BCMA-targeted single-domain antibody as well as related material and application thereof

Abstract

The invention discloses a single-domain antibody targeting BCMA as well as a related material and application thereof, and belongs to the technical field of biological medicines. The technical problem to be solved by the invention is how to realize sensitive and efficient detection and / or precise targeted therapy of BCMA. In order to solve the technical problem, the invention provides a single-domain antibody of which the amino acid sequences of CDR1, CDR2 and CDR3 are respectively shown as 28th to 35th, 49th to 60th and 97th to 112th sites of SEQ ID NO: 1. The single-domain antibody has high affinity to BCMA protein, and can specifically recognize and target BCMA positive cells. By combining with radionuclide, an anti-cancer preparation or a contrast agent, the single-domain antibody can be further developed into a targeted imaging agent, an immunotherapy drug or a single-domain antibody coupling drug for multiple myeloma, and a new strategy and thought are provided for early diagnosis, immune monitoring and targeted therapy of tumors.

Description

Technical Field

[0001] The present invention belongs to the field of pharmaceutical technology, and particularly relates to a single-domain antibody targeting BCMA, and related materials and applications thereof. Background Art

[0002] Multiple myeloma (MM) is a clonal plasma cell dysplastic malignant tumor, which mostly occurs in middle-aged and elderly people and is the second most common malignant tumor in the hematological system. It is still incurable at present. In normal human tissues, BCMA protein and mRNA are almost only present on plasma cells, and are selectively overexpressed during the malignant transformation of plasma cells, mainly promoting tumor cell growth, survival and drug resistance by activating intracellular signal transduction cascades of NFκB, AKT, phosphoinositide 3-kinase (PI3K), STAT3 and MAPK. This consistent elevation and almost exclusive limitation of BCMA on the surface of MM cells in cell lines and patient samples make BCMA a popular target for MM drug discovery and development. At present, the development of BCMA target drug indications is still mainly for MM, and the approved indications by drugs include multiple myeloma, AL amyloidosis, and hematological tumors. Among them, those still in the R & D stage include cancer, non-Hodgkin lymphoma, B-cell lymphoma, solid tumor, diffuse large B-cell lymphoma, autoimmune disease, end-stage renal disease, leukemia, etc.

[0003] BCMA is short for B-cell maturation antigen, also known as TNFRSF17 or CD269 (UniProt Q02223), and is encoded by the 2.92 kb TNFRSF17 gene located on the short arm of chromosome 16 (16p13.13), including 3 exons and 2 introns. BCMA protein is a type III transmembrane glycoprotein consisting of 184 amino acids, with a molecular weight of 20.2 kDa, and belongs to the tumor necrosis factor (TNF) receptor superfamily. The BCMA protein structure includes an N-terminal extracellular domain (ECD), a transmembrane domain (TM) and an intracellular domain (ICD). There is no signal sequence at the extracellular N-terminus, and it contains a conserved motif of 6 cysteines. ECD consists of 54 amino acids, TM contains 23 amino acid residues, and ICD contains 107 amino acids. BCMA is mainly expressed on the surface of late B cells, short-lived proliferating plasmablasts and long-lived plasma cells, and to a certain extent exists on memory B cells, but is not expressed in naive B cells, CD34-positive hematopoietic stem cells and other normal tissue cells. It is highly expressed in malignantly proliferating B lymphocytes (such as myeloma cells and leukemia cells). At the same time, it plays a key role in cell survival, proliferation, metastasis and drug resistance by mediating downstream signal pathways, and these characteristics make it a target for immunotherapy, especially for the treatment of multiple myeloma.

[0004] Traditional antibodies such as monoclonal (mAb) and polyclonal (pAb) antibodies have been at the forefront of biomedical research for diagnostic and analytical therapies against cancer, immune diseases, and infectious diseases. Although traditional antibodies are the basis of very successful research, diagnostic, and therapeutic tools, they also have their drawbacks, such as stability within a narrow pH and temperature range and may not be able to access specific active sites on proteins. In recent years, single-domain antibodies (Nanobodies, Nbs) have emerged as a new type of biomolecule with great potential in cancer research, drug development, and treatment due to their unique advantages. Nanobodies are single-chain antibody fragments derived from camel heavy-chain antibodies and consist of 4 conserved sequence segments (FR1, FR2, FR3, FR4) and 3 highly variable complementarity-determining regions (CDR1, CDR2, and CDR3). Nanobodies lack the light chain and are approximately 1 / 10 the size of traditional antibodies, but they possess full-functional antigen-binding capabilities. Compared with traditional antibodies, the CDR3 loop of single-domain antibodies is longer, which enables it to interact more with antigens and increase potential targets. The small size of single-domain antibodies allows them to rapidly diffuse and penetrate into tumor tissues, better exerting their functions. At the same time, single-domain antibodies also have characteristics such as strong specificity, high affinity, high stability, and low immunogenicity, and can be highly expressed in production systems such as Escherichia coli and Saccharomyces cerevisiae, reducing production costs. In addition, single-domain antibodies can also be modified to extend their half-life and improve their therapeutic efficacy.

[0005] In recent therapeutic advances, treatment modalities targeting BCMA such as CAR-T cell therapy, bispecific antibodies (BsAbs), and antibody-drug conjugates (ADCs) have demonstrated good therapeutic potential. These new therapies have shown good efficacy in patients with relapsed and refractory MM, but they are also accompanied by certain toxic reactions, including cytokine release syndrome and off-target effects. In addition, some patients have not benefited significantly, suggesting that we need to develop more effective monitoring methods to non-invasively evaluate BCMA expression and treatment response.

[0006] Nuclear medicine techniques can detect the in-vivo distribution of target molecules in the body by radiolabeling specific molecular probes and using single-photon computed tomography (SPECT) or positron emission tomography (PET / CT). The commonly used imaging agent 18 18F-FDG is widely used in the diagnosis, staging, and efficacy monitoring of malignant tumors. However, there are certain limitations in detecting MM because the expression of glucose transporter (GLUT1) and hexokinase-2 (HK-2) in MM cells is relatively low, resulting in 18F-FDG is difficult to detect some intramedullary lesions. In contrast, immuno-PET can combine the high specific binding ability of antibodies with the high sensitivity and quantitative analysis advantages of PET imaging, and can show the expression and distribution of targets at the in vivo level. This detection method has great potential for the detection of specific targets in multiple myeloma.

[0007] Different types of antibody-drug fragments have their own advantages in tumor targeted diagnosis and treatment. Radio-labeled whole antibodies, due to their large molecular weight, usually need to be combined with radionuclides with longer half-lives, resulting in slow pharmacokinetics, slow blood clearance, and higher background signals. However, they can achieve targeted internal radiotherapy by specifically binding to tumor cells. In contrast, peptide-conjugated drugs (PDCs) are advantageous for their small molecular weight, excellent tumor penetrability, and low immunogenicity, and are suitable for conjugation with diagnostic radionuclides with shorter half-lives (such as 18 F, 68 Ga), and have good clinical translation potential. Single-domain antibodies (Nbs), as the smallest antibody fragments in structure, have high antigen affinity, tissue permeability, and faster clearance rates, and are commonly used in molecular imaging and therapeutic delivery. Antibody fragments, by retaining the targeting properties of intact antibodies, have better tumor permeability, faster blood clearance, and higher signal-to-noise ratios, and are preferred candidates for immuno-PET imaging agents.

[0008] Currently, significant progress has been made in the research and development of BCMA-targeted probes. For example, the nuclear medicine team of the First Affiliated Hospital of Jinan University recently developed a monoclonal antibody BCMAh230430 targeting BCMA, which, after being labeled with 89 Zr and 177 Lu respectively, demonstrated its effectiveness in non-invasive monitoring of BCMA expression status and radioimmunotherapy in subcutaneous tumors of multiple myeloma (MM). Wei et al. designed two single-domain antibodies targeting BCMA for the detection of primary multiple myeloma models. PET imaging analysis showed that the diagnostic effects of these two tracers were comparable in disseminated MM models and could effectively detect disseminated MM lesions. Meanwhile, the 68The Ga-labeled BCMA-targeting polypeptide BP1 demonstrated excellent tumor targeting and in vivo stability in preclinical studies, mainly accumulating in the kidneys, bladder, and BCMA-positive H929 tumors. The imaging results showed that the binding of this polypeptide to the BCMA protein was highly specific. Metabolic studies also indicated that it was mainly metabolized through the kidneys, with low background uptake and good imaging effects (Literature source: Song L, Jiang S, Yang Q, Huang W, Qiu Y, Chen Z, Sun X,Wang T, Wu S, Chen Y, Zeng H, Wang Z, Kang L. Development of a Novel Peptide-Based PET Tracer 68 Ga]Ga-DOTA-BP1 for BCMA Detection in Multiple Myeloma. JMed Chem. 2024 Sep 12;67(17):15118-15130. doi: 10.1021 / acs.jmedchem.4c00759.Epub 2024 Aug 21. PMID: 39167092.).

