Application of cotinus coggygria gene ccdt1 in improving plant drought resistance

Abstract

The application discloses application of a Cotinus coggygria gene CcDT1 to improving drought resistance of plants and belongs to the field of genetic engineering. The CcDT1 gene from the Cotinus coggygria is used to construct an overexpression vector, the expression vector containing the gene is obtained by genetic transformation, and the overexpression Arabidopsis thaliana plant is obtained, and the overexpression plant is subjected to drought stress treatment. The experimental results show that, after being treated for 2 weeks under the drought condition, the overexpression plant has higher drought resistance than the wild type plant, the total chlorophyll content is higher, and the ion permeation rate and the water loss rate are lower, indicating that the overexpression of the Cotinus coggygria gene CcDT1 can significantly improve the drought resistance of the plant. The gene can provide an important theoretical basis for breeding drought-resistant forest trees and has important scientific significance in strengthening the diversity of forest tree species.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and relates to the application of the smoke tree gene CcDT1 in improving the drought resistance of plants. Background Technology

[0002] As sessile organisms in nature, plants face various abiotic stresses during their growth, such as drought, salinity, extreme temperatures, and flooding. These stresses severely impact plants at multiple levels, including molecular, cellular, and physiological / biochemical. To better withstand environmental pressures, plants have developed a series of regulatory and adaptive mechanisms over long-term evolution to respond to and adapt to stressful environments. With the increasing frequency of extreme weather events such as high temperatures and reduced rainfall, drought stress is intensifying, significantly limiting forest growth and threatening the ecological and economic value of forests. Therefore, studying the response pathways and adaptation mechanisms of forest trees to abiotic stresses is of significant scientific importance for enhancing forest species diversity.

[0003] Plants can sense stress signals through multiple pathways, thereby inducing and activating protective mechanisms. Post-translational modifications of proteins are a widely present and important regulatory pathway in eukaryotes, crucial for maintaining normal growth and development. Studies have found that post-translational modifications of various transcription factors can regulate the expression of corresponding functional genes, thereby modulating plant tolerance to stress environments.

[0004] Drought is one of the major abiotic stresses that limit the growth of trees. Under drought stress, leaf stomata close, carbon dioxide absorption decreases, and photosynthesis is inhibited. In addition, drought leads to a decrease in soil moisture content, making it difficult for tree roots to absorb water from the soil, affecting the growth and development of their above-ground parts, and in severe cases, it can lead to the death of trees. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide an application of the smoke tree gene CcDT1 in improving the drought resistance of plants.

[0006] The technical solution of the present invention is: the application of the gene encoding the amino acid sequence shown in SEQ ID No.2 in improving the drought resistance of plants.

[0007] Furthermore, the application method involves overexpressing the aforementioned genes in forest trees to improve the drought resistance of the plants.

[0008] Furthermore, the nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0009] Furthermore, the plant is either smoke tree or Arabidopsis thaliana.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] This invention first cloned the CcDT1 gene from the Smoke Tree genome and constructed the expression vector 35S::CcDT1-EGFP. Genetic transformation technology was used to obtain Arabidopsis thaliana overexpressing the 35S::CcDT1-EGFP gene. Wild-type plants and the overexpressing lines were subjected to drought treatment, and their ion permeability, water loss rate, and total chlorophyll content were measured. The results showed that the overexpressing plants exhibited higher drought tolerance than the wild-type plants, with higher total chlorophyll content and lower ion permeability and water loss rate. These findings indicate that overexpression of the CcDT1 gene can significantly improve the drought tolerance of plants. Attached Figure Description

[0012] Figure 1 Electrophoresis image of the CDS fragment of gene CcDT1.

[0013] Figure 2 Expression level of CcDT1 after drought treatment.

[0014] Figure 3 Identification and expression level detection of 35S::CcDT1-EGFP overexpression lines in Arabidopsis thaliana.

[0015] Figure 4 Phenotypic observation of Arabidopsis thaliana plants overexpressing 35S::CcDT1-EGFP under drought stress.

