased by about 2.27×10 8 , and when FtlpxE was inserted into TKO as an exogenous gene, the attenuation ability was more advantageous.

Claims

1. An endotoxin-attenuated Escherichia coli expression strain, characterized in that, It lacks at least one of WaaF, WaaC, and LpxM, and carries at least one of the exogenous genes lpxE and lpxF.

2. The endotoxin-attenuated Escherichia coli expression strain according to claim 1, wherein It lacks WaaF, WaaC, and LpxM, and carries at least one of the exogenous genes lpxE and lpxF.

3. The endotoxin-attenuated Escherichia coli expression strain according to claim 1, characterized in that, The lpxE is specifically FtlpxE or FnlpxE; The lpxF is specifically FtlpxF or FnlpxF.

4. The endotoxin-attenuated Escherichia coli expression strain according to claim 1, characterized in that, It lacks WaaF, WaaC, and LpxM, and carries the exogenous gene lpxE.

5. The endotoxin-attenuated Escherichia coli expression strain according to claim 1, characterized in that, It lacks WaaF, WaaC, and LpxM, and carries the exogenous gene FtlpxE.

6. A construction method for constructing the endotoxin-attenuated Escherichia coli expression strain described in any one of claims 1-5, characterized in that, It includes the following steps: Step 1: Using BL21 competent bacteria as the basic strain, knock out the genes of WaaF, WaaC, and / or LpxM of the BL21 competent bacteria to obtain a gene deletion strain lacking the genes of WaaF, WaaC, and / or LpxM; Step 2: Insert the exogenous genes lpxE and / or lpxF into the gene deletion strain prepared in Step 1; obtain a gene deletion strain capable of expressing lpxE and / or lpxF.

7. The method for constructing an endotoxin-attenuated Escherichia coli expression strain according to claim 6, characterized in that, The specific steps of Step 1 include the following sub-steps: Step A1: Using BL21 competent bacteria as the basic strain, heat shock transform the pKD46 plasmid to obtain BL21 / pKD46 electrocompetent bacteria; Step A2: Use the gene knockout cassette of WaaFC and the gene knockout cassette of lpxM to knock out the genes of WaaF, WaaC, and lpxM of the BL21 / pKD46 electrocompetent bacteria respectively, to obtain a gene deletion strain lacking the genes of WaaF, WaaC, and LpxM.

8. The construction method of the endotoxin-attenuated Escherichia coli expression strain according to claim 7, characterized in that, The preparation method of the gene knockout cassette of WaaFC is: Using pKD4 as the DNA template, add it to the PCR reaction system designed for the WaaF and WaaC genes, amplify to obtain a nucleic acid fragment with FRT flanks and a kanamycin resistance gene. After the amplified PCR product is identified by nucleic acid gel electrophoresis, use the HiPure Gel Pure DNA Mini Kit to recover the PCR product to obtain the gene knockout cassette of WaaFC; The preparation method of the gene knockout cassette of lpxM is: Using pKD4 as the DNA template, add it to the PCR reaction system designed for the lpxM gene, amplify to obtain a nucleic acid fragment with FRT flanks and a kanamycin resistance gene. After the amplified PCR product is identified by nucleic acid gel electrophoresis, use the HiPure Gel Pure DNA Mini Kit to recover the PCR product to obtain the gene knockout cassette of lpxM.

9. The construction method of the endotoxin-attenuated Escherichia coli expression strain according to claim 6, characterized in that, The specific Step 2 is: Prepare the gene deletion strain obtained in Step 1 into an electrocompetent gene deletion strain, and then introduce the plasmid carrying the exogenous genes lpxE and / or lpxF into the electrocompetent gene deletion strain to obtain a gene deletion strain capable of expressing lpxE and / or lpxF.

10. Use of the endotoxin-attenuated Escherichia coli expression strain as described in any one of claims 1-5 for expressing a low-endotoxin type protein.

Images