[0009] Therefore, the development of BCMA-targeting single-domain antibodies can be used in the research of BCMA bispecific antibody drugs or BCMA CAR-T cell therapies, and at the same time, for radionuclide labeling, as a reagent drug for clinical detection, it has extremely broad application prospects and research value. Summary of the Invention

[0010] The technical problem to be solved by the present invention is: how to achieve sensitive and efficient detection and / or precise targeted therapy of BCMA. To solve this technical problem, the present invention provides the following technical solutions.

[0011] The present invention provides a single-domain antibody, which includes 3 complementary determining regions named CDR1, CDR2, and CDR3 respectively; the amino acid sequences of CDR1, CDR2, and CDR3 include positions 28 to 35, positions 49 to 60, and positions 97 to 112 of SEQ ID NO:1 respectively.

[0012] In the present invention, the single-domain antibody can be a single-domain antibody that binds to BCMA.

[0013] In the present invention, the binding can be specific binding.

[0014] In some specific embodiments of the present invention, the amino acid sequences of CDR1, CDR2, and CDR3 of the single-domain antibody are respectively positions 28 to 35, positions 49 to 60, and positions 97 to 112 of SEQ ID NO:1.

[0015] The single-domain antibody may further include four framework regions named FR1, FR2, FR3, and FR4. The FR1 may include the amino acid sequence shown in at least one of (A11) or (A12): (A11) positions 1 to 27 of SEQ ID NO:1, (A12) an amino acid sequence having more than 70% identity with (A11); The FR2 may include the amino acid sequence shown in at least one of (A21) or (A22): (A21) positions 36 to 48 of SEQ ID NO:1, (A22) an amino acid sequence having more than 70% identity with (A21); The FR3 may include the amino acid sequence shown in at least one of (A31) or (A32): (A31) positions 61 to 96 of SEQ ID NO:1, (A32) an amino acid sequence having more than 70% identity with (A31); The FR4 may include the amino acid sequence shown in at least one of (A41) or (A42): (A41) positions 113 to 123 of SEQ ID NO:1, (A42) an amino acid sequence having more than 70% identity with (A41).

[0016] In the present invention, the single-domain antibody is composed of three CDRs and "framework regions" separated by the three CDRs. The framework regions are used to align the CDRs that specifically bind to the antigen epitope. CDRs include the amino acid residues in the antibody that are mainly responsible for antigen binding. The single-domain antibody includes the following framework regions (FR) and CDR regions from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.

[0017] In a specific embodiment of the present invention, the amino acid sequences of FR1, FR2, FR3, and FR4 of the single-domain antibody may be positions 1 to 27, positions 36 to 48, positions 61 to 96, and positions 113 to 123 of SEQ ID NO:1, respectively.

[0018] In the present invention, the amino acid sequence of the single-domain antibody may include SEQ ID NO: 1 or have at least 70% identity with SEQ ID NO: 1.

[0019] In the present invention, the amino acid sequence of the single-domain antibody may be SEQ ID NO: 1.

[0020] In the present invention, the amino acid sequence of the single-domain antibody may also have at least 70% identity with SEQ ID NO: 1.

[0021] As used herein, the "identity of more than 70%" or "identity of at least 70%" may specifically be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.

[0022] The present invention also provides an immunoconjugate, which comprises (I) and (II): (I) An antibody, which comprises the above-mentioned single-domain antibody; (II) A conjugate part: The conjugate part may be selected from detectable markers, drugs, toxins, nucleic acids, therapeutic isotopes or combinations thereof.

[0023] In a specific embodiment of the present invention, the antibody in the immunoconjugate is the above-mentioned single-domain antibody.

[0024] In the present invention, the detectable markers include (but are not limited to): radionuclides, fluorescein, enzymes, and colloidal gold.

[0025] The present invention also provides a probe molecule, which contains the above-mentioned single-domain antibody.

[0026] In the present invention, the probe molecule may be a radioactive probe.

[0027] In the present invention, the radioactive probe may include the single-domain antibody and a radionuclide conjugated to the single-domain antibody.

[0028] In the present invention, the radionuclides include but are not limited to the following (i) or / and (ii): (i) Diagnostic isotopes, which are selected from the group consisting of: Ga-68 (i.e., 68 Ga), F-18, I-123, Ga-67, Cu-64, Zr-89, C-11, Re-188, or combinations thereof; and / or (ii) Therapeutic isotopes, said therapeutic isotopes being selected from the following group: I-131, I-124, I-125, Lu-177, Tc-99m, In-111, Y-90, Ac-225, As-211, Bi-212, Bi-213, Cs-137, Cr-51, Co-60, Dy-165, Er-169, Fm-255, Au-198, Ho-166, Ir-192, Fe-59, Pb-212, Mo-99, Pd-103, P-32, K-42, Re-186, Re-188, Sm-153, Ra223, Ru-106, Na24, Sr89, Tb-149, Th-227, Xe-133, Yb-169, Yb-177 or a combination thereof.

[0029] In the present invention, the radionuclide is selected from: Ga-68, F-18, I-131.

[0030] In some embodiments of the present invention, the radionuclide is Ga-68.

[0031] In the present invention, "Ga-68" has the same meaning as " 68 Ga".

[0032] In some embodiments of the present invention, the probe is 68 a Ga-NOTA-PFBC01 single-domain antibody-labeled probe.

[0033] The present invention also provides a reagent or a kit, which comprises the above-mentioned single-domain antibody, immunoconjugate or / and probe molecule.

[0034] In the present invention, the reagent or the kit may have at least one of the following uses: (B1) Identifying or assisting in identifying BCMA protein; (B2) Binding or assisting in binding to BCMA protein; (B3) Detecting or assisting in detecting whether the test sample contains BCMA protein; (B4) Detecting or assisting in detecting the content of BCMA protein in the test sample; (B5) Identifying or assisting in identifying BCMA protein-positive diseases; (B6) Targeting BCMA protein; (B7) Diagnosing diseases related to BCMA protein.

[0035] In the present invention, the reagent or the kit may further comprise a pharmaceutically acceptable carrier.

[0036] In the present invention, the pharmaceutically acceptable carrier may be a non-toxic, inert aqueous carrier medium.

[0037] In the present invention, the detectionally acceptable carrier is one or more reagents selected from the following group: isotope tracers, contrast agents, flow cytometry detection reagents, cellular immunofluorescence detection reagents, nanomagnetic particles, and imaging agents.

[0038] In some specific embodiments of the present invention, the detection reagent may be a contrast agent. Further, the contrast agent may also include other preparations for contrast imaging.

[0039] In some specific embodiments of the present invention, the contrast agent is a contrast agent for MRI (magnetic resonance imaging) or CT (computed tomography).

[0040] In some specific embodiments of the present invention, the imaging agent chelates two or more signals simultaneously, such as Ga-68 and Gd, and is used for both PET / CT and MRI; or Tc-99m and a fluorescent agent, and is used for both SPECT / CT and fluorescence detection.

[0041] In some specific embodiments of the present invention, the detection reagent can be used for in vivo detection.

[0042] In some specific embodiments of the present invention, the dosage form of the detection reagent is liquid or powder (such as aqueous solution, injection, lyophilized powder, tablet, buccal tablet, aerosol).

[0043] The present invention also provides a polypeptide comprising the above-mentioned single-domain antibody.

[0044] In the present invention, the polypeptide may be a BCMA antibody or an antigen-binding fragment thereof.

[0045] In some specific embodiments of the present invention, the BCMA antibody or an antigen-binding fragment thereof includes, but is not limited to: recombinant single-domain antibody, bivalent single-domain antibody, multivalent single-domain antibody, multispecific single-domain antibody, single-chain antibody, Fab, Fab' fragment, F(ab')2 fragment, minimal recognition unit (MRU), Fv antibody, single-chain antibody, or heavy-chain antibody.

[0046] In some specific embodiments of the present invention, the polypeptide is a recombinant single-domain antibody with a 6×His tag. The amino acid sequence of the recombinant single-domain antibody is SEQ ID NO:3. In SEQ ID NO:3, positions 2 to 124 are the same as SEQ ID NO:1.

[0047] The present invention also provides a pharmaceutical composition, which may include the above-mentioned single-domain antibody, the immunoconjugate, the probe molecule, and / or the polypeptide.

[0048] In the present invention, the pharmaceutical composition may further include a pharmaceutically acceptable carrier.