[0016] Figure 5 Ion permeability of Arabidopsis thaliana plants overexpressing 35S::CcDT1-EGFP under drought stress.

[0017] Figure 6 Water loss rate of Arabidopsis thaliana plants overexpressing 35S::CcDT1-EGFP under drought stress.

[0018] Figure 7 Total chlorophyll content in Arabidopsis thaliana plants overexpressing 35S::CcDT1-EGFP under drought stress. Detailed Implementation

[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from commercial sources.

[0020] 1. Gene cloning

[0021] CcDT1 amplification primers were designed, and the CDS sequence was amplified from *Cotinus coggygria* cDNA using the designed primers. This CDS sequence was then ligated into an EGFP expression vector. Sequencing results showed that the full-length coding region of the gene was 543 bp (SEQ ID No. 1, the amino acid sequence of the encoded protein is shown in SEQ ID No. 2). Domain prediction of CcDT1 was performed using the NCBI website, revealing that it contains PSPG and UDPGT domains. Table 2 shows the primer sequences designed for amplification.

[0022] Table 1 shows the CDS amplification system (total 50 μL).

[0023]

[0024] Table 2. CDS primer sequences for amplifying gene CcDT1.

[0025] CcDT1 CDS-F CGACGCGTATGGCAAGTTGGGGAATA CcDT1 CDS-R GCGTCGACTTCAACAAGCAATCGAGC

[0026] Experimental results:

[0027] The amplified product was detected as a 543bp fragment by 1.0% agarose gel electrophoresis. Figure 1 As shown, the amplified fragment was ligated into an expression vector containing the EGFP reporter gene via enzyme digestion, and the positive plasmid was extracted and sequenced. The sequencing results were consistent with the nucleotide sequence shown in SEQ ID No. 1, indicating that the 35S::CcDT1-EGFP expression vector was successfully constructed.

[0028] 2. Overexpression in Arabidopsis thaliana plants

[0029] The successfully constructed expression vector containing 35S::CcDT1-EGFP was transformed into Agrobacterium and then into wild-type Arabidopsis thaliana material via inflorescence immersion. Overexpressing Arabidopsis plants were obtained through selection medium, and resistant seedlings were selected and transplanted into soil for further cultivation and subculturing to obtain homozygous lines. Further identification of transgenic plants was then performed. Figure 2 ).

[0030] 3. Drought Treatment

[0031] Three-week-old Arabidopsis thaliana plants with good growth were completely removed from the soil. The soil around the roots was washed off with ddH2O, and residual moisture was removed with absorbent paper. They were then placed in dry, clean culture bottles for drought treatment. Samples were collected at 0 h and 3 h, and RNA was extracted and reverse-transcribed into cDNA for qRT-PCR to detect changes in CcDT1 gene expression at different treatment time points. Figure 3 ).

[0032] Wild-type and 35S::CcDT1-EGFP overexpressing Arabidopsis thaliana lines from the same period were transplanted into soil and cultured normally for two weeks before being subjected to drought treatment. Phenotypic observations were conducted during this period, and ion permeability, water loss rate, and total chlorophyll content were measured. Results showed that after two weeks of drought treatment, wild-type leaves curled and wilted, with leaf edges drying and turning yellow; the overexpressing lines had more flat leaves, with most leaves remaining green and healthy, exhibiting a stronger drought-tolerant phenotype. Figure 4 Furthermore, the results of the detection of relative ion permeability, water loss rate, and total chlorophyll content of each strain also showed that the relative ion permeability and water loss rate of the overexpression strains after drought treatment were lower than those of wild-type Arabidopsis thaliana. Figure 5 , Figure 6 The total chlorophyll content is higher than that of wild-type Arabidopsis thaliana. Figure 7 These results all indicate that CcDT1 is an important positive regulator that can enhance the plant's tolerance to drought stress.

Claims

1. The application of a gene encoding the amino acid sequence shown in SEQ ID No. 2 in improving the drought resistance of plants, wherein the application method is: overexpressing the gene in a plant, thereby improving the drought resistance of the plant, wherein the plant is Arabidopsis thaliana.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID No. 1.

Images