[0049] In the present invention, the pharmaceutical composition further contains other drugs for treating tumors.

[0050] The present invention also provides the use of the above-mentioned single-domain antibody, the immunoconjugate, the probe molecule or the polypeptide in at least one of the following (C1) to (C7). (C1) Preparing a detection reagent, a detection kit, a detection plate or a developer for recognizing or assisting in recognizing BCMA protein; (C2) Preparing a detection reagent, a detection kit, a detection plate or a developer for binding or assisting in binding BCMA protein; (C3) Preparing a detection reagent, a detection kit, a detection plate or a developer for detecting or assisting in detecting the BCMA expression level in cells; (C4) Preparing a detection reagent, a detection kit, a detection plate or a developer for diagnosing or assisting in diagnosing BCMA-positive diseases; (C5) Preparing a detection reagent, a detection kit, a detection plate or a developer for diagnosing or assisting in diagnosing the stage of BCMA-positive diseases; (C6) Preparing a detection reagent, a detection kit, a detection plate or a developer for monitoring or assisting in monitoring the therapeutic effect of BCMA-positive diseases; (C7) Preparing a pharmaceutical composition for treating or / and preventing BCMA-positive diseases.

[0051] The present invention also provides the use of the above-mentioned single-domain antibody, immunoconjugate, probe molecule, reagent or kit, polypeptide or / and pharmaceutical composition in any one of the following. (D1) Recognizing or assisting in recognizing BCMA protein; (D2) Binding or assisting in binding BCMA protein; (D3) Detecting or assisting in detecting the BCMA expression level in cells; (D4) Diagnosing or assisting in diagnosing BCMA-positive diseases; (D5) Diagnosing or assisting in diagnosing the stage of BCMA-positive diseases; (D6) Monitoring or assisting in monitoring the therapeutic effect of BCMA-positive diseases; (D7) Treating or / and preventing BCMA-positive diseases.

[0052] The use of substance X or a composition comprising substance X as a developer preparation also belongs to the scope of protection of the present invention, and the substance X can be the single-domain antibody or / and the polypeptide.

[0053] The present invention also provides the use of the above-mentioned single-domain antibody or polypeptide as a reagent for binding BCMA protein.

[0054] The present invention also provides the use of the above-mentioned single-domain antibody or polypeptide as a developer preparation.

[0055] The present invention also provides a method for detecting BCMA protein, which comprises the step of detecting BCMA protein by using the above-mentioned single-domain antibody, immunoconjugate, probe molecule, reagent or kit.

[0056] The present invention also provides a method for diagnosing BCMA-positive diseases, which includes the step of administering an effective dose of the above-mentioned immunoconjugate or probe molecule to a subject for diagnosing BCMA-positive diseases.

[0057] The present invention also provides a method for staging or assisting in staging BCMA-positive diseases, which includes the step of administering an effective dose of the above-mentioned immunoconjugate or probe molecule to a subject for staging or assisting in staging BCMA-positive diseases.

[0058] The use of substance X or a composition comprising substance X as a drug also falls within the scope of protection of the present invention. The substance X may be the single-domain antibody or the polypeptide.

[0059] In certain specific embodiments of the present invention, the drug may be a drug for treating BCMA-positive diseases or a drug for diagnosing BCMA-positive diseases.

[0060] The present invention also provides the use of the above-mentioned single-domain antibody, polypeptide, drug or pharmaceutical composition for preventing and / or treating BCMA-positive diseases.

[0061] The present invention also provides a method for treating and / or preventing BCMA-positive diseases, which comprises the step of administering an effective dose of the above-mentioned single-domain antibody, polypeptide, drug or pharmaceutical composition to a subject for treating and / or preventing BCMA-positive diseases.

[0062] In the present invention, the subject shows BCMA positivity.

[0063] The drug or pharmaceutical composition may further comprise an agent capable of killing tumor cells.

[0064] In the present invention, the agent capable of killing tumor cells is at least one of a chemical drug, a biological drug, a nano-drug, a radioactive drug, a photothermal therapy drug or a photodynamic therapy drug capable of killing tumor cells; or, is at least one of an alkylating agent, an antimetabolic drug, an antitumor natural drug, an antitumor antibiotic, a hormone, a metal complex or a tumor radio-targeting marker.

[0065] In the present invention, the application, use or method may be for the purpose of diagnosing and treating diseases.

[0066] In the present invention, the application, use or method may also not be for the purpose of diagnosing and treating diseases, and its direct purpose is only to obtain intermediate results.

[0067] The present invention also provides biological materials, and the biological materials can be any one of the following: (E1) A nucleic acid molecule encoding the above-mentioned single-domain antibody, (E2) An expression cassette containing the nucleic acid molecule described in (E1), (E3) A recombinant vector containing the nucleic acid molecule described in (E1) or / and the expression cassette described in (E2), (E4) A recombinant cell containing the nucleic acid molecule described in (E1), the expression cassette described in (E2) or / and the recombinant vector described in (E3), (E5) A recombinant microorganism containing the nucleic acid molecule described in (E1), the expression cassette described in (E2) or / and the recombinant vector described in (E3).

[0068] Among the above biological materials, the nucleic acid molecule described in (E1) can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.

[0069] In the present invention, the nucleic acid described in (E1) can be the DNA molecule described in the following (F1) or (F2) or the RNA transcribed from the DNA molecule: (F1) A DNA molecule with the nucleotide sequence of the coding strand shown in SEQ ID NO: 2; (F2) A DNA molecule having more than 70% identity with (F1) and encoding the above-mentioned single-domain antibody.

[0070] In the present invention, the expression cassette described in (E2) refers to DNA that can express the single-domain antibody in a host cell, and this DNA can not only include a promoter that initiates the transcription of the single-domain antibody-encoding gene, but also include a terminator that terminates the transcription of the single-domain antibody-encoding gene.

[0071] In the present invention, the vector can be a plasmid, cosmid, phage or viral vector.

[0072] In some embodiments of the present invention, the recombinant vector can be a recombinant vector obtained by introducing the nucleic acid molecule described in (E1) into pET21b(+). Specifically, the structure of the recombinant vector can be that the fragment between the recognition sites of restriction endonucleases NdeI and XhoI of pET21b(+) (the small fragment between the NdeI and XhoI recognition sites) is replaced with a DNA molecule with the nucleotide sequence shown in SEQ IDNO: 2, and the other nucleotide sequences of pET21b(+) are kept unchanged.

[0073] In the present invention, the microorganism can be bacteria (such as Escherichia coli), yeast, algae or fungi.

[0074] In the present invention, the bacteria can be Escherichia coli.

[0075] Among the above-mentioned biological materials, the cell described in (E4) can be a prokaryotic cell or a eukaryotic cell.

[0076] Among the above-mentioned biological materials, the cell can be a cell derived from an animal, a plant or a microorganism.

[0077] In some specific embodiments of the present invention, the cell derived from an animal can be an ex vivo animal cell. In a specific embodiment of the present invention, the ex vivo animal cells include but are not limited to: ExpiCHO-S™ cells, Chinese hamster ovary cells (CHO), 293F cells, 293E cells, 293-6E cells, etc.

[0078] In some embodiments of the present invention, the recombinant cell is a recombinant Escherichia coli cell.

[0079] The present invention also provides a method for preparing the above-mentioned single-domain antibody, which may include the step of expressing the coding gene of the above-mentioned single-domain antibody in a cell to obtain the single-domain antibody.

[0080] In the above method, the cell can be an ex vivo cell or a non-human animal body cell.

[0081] In some embodiments of the present invention, the cell is a recombinant Escherichia coli cell.

[0082] The single-domain antibody provided by the present invention has high affinity and can be used to detect the expression level of BCMA, diagnose BCMA-related tumors, predict its therapeutic effect and perform targeted therapy. In particular, the BCMA-specific molecular imaging probe prepared from the single-domain antibody significantly improves the affinity, reduces the non-specific uptake of normal tissues, and improves the imaging quality, thus realizing non-invasive, accurate and efficient detection of the expression of human BCMA, and is applicable to the diagnosis and efficacy prediction of BCMA-related tumors. After being conjugated with an appropriate radionuclide, the probe can also be used for the precise treatment of BCMA-related tumors.

[0083] Compared with the prior art, the present invention has the following advantages: (1) The single-domain antibody of the present invention is the first specific single-domain antibody against BCMA, with high selectivity, small molecular weight (about 15 kDa), high biosafety, low immunogenicity, strong tumor permeability and excellent pharmacokinetic properties. The single-domain antibody is easy to design and modify, suitable as a multifunctional targeting material, and has broad application prospects.

[0084] (2) The single-domain antibody of the present invention can be combined with imaging agents for clinical transformation, used as a molecular probe to detect the expression of BCMA in tumor cells in real time, monitor the efficacy of immunotherapy, and can be used for the prediction and companion diagnosis of BCMA immunotherapy. In addition, as a homing peptide, it can be combined with anticancer drugs to form a single-domain antibody-conjugated drug, which can be used for the targeted and combined treatment of various tumors. Description of the Drawings

[0085] Figure 1 It is the electrophoresis diagram of the amplification of the common heavy chain of the antibody and the VHH gene of the heavy chain antibody in the first-round PCR.

[0086] Figure 2 It is the SDS-PAGE electrophoresis diagram of the purification of the recombinant single-domain antibody PFBC01 by the magnetic bead method.

[0087] Figure 3 It is the binding activity curve diagram of the recombinant single-domain antibody PFBC01 in the present invention.

[0088] Figure 4 It is the comparison of the affinity of the recombinant single-domain antibody PFBC01 and other control single-domain antibodies for H929 cells by flow cytometry; PE represents the control cells with only PE-NHS added and no antibody incubated, and CK represents the control cells without any antibody incubated.

[0089] Figure 5 It is the BLI result of the recombinant single-domain antibody PFBC01 in the present invention.

[0090] Figure 6 It is for the probe 68 The stability of 68Ga-NOTA-PFBC01 in PBS and FBS solutions for 1 to 2 hours; where a is 68 The radiochemical purity of the 68Ga-NOTA-PFBC01 single-domain antibody-labeled probe in FBS solution for 1 hour, b is 68 The radiochemical purity of the 68Ga-NOTA-PFBC01 single-domain antibody-labeled probe in FBS solution for 2 hours, c is 68 The radiochemical purity of the 68Ga-NOTA-PFBC01 single-domain antibody-labeled probe in PBS solution for 1 hour, d is 68 The radiochemical purity of the 68Ga-NOTA-PFBC01 single-domain antibody-labeled probe in PBS solution for 2 hours.

[0091] Figure 7 It is the maximum intensity projection (MIP) map of the PET / CT of the H929 tumor-bearing mice 1 to 2 hours after injection of the single-domain antibody probe 68 68Ga-NOTA-PFBC01 of the present invention.

[0092] Figure 8For the ROI uptake values and tumor-to-nontumor ratios of H929 tumor-bearing mice 1 to 2 hours after injection of the single-domain antibody probe of the present invention 68 Ga-NOTA-PFBC01; where a is the ROI uptake value and b is the tumor-to-nontumor ratio.

[0093] Figure 9 For the ROI uptake values and tumor-to-nontumor ratios of H929 tumor-bearing mice 1 to 2 hours after injection of the single-domain antibody probe of the present invention 68 PET / CT maximum intensity projection (MIP) images and ROI uptake values of H929 tumor-bearing mice 1 hour after injection of Ga-NOTA-PFBC01 of the single-domain antibody probe of the present invention and the blocking group; where a is the PET / CT maximum intensity projection (MIP) image and b is the ROI uptake value.

[0094] Figure 10 For the PET / CT maximum intensity projection (MIP) images and ROI uptake values of BCMA-positive H929 and BCMA-negative Bx-PC3 tumor-bearing mice 1 hour after injection of Ga-NOTA-PFBC01 of the single-domain antibody probe of the present invention; where a is the PET / CT maximum intensity projection (MIP) image and b is the ROI uptake value. 68 PET / CT maximum intensity projection (MIP) images and ROI uptake values of BCMA-positive H929 and BCMA-negative Bx-PC3 tumor-bearing mice 1 hour after injection of Ga-NOTA-PFBC01 of the single-domain antibody probe of the present invention; where a is the PET / CT maximum intensity projection (MIP) image and b is the ROI uptake value.

[0095] Figure 11 For the biodistribution of radioactive uptake in tumors and various organs of H929 tumor-bearing mice and mice in the blocking group 1 hour after injection of Ga-NOTA-PFBC01 of the single-domain antibody probe of the present invention 68 Ga-NOTA-PFBC01.

[0096] Figure 12 For the dynamic PET images and ROI dynamic uptake values of cynomolgus monkeys 1 hour after injection of Ga-NOTA-PFBC01 of the single-domain antibody probe of the present invention 68 Ga-NOTA-PFBC01; where a is the dynamic PET image and b is the ROI dynamic uptake value.

[0097] Figure 13 For the static PET / CT images and ROI uptake values of cynomolgus monkeys 1 hour and 2 hours after injection of Ga-NOTA-PFBC01 of the single-domain antibody probe of the present invention 68 Ga-NOTA-PFBC01; where a is the static PET / CT image and b is the ROI uptake value.

[0098] Figure 14 The amino acid sequence of the single-domain antibody PFBC01, the coding gene, the amino acid sequence of the corresponding recombinant single-domain antibody PFBC01, and the CDR sequence of the single-domain antibody PFBC01 in the present invention. Detailed implementation mode

[0099] I. Terms in the present invention: Unless otherwise defined, the technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art, unless otherwise defined. In general, terms related to cell and tissue culture, molecular biology, immunology, microbiology, genetics, transgenic cell production, protein chemistry, nucleic acid chemistry, and hybridization techniques described herein are well known in the art and commonly used in the art. The methods and techniques provided herein are generally performed according to routine.

[0100] Unless otherwise noted, methods well known in the art are described in various general and more specific references cited and discussed herein.

[0101] Any reference cited herein, including, for example, all patents, published patent applications, and non-patent publications, are hereby incorporated by reference in their entirety.

[0102] For ease of understanding the present disclosure, several terms and abbreviations used herein are defined as follows: In the present invention, "identity" refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence (or nucleotide sequence) can be determined using homology search sites on the Internet, such as the BLAST web page of the NCBI home page website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a search to calculate the identity of a pair of amino acid sequences, and then the identity value (%) can be obtained.

[0103] Specifically, the consistency of more than 70% may be more than 75%. Specifically, the consistency of more than 75% may be more than 80%. Specifically, the consistency of more than 80% may be more than 85%. Specifically, the consistency of more than 85% may be more than 90%. Specifically, the consistency of more than 90% may be more than 91%, more than 92%, more than 93%, more than 94%, more than 95%, more than 96%, more than 97%, more than 98% or more than 99%. More specifically, the consistency of more than 70% may be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

[0104] When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either A or B or both, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0105] The term "biomaterial" refers to any material that carries genetic information and is capable of self-replication or being replicated in a biological system, such as genes, plasmids, microorganisms, animals, plants, etc.

[0106] As used herein, the terms "protein" or "polypeptide" encompass all kinds of naturally occurring proteins and synthetic proteins, including protein fragments of all lengths, fusion proteins and modified proteins, including but not limited to glycoproteins and all other types of modified proteins (e.g., proteins produced by phosphorylation, acetylation, myristoylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, polyethylene glycolylation, biotinylation, etc.).

[0107] Unless otherwise specified, the terms "nucleic acid", "nucleotide" and "polynucleotide" simultaneously encompass DNA and RNA.

[0108] The host cell can be a prokaryotic cell, such as a bacterial cell, more specifically, an Escherichia coli cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; insect cells of Drosophila S2 or Sf9; animal cells such as CHO, COS7, 293 cells, etc.

[0109] The nucleic acid sequence encoding the single-domain antibody disclosed herein can be introduced into cells by "transfection", "transformation" or "transduction". As used herein, "transfection", "transformation" or "transduction" refers to the introduction of one or more exogenous polynucleotides into a host cell by using physical or chemical methods.

[0110] The term "transformation" means the introduction of one or more exogenous polynucleotides into competent bacterial cells, for example by using dimethyl sulfoxide, divalent cations (such as calcium) or polyethylene glycol. Many transformation techniques are known in the art and include heat shock and electroporation.

[0111] The terms "express" and "expression" mean to allow or cause the information in a gene or DNA sequence to be produced. For example, expression can take the form of producing a protein by activating the cellular functions involved in the transcription and translation of the corresponding gene or DNA sequence. The DNA sequence is expressed in or by a cell to form an "expression product" such as a protein. The expression product itself, such as the resulting protein, can also be said to be "expressed" by the cell. The expression product can be characterized as intracellular, extracellular or transmembrane.

[0112] The single-domain antibody can be prepared by recombinant methods. This is usually to clone the single-domain antibody gene into a vector, then transfer it into cells, and then isolate the relevant sequence from the proliferated host cells by conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in the present invention include biomolecules in an isolated form.

[0113] Currently, it is already possible to obtain the DNA sequence encoding the protein (or its fragment, or its derivative) of the present invention entirely by chemical synthesis. Then this DNA sequence can be introduced into various existing DNA molecules (or such as vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0114] Transformation of a host cell with recombinant DNA can be carried out by conventional techniques well known to those skilled in the art. When the host is a prokaryote such as Escherichia coli, competent cells capable of DNA uptake can be harvested after the exponential growth phase and treated with the CaCl2 method, the steps of which are well known in the art. Another method is to use MgCl2. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods can be selected: calcium phosphate co-precipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0115] The single-domain antibody or polypeptide described in the present invention can be expressed intracellularly, or on the cell membrane, or secreted extracellularly. If desired, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional renaturation treatment, treatment with protein precipitants (salting-out method), centrifugation, osmotic lysis, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

[0116] The term "single-domain antibody" refers to the heavy-chain single-domain antibody VHH (variable domain of heavy chain of heavy-chain antibody), which is a protein composed of the variable region of the heavy chain of an antibody.

[0117] The terms "single-domain antibody", "nanobody", "VHH", or "sdAb" refer to a single antigen-binding polypeptide having three complementarity-determining regions (CDRs). The basic single-domain antibody has the following structure from the N-terminus to the C-terminus: FR1 CDR1 FR2 CDR2 FR3 CDR3 FR4, where FR1 to FR4 refer to framework regions 1 to 4, respectively, and where CDR1 to CDR3 refer to complementarity-determining regions 1 to 3.

[0118] The "complementary determining region" (CDR) is the antigen-binding site in an antibody. CDRs can be defined using various terms: (i) Complementary determining regions (CDRs) are based on sequence variability. (ii) "Hypervariable region", "HVR", or "HV" refers to regions of the antibody variable domain that are highly variable in structure, as defined by Chothia and Lesk. The International ImMunoGeneTics (IMGT) database (http: / / www_imgt_org) provides standardized numbering and definitions of antigen-binding sites. As used herein, the terms "CDR", "CDR1", "CDR2", "CDR3" include CDRs defined by any of the methods described above, Kabat, Chothia, or IMGT, unless expressly stated otherwise in the specification. Framework regions (FWs) are adjacent to and flank these CDRs.

[0119] As used herein, the term "fragment" refers to a polypeptide that substantially retains the same biological function or activity as an antibody of the present invention. The polypeptide fragments of the present invention can be (i) polypeptides in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) polypeptides having a substituent group in one or more amino acid residues, or (iii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that prolongs the polypeptide half-life, e.g., polyethylene glycol), or (iv) polypeptides formed by fusion of an additional amino acid sequence to this polypeptide sequence (such as a leader sequence or a secretion sequence or a sequence used to purify this polypeptide or a proprotein sequence, or a fusion protein formed with a 6×His tag).

[0120] The term "antigen-binding fragment" refers to an antigen-binding fragment that includes the single-domain antibody described in the present invention, which generally includes at least a portion of the antigen-binding region or variable region of the parental antibody (e.g., one or more CDRs). The above antigen-binding fragments retain at least some of the binding specificities of the parental antibody. Generally, when expressed on a molar basis, the above antigen-binding fragments retain at least 10% of the parental binding activity. Specifically, the above antigen-binding fragments retain at least 20%, 50%, 70%, 80%, 90%, 95%, or 100% or more of the binding affinity of the parental antibody for the target.

[0121] In the present invention, the BCMA antibody or its antigen-binding fragment includes, but is not limited to: recombinant single-domain antibody, bivalent single-domain antibody, multivalent single-domain antibody, multispecific single-domain antibody, single-chain antibody, Fab, Fab' fragment, F(ab')2 fragment, minimal recognition unit (MRU), Fv antibody, single-chain antibody, or heavy-chain antibody.

[0122] The term "bivalent single-domain antibody" or "multivalent single-domain antibody" refers to a fusion polypeptide formed by linking two or more of the said single-domain antibodies. The single-domain antibodies in the "bivalent single-domain antibody" or "multivalent single-domain antibody" are formed by covalent or non-covalent linkage through a linking molecule, or by non-covalent linkage through mixing with a multimer.

[0123] The term "multispecific single-domain antibody" refers to a multispecific fusion polypeptide formed by linking the said single-domain antibody with an antigen-binding fragment specific for another antigen.

[0124] The term "multispecific" means that the antigen-binding protein (the BCMA single-domain antibody or its antigen-binding fragment) has two or more different antigen-binding specificities.

[0125] The term "Fab" is the fragment of antigen binding (Fab), which consists of a complete antibody light chain and the VH (heavy chain variable region) and CH1 (heavy chain constant region 1) domains of the heavy chain. That is, it is a heterodimer formed by the Fd of the antibody heavy chain and the complete light chain through a disulfide bond.

[0126] The term "Fab' fragment" contains a complete antibody light chain and a part of an antibody heavy chain including the VH domain, the CH1 domain, and the region between the CH1 and CH2 domains. Thus, an interchain disulfide bond can be formed between the two heavy chains of two Fab' fragments to form an F(ab')2 molecule.

[0127] The term "F(ab')2 fragment" consists of two Fab' fragments held together by a disulfide bond between the two heavy chains.

[0128] The term "minimal recognition unit (MRU)" refers to a molecule that contains only a single CDR structure in the variable region, with a molecular mass of only about 1% of the complete antibody and can bind the corresponding antigen.

[0129] The term "Fv antibody" is a protein composed only of the heavy chain variable region and the light chain variable region of an antibody. The heavy chain variable region and the light chain variable region are connected by non-covalent bonds.

[0130] The term "single-chain antibody" (ScFv) is a protein formed by linking the heavy chain variable region and the light chain variable region of an antibody with a short peptide.

[0131] As used herein, the terms "specifically bind", "specifically recognize", or "be specific for" refer to a measurable and reproducible interaction, such as the binding between a target and a single-domain antibody, which determines the presence of the target in a heterogeneous population of biomolecules.

[0132] The term "specificity" refers to the selective recognition of a single-domain antibody for a specific epitope of an antigen.

[0133] The term "specific binding" means that the affinity of a molecule for binding to another molecule is significantly higher than the affinity for binding to any cross-reactive antigen or off-target antigen (collectively referred to as non-target antigens). The affinity is determined using experimental techniques such as surface plasmon resonance (SPR), fluorescence-activated cell sorting (FACS) analysis, kinetic exclusion assay (KinExA), isothermal titration calorimetry (ITC), radioimmunoassay (RIA), and enzyme-linked immunosorbent assay (ELISA).

[0134] The terms "tumor" and "cancer" are used interchangeably herein and include solid tumors and liquid tumors.

[0135] The terms "cancer" and "cancerous" refer to a physiological disease in mammals characterized by uncontrolled cell growth.

[0136] The term "tumor" refers to the growth and proliferation of all neoplastic cells (whether malignant or benign) as well as all pre-cancerous and cancerous cells and tissues. When referred to herein, the terms "cancer", "cancerous", and "tumor" are not mutually exclusive.

[0137] As used herein, the term "label" refers to a compound or composition that is directly or indirectly conjugated or fused to a reagent (such as a single-domain antibody) and facilitates the detection of the reagent to which it is conjugated or fused. The label itself can be detectable (such as a radioisotope label or a fluorescent label), or in the case of an enzyme label, the label can catalyze a chemical change in a substrate compound or composition to be detectable. The term is intended to cover both the direct labeling of a probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, and the indirect labeling of a probe or antibody by reaction with another directly labeled reagent. Examples of indirect labeling include using a fluorescently labeled secondary antibody to detect a primary antibody, and using biotin to end-label a DNA probe so that it can be detected using a fluorescently labeled streptavidin.

[0138] The term "treat" or "treatment" refers to therapeutic treatment, where the purpose is to slow or mitigate an undesired physiological change or disorder, or to provide a beneficial or desired clinical outcome during the course of treatment. Beneficial or desired clinical outcomes include alleviation of symptoms, diminishment of the extent of a disorder, stabilization of a disease state (i.e., halting of worsening), delay or slowing of disease progression, improvement or palliation of a disease state, and / or remission (whether partial or complete, and whether detectable or undetectable). "Treatment" can also mean prolongation of survival as compared to expected survival if the subject were not receiving treatment. Those subjects in need of treatment include those subjects who already have an undesired physiological change or disorder and those subjects who are predisposed to having a physiological change or disorder. Treatment can involve a therapeutic agent, also referred to herein as a "medicament" or "medication", which can be intended to help achieve the beneficial or desired clinical outcome of interest through its action. A therapeutic agent or medicament can be administered to a subject by a number of routes, including at least intravenous and oral routes. The term "intravenous" in relation to the administration of a therapeutic agent or medicament refers to the administration of the therapeutic agent or medicament within one or more veins. The term "oral" in relation to the administration of a therapeutic agent or medicament refers to the administration of the therapeutic agent or medicament via an oral passage such as the mouth.

[0139] In the present invention, a "subject" includes a human being being treated for a disease or being prophylactically treated for a disease as a patient. The methods described herein can be used to treat animal subjects belonging to any classification. Examples of such animals include mammals. Mammals include, but are not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Lagomorpha, such as rabbits. Mammals can be of the order Carnivora, including felines (cats) and canines (dogs). Mammals can be of the order Artiodactyla, including bovines (cows) and suids (pigs), or of the order Perissodactyla, including equines (horses). Mammals can be of the order Primate, the order Ceboid or the order Simoid (monkeys) or anthropoid.

[0140] The term "effective" as applied to a dose or amount means the amount of a compound or pharmaceutical composition sufficient to produce a desired activity upon administration to a subject in need thereof. Note that when a combination of active ingredients is administered, the effective amount of the combination may or may not include the amounts of each ingredient that would be effective if administered alone. The exact amount required will vary with the subject, depending on the species, age and general condition of the subject, the severity of the condition being treated, the one or more specific drugs employed, the mode of administration, and the like.

[0141] In the present invention, the "BCMA-positive disease" may be a disease associated with a significant increase in BCMA expression level and having BCMA as a biomarker. Existing studies have found that BCMA-positive diseases include B-cell tumors, B-cell malignancies, plasma cell malignancies, and autoimmune diseases. Exemplarily, the BCMA-positive disease may be multiple myeloma (MM), non-Hodgkin lymphoma (NHL), including Burkitt lymphoma (BL), B-chronic lymphocytic leukemia (B-CLL), systemic lupus erythematosus (SLE), B- and T-acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma, chronic myeloid leukemia (CML), hairy cell leukemia (HCL), follicular lymphoma, Waldenström macroglobulinemia, mantle cell lymphoma, Hodgkin lymphoma (HL), plasma cell myeloma, precursor B-cell lymphoblastic leukemia / lymphoma, plasmacytoma, giant cell myeloma, plasma cell myeloma, heavy chain myeloma, light chain or Bence-Jones myeloma, lymphomatoid granulomatosis, post-transplant lymphoproliferative disorder, immunoregulatory diseases, rheumatoid arthritis, myasthenia gravis, idiopathic thrombocytopenic purpura, antiphospholipid syndrome, Chagas disease, Graves' disease. Wegener's granulomatosis, polyarteritis nodosa, Sjogren's syndrome, pemphigus vulgaris, scleroderma, multiple sclerosis, antiphospholipid syndrome, ANCA-associated vasculitis, Goodpasture's disease, Kawasaki disease, autoimmune hemolytic anemia, and rapidly progressive glomerulonephritis. Primary or immunocyte-related amyloidosis, or monoclonal gammopathy of undetermined significance.

[0142] The phrase "pharmaceutically acceptable" as used in connection with the compositions described herein refers to the molecular entities and other ingredients of such compositions that are physiologically tolerable and typically produce no adverse reactions when administered to a mammal (such as a human). Preferably, the term "pharmaceutically acceptable" means listed in recognized pharmacopoeias for mammals and more particularly for humans.

[0143] Exemplarily, the term "pharmaceutically acceptable carrier" includes, but is not limited to, water-soluble carrier materials (such as polyethylene glycol, polyvinylpyrrolidone, organic acids, etc.), poorly water-soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), enteric-soluble carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.). Using these materials, various dosage forms can be prepared, including but not limited to tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, buccal tablets, suppositories, freeze-dried powder injections, etc. They can be conventional preparations, sustained-release preparations, controlled-release preparations, and various particulate drug delivery systems. To prepare a unit dosage form into a tablet, various carriers well-known in the art can be widely used. Examples of carriers are, for example, diluents and absorbents, such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, aluminum silicate, etc.; wetting agents and binders, such as water, glycerol, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, gum arabic paste, gelatin paste, sodium carboxymethyl cellulose, shellac, methyl cellulose, potassium phosphate, polyvinylpyrrolidone, etc.; disintegrants, such as dried starch, alginate, agar powder, laminaran, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitan fatty acid ester, sodium dodecyl sulfate, methyl cellulose, ethyl cellulose, etc.; disintegration inhibitors, such as sucrose, glyceryl tristearate, cocoa butter, hydrogenated oil, etc.; absorption promoters, such as quaternary ammonium salts, sodium dodecyl sulfate, etc.; lubricants, such as talc, silica, corn starch, stearate, boric acid, liquid paraffin, polyethylene glycol, etc. Tablets can also be further made into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or bilayer tablets and multilayer tablets. To prepare a unit dosage form into pills, various carriers well-known in the art can be widely used. Examples of carriers are, for example, diluents and absorbents, such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinylpyrrolidone, kaolin, talc, etc.; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste or batter, etc.; disintegrants, such as agar powder, dried starch, alginate, sodium dodecyl sulfate, methyl cellulose, ethyl cellulose, etc. To prepare a unit dosage form into suppositories, various carriers well-known in the art can be widely used. Examples of carriers are, for example, polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, semi-synthetic glycerides, etc. To prepare a unit dosage form into injectable preparations, such as solutions, emulsions, freeze-dried powder injections and suspensions, all diluents commonly used in the art can be used, for example, water, ethanol, polyethylene glycol, 1,3-propanediol, ethoxylated isostearyl alcohol, polyoxygenated isostearyl alcohol, polyoxyethylene sorbitan fatty acid ester, etc.In addition, to prepare isotonic injection solutions, appropriate amounts of sodium chloride, glucose, or glycerol may be added to the injectable preparations. Additionally, conventional solubilizers, buffers, pH regulators, etc. may also be added. Furthermore, if needed, colorants, preservatives, fragrances, flavoring agents, sweeteners, or other materials may also be added to the pharmaceutical preparations.

[0144] II. Examples The present invention uses the BCMA protein as the targeting group of radioactive drugs to explore 68 the diagnostic efficacy of 68Ga-BCMA probes in multiple myeloma, aiming to provide new methods and means for the early diagnosis, accurate staging, recurrence judgment, treatment decision-making, and prognosis judgment of multiple myeloma, and to provide a scientific basis for the precise treatment of related diseases.

[0145] The present invention constructs a single-domain antibody library specific to the BCMA antigen based on steps such as alpaca immunization, RNA extraction, polymerase chain reaction (PCR), ligation and transformation, etc., and initially obtains a series of Anti-BCMA single-domain antibodies through plasmid expression, antibody expression, and purification. Subsequently, high-affinity single-domain antibodies against BCMA are screened using Enzyme-Linked Immunosorbent Assay (ELISA).

[0146] After extensive experimental verification and screening, the single-domain antibody PFBC01 targeting BCMA of the present invention is finally obtained. This single-domain antibody can specifically bind to the BCMA protein and selectively bind to tumor cells with high BCMA expression. The present invention also provides products derived from this single-domain antibody that can specifically bind to BCMA, as well as the uses of the single-domain antibody and its derivatives in tumor treatment, diagnosis, and imaging.

[0147] The purified recombinant single-domain antibody PFBC01 (1 mg / mL) is reacted with a chelating agent (PE-NHS or NOTA-NHS-ester) at a molar ratio of 1:5 - 1:10 in a carbonate buffer at pH 9.2 for 2 hours (25°C). Subsequently, a PD-10 desalting chromatography column is used to remove the free chelating agent, and the PE- or NOTA-labeled recombinant single-domain antibody PFBC01 is collected and stored at 4°C after aliquoting. In the specific embodiments of the present invention, the molar ratio of the recombinant single-domain antibody PFBC01 to the chelating agent is 1:10.

[0148] The present invention will be further described in detail below in conjunction with specific embodiments. The examples given are only for clarifying the present invention and not for limiting the scope of the present invention. The following examples provided can be used as a guide for those of ordinary skill in the art to make further improvements and do not limit the present invention in any way.

[0149] In the following experimental methods of the examples, unless otherwise specified, they are all conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0150] In the quantitative tests in the following examples, unless otherwise specified, three replicates are set, and the results are averaged.

[0151] In the following examples, GraphPad Prism statistical software was used to process the data. The experimental results are expressed as mean ± standard deviation, and the t-test was used. *, **, ***, and **** represent p < 0.05 (significant), p < 0.01 (very significant), p < 0.001 (extremely significant), and p < 0.0001 (highly significant), respectively.

[0152] Example 1 Construction of a single-domain antibody library specific for BCMA antigen 1. Immunization of alpacas with BCMA antigen Adult and healthy alpacas were selected and injected subcutaneously at multiple points on the back of the neck with BCMA antigen (KaiKa Biotech, BCM-HM217; Recombinant Human BCMA Protein (ECD, hFc Tag)), with a total amount of 2 mg. An equal volume of Freund's adjuvant was added to the antigen, and the immunization was carried out 5 times at an interval of 14 days. After the 3rd immunization, serum was collected, and the immunization titer of the antigen was measured by the ELISA method. When the titer reached more than 10,000 times, 50 mL of whole blood was collected, and PBMC cells were isolated. After adding Trizol (RNA extraction reagent) and mixing well, it was stored at -80 °C for later use.

[0153] 2. Extraction of RNA Take 1 mL of the separated PBMC cells, add 0.2 mL of chloroform, and mix well by shaking. Add 200 μL of chloroform, shake for 15 s, and let it stand at room temperature for 3 min; centrifuge at 12,000 rpm at 4 °C for 15 min; carefully take out the centrifuge tube, aspirate the supernatant and transfer it to a new 1.5 mL EP tube, add an equal volume of isopropanol, and mix well by inverting up and down. Let it stand at room temperature for 10 min; centrifuge at 12,000 rpm at 4 °C for 10 min; carefully discard the supernatant with a pipette tip, add 75% ethanol along the tube wall, and carefully resuspend the precipitate (or gently flick the bottom of the tube with your hand); centrifuge at 7,500 rpm at 4 °C for 5 min; carefully pour out the supernatant, and then spin for 1 min with no sample to aspirate the supernatant; open the lid and let it stand at room temperature for 10 to 15 min until the ethanol has completely evaporated; add 30 μL of RNase-free water to dissolve the RNA. The extracted RNA is easily degraded and needs to be reverse transcribed into cDNA in a timely manner.

[0154] 3. Obtain the variable region of the Anti-BCMA heavy chain antibody - VHH gene fragment (single-domain antibody gene) Reverse transcribe the extracted RNA into cDNA according to the instructions of the cDNA synthesis kit (PrimeScript™ II 1st Strand cDNA Synthesis Kit, catalog number 6210A, TAKARA). Prepare the following reaction mixture in a centrifuge tube: Random 6 mers (50 μM) 1 μL, dNTP Mixture (10 mM each) 1 μL, template RNA: less than 5 μg, RNase Free ddH2O Up to 10 μL. Incubate the mixture at 65 °C for 5 min and then quickly cool on ice. Prepare the following reverse transcription reaction solution in the above centrifuge tube with a total volume of 20 μL. Use 10 μL of the above denatured reaction solution, 5×PrimeScript II Buffer 4 μL, RNase Inhibitor (40 U / μL) 0.5 μL, PrimeScript IIRTase (200 U / μL) 1 μL, and add RNase Free dH2O to 20 μL. Carry out the reverse transcription reaction under the following conditions: 30 °C for 10 min, 42 °C for 30 to 60 min, 95 °C for 5 min, and then cool on ice.

[0155] Using cDNA as a template, perform PCR amplification of the heavy chain VHH gene fragment with two sets of primers respectively. In the first PCR amplification, the fragment larger than 750 bp is the common heavy chain gene fragment, and the fragment between 750 and 500 bp is the single-domain antibody gene fragment. Cut and recover the heavy chain antibody VHH gene fragment (single-domain antibody gene), and use this as a template to obtain the VHH target gene (up to 500 bp) by PCR amplification with VHH-specific primers

[0156] Note: In primer YT1BN, nucleotide symbols and definitions follow the ST.26 standard. Among them, S represents C or G, M represents A or C, K represents G or T; R represents A or G.

[0157] The first round of PCR was divided into two groups. The upstream primer corresponding to the common heavy chain gene of the antibody was YT-1, and the downstream primer was YT1BN; the upstream primer corresponding to the VHH gene was YT-2, and the downstream primer was YT1BN; the concentrations of the upstream and downstream primers in the system were each 10 pmol. PCR amplification reaction system: 5 μL of 10×PCR buffer, 5 μL of dNTPs, 1.5 μL of upstream primer, 1.5 μL of downstream primer, 3.5 μL of template (cDNA), 0.5 μL of Blend Taq enzyme, 33 μL of ddH2O. PCR conditions were: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 25 cycles; 10 min at 4°C.

[0158] The upstream and downstream primers for the second round of PCR were YTV8 and YTV9 respectively, and the concentrations of the upstream and downstream primers in the system were each 10 pmol. Second-round PCR amplification system: 5 μL of 10×PCR buffer, 5 μL of dNTPs, 1.5 μL of upstream primer (YTV8), 1.5 μL of downstream primer (YTV9), 3.5 μL of template (the first-round recovered product), 0.5 μL of Blend Taq enzyme, 33 μL of ddH2O. PCR conditions were: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min; 15 cycles were carried out, 10 min at 4°C.

[0159] The electrophoresis diagram of the amplification of the common heavy chain of the antibody and the VHH gene of the heavy chain antibody in the first round of PCR is as Figure 1 shown. The Marker was 2000bp, 1500b, 1000bp, 750bp, 500bp, 250bp, and 100bp. Lanes 1 and 2 were the products obtained by PCR using different primer combinations. Lane 1 contained an amplified fragment of the common heavy chain gene of the antibody greater than 750bp and an amplified fragment of the heavy chain antibody gene less than 750bp. Lane 2 was only an amplified fragment of the VHH gene of the heavy chain antibody of about 500bp.

[0160] 4. Ligation and transformation Digest the PCR product and the pHEN6 vector with the restriction endonuclease SfiI at 37°C overnight, and purify and recover the fragments using a universal recovery kit. Mix the recovered fragments and the vector at a ratio of 3:1, add T4 DNA ligase, mix well, briefly centrifuge, place in a 16°C constant temperature metal bath, and ligate overnight. Purify and recover the ligation product using a universal recovery kit. Electrotransform the ligation product of the VHH fragment and the pHEN6 vector into TG1 competent cells, spread on plates, and verify the antibody insertion rate by colony PCR. Spread the electrotransformed bacterial solution on LB / Amp plates and incubate at 37°C for 14 hours. Count and calculate the library capacity the next day. Use 2YT medium at 2 mL / plate and scrape the colonies. After mixing all the colonies evenly, add glycerol and store as 20% glycerol bacteria. Store at 1 mL / vial at -80°C.

[0161] 5. Preparation of Anti-BCMA VHH Phage Library (Single Domain Antibody Library) Add 1 mL of the seed bacterial library to 200 mL of 2YT medium (containing 50 μg / mL Amp + 1% glucose at the final concentration), culture at 37°C until the OD600 reaches 0.8 - 1, then add M13KO7 helper phage at a ratio of 1:20 for infection. After culturing for 1 hour, replace with a new 2YT medium (containing 100 μg / mL Amp + 50 μg / mL Kana at the final concentration) and culture overnight on a shaker at 37°C. Collect the bacterial solution into a sterile centrifuge tube, centrifuge to collect the supernatant, add 1 / 5 volume of 20% PEG-2.5M NaCl, mix well, incubate on ice for 1 hour, centrifuge at 12,000 rpm for 30 min, discard the supernatant, dissolve the precipitate in 3 mL of sterile 15% glycerol-PBS solution, and store the phage library at -80°C.

[0162] Example 2 Screening, Expression and Purification of Anti-BCMA Single Domain Antibody 1. Screening for BCMA-Specific Single Domain Antibody Coat the BCMA protein onto the immunization tube with the coating solution for the first round of screening. Discard the coating solution, block the whole tube with the blocking solution, add the phage solution after 1 h at room temperature, wash the tube 20 times with PBST, and then wash 5 times with PBS. Elute with 500 μL of the elution solution and add the neutralization solution for neutralization. Take 2 μL of the eluted phage for titer determination, and culture the remaining phage solution for amplification.

[0163] Determining the titer facilitates the next round of screening. The screening results are shown in Table 2. Using the coated BCMA protein as the target, three rounds of screening were performed from the total phage antibody library by solid-phase screening method. The phage titers eluted in each round were detected. It can be seen from Table 2 that as the number of screening rounds increased, the coating concentration decreased step by step, but the phage titer eluted increased, indicating that BCMA-specific phages were enriched.

[0164] 2. Screening of Anti-BCMA single-domain antibody phage monoclonal Coat BCMA antigen for ELISA determination. The concentration of the coated BCMA antigen protein is 1 μg / mL, 100 μL / well, and incubated overnight at 4°C. After 2 to 3 rounds of solid-phase screening of phages, randomly select monoclonal into deep well plates for culture, add helper phages for infection and then culture overnight. Take the overnight culture supernatant for ELISA detection, use Anti-M13-HRP as the secondary antibody, and incubate at 37°C for 1 h. After washing, add TMB for color development, add 2M H2SO4 to terminate the reaction, and measure the OD value of the sample at a wavelength of 450 nm with an enzyme-linked immunosorbent assay reader. Select the Anti-BCMA positive wells, perform DNA sequencing, and identify the gene sequences of the anti-BCMA single-domain antibody clones to obtain a series of single-domain antibody gene sequences. Through the analysis and typing of the amino acids encoded by the sequences, single-domain antibodies of multiple gene subtypes were obtained for further expression and screening of highly specific and highly active single-domain antibodies.

[0165] 3. Construction of Anti-BCMA single-domain antibody expression plasmid Using 5-nano-NdeI and 3-nano-XhoI as primers and the phage screening positive monoclonal product as the template, PCR amplification was used to obtain the specific Anti-BCMA single-domain antibody gene. The PCR product and the pET-21b(+) vector (Youbao Biotech, VT1198) were treated with the restriction enzymes NdeI and XhoI respectively, and the fragments were ligated by T4 DNA ligase and transformed into BL21(DE3) competent cells to obtain a plasmid capable of highly expressing single-domain antibodies in Escherichia coli.

[0166] The sequences (5' to 3') of the primers 5-nano-NdeI and 3-nano-XhoI are as follows: 5-nano-NdeI: CATATGCAGGTTCAGCTGGTTGA (SEQ ID NO:9): 3-nano-XhoI: CTCGAGTGAGGAGACGGTGACCTGGGT (SEQ ID NO:10).

[0167] 4. Expression and purification of Anti-BCMA single-domain antibody The strain containing the target gene was streaked on a culture plate containing sodium ampicillin and cultured overnight at 37°C. A single clone was selected and inoculated into 3 mL of 2YT medium containing sodium ampicillin and cultured overnight. It was then subcultured into 100 mL of 2YT culture medium containing sodium ampicillin and cultured on a shaker at 37ºC at 220 rpm. When the OD 600nm value reached 0.6 to 1.0, 0.5 to 1 M IPTG was added, and the culture was continued on a shaker at 20°C at 200 rpm overnight. The cells were harvested by centrifugation at 6500 rpm for 20 minutes. The cells were washed twice with 0.05 M Tris buffer, 20 mL of 0.05 M Tris buffer was added, and the mixture was placed in an ultrasonic cell disruptor and sonicated in an ice bath for 15 min. The supernatant was collected by centrifugation. The single-domain antibody protein with a purity of over 90% was obtained by separation using Ni+ ion affinity chromatography magnetic beads (BeaverBeadsTM His-tagProtein Purification, Suzhou Beaver Biomedical Engineering Co., Ltd.), and the protein was collected and the dialysis buffer was replaced. The results are shown in SDS-PAGE electrophoresis Figure 2 , in the figure, the Marker is 180 kDa, 135 kDa, 100 kDa, 75 kDa, 63 kDa, 48 kDa, 35 kDa, 25 kDa, 17 kDa and 11 kDa.

[0168] Finally, the single-domain antibody numbered PFBC01, its amino acid sequence, the recombinant single-domain antibody with a His tag corresponding to the coding gene, and the CDR sequence are as Figure 14 shown.

[0169] On the premise that the sequence is known, the preparation and screening of single-domain antibodies are routine operations in the art. Taking the PFBC01 single-domain antibody as an example, it is exemplified as follows: The fragment between the recognition sites of the restriction endonucleases NdeI and XhoI in pET-21b(+) (the small fragment between the NdeI and XhoI recognition sites) was replaced with the DNA molecule shown in SEQ ID NO:2, and the other nucleotide sequences of pET-21b(+) were kept unchanged to obtain the recombinant vector pET21b-PFBC01 expressing the recombinant single-domain antibody PFBC01. pET21b-PFBC01 was transformed into competent cells of Escherichia coli BL21(DE3) to obtain recombinant Escherichia coli that can highly express the recombinant single-domain antibody PFBC01. The amino acid sequence of the recombinant single-domain antibody PFBC01 expressed by this recombinant Escherichia coli is SEQ ID NO:3, where the first amino acid of SEQ ID NO:3 is M encoded by the sequence ATG in pET-21b(+), the second to 124th amino acids are the amino acid sequence of the single-domain antibody PFBC01, and the 125th to 130th amino acids are the 6×His tag.

[0170] The amino acid sequence shown at positions 2 to 124 of SEQ ID NO:3 is the same as that of SEQ ID NO:1.

[0171]

[0172] Example 3 Detection of the affinity of recombinant single-domain antibody PFBC01 for human BCMA protein by enzyme-linked immunosorbent assay (ELISA) Dilute the BCMA-His antigen (Sino Biological, 10620-H08H) to 1 μg / ml with 0.05 M NaHCO3 (pH 9.6) coating buffer, 100 μL / well, and coat overnight at 4°C. Block the 96-well plate with PBST containing 4% skim milk powder at 37°C for 1 hour. Add the diluted recombinant single-domain antibody PFBC01 with an initial concentration of 50 μg / mL, serially diluted 5-fold for 7 gradients, and incubate at 37°C for 1 hour. Wash the plate three times with 0.05% PBST. Add the secondary antibody Anti-VHH-antibody-HRP diluted 1:10,000, 100 μL / well, and incubate at 37°C for 1 hour. Wash the plate three times with 0.05% PBST. Add 100 μL of TMB and let it develop color in the dark at room temperature for 15 minutes. Add 50 μL of 2 M H2SO4 to terminate the reaction. Measure the OD value of the sample at a wavelength of 450 nm using a microplate reader. The results are shown in Table 3 and Figure 3 The results show that the recombinant single-domain antibody PFBC01 has good specificity for the BCMA protein.

[0173]

[0174] Example 4 Flow cytometry identification of the affinity of PFBC01 single-domain antibody for BCMA protein In the experiment, human myeloma cell line H929 (ATCC, CRL-3580) was selected as the positive cell and cultured in RPMI 1640 medium containing 10% FBS. The purified recombinant single-domain antibody PFBC01 (1 mg / mL) was reacted with PE-NHS (AATBioquest, 2613) at a molar ratio of 1:10 in carbonate buffer at pH 9.2 in the dark for 2 hours (25 °C). Subsequently, free dye was removed using a PD-10 desalting chromatography column, and the PE-labeled recombinant single-domain antibody PFBC01 was collected, aliquoted, and stored at 4 °C in the dark. The PE-labeled recombinant single-domain antibody PFBC01 at 20 μg / mL was incubated with H929 cells on ice for 20 minutes, then washed three times with PBS and resuspended in 500 μL PBS. Fluorescence intensity was analyzed using a FACS Calibur analyzer (BD Biosciences) and FlowJo software (Tree Star). 3G1-2 and 3G1-1 were used as positive controls, and the detection method for the positive controls was the same as that for the PE-labeled recombinant single-domain antibody PFBC01, except that the recombinant single-domain antibody PFBC01 was replaced with 3G1-2 or 3G1-1. PE control and blank control (CK) were set up. The results Figure 4 showed that the recombinant single-domain antibody PFBC01 had a significant displacement with H929 cells, while the displacement degrees of other alternative single-domain antibodies were lower than that of the recombinant single-domain antibody PFBC01, indicating that the recombinant single-domain antibody PFBC01 had good binding affinity and specificity with H929 cells.

[0175] Example 5 Analysis of the Affinity between the Single-Domain Antibody PFBC01 and BCMA Protein by Biolayer Interferometry (BLI) The Octet RED96 (Sartorius) biolayer interferometer was used to identify the affinity between the recombinant single-domain antibody PFBC01 and BCMA protein. After the HIS1K biosensor was immersed in PBS solution for 10 min, the single-domain antibody was captured, and then the sensor was immersed in wells containing 100, 50, 25, 12.5, 6.25, 3.125, and 1.563 nM BCMA protein for 2 min. Dissociation was carried out in PBS solution. Then, the data were analyzed using Octet Analysis Studio 13.0 software, and the results are shown in Figure 5 , the recombinant single-domain antibody PFBC01 had a very high affinity for BCMA protein, and the KD value was less than 1.0E-12.

[0176] Example 6 Radioactive Probe Labeling and Stability Determination of the Single-Domain Antibody PFBC01 All animal experiments were conducted according to the approved protocols of the Animal Management and Use Committee of Peking University First Hospital. Female NCG immunodeficient mice (4-6 weeks old, Jiangsu Jicui Yakang Biotechnology Co., Ltd.) were used to establish a subcutaneous multiple myeloma tumor model. The preparation of tumor-bearing mice is a conventional technique in the art. An exemplary preparation method is as follows: The positive cell line H929 (ATCC, CRL-3580) was subcutaneously injected into the right axilla of mice at a density of 1×10 7 cells in 100 μL of Matrigel suspension. The tumor volume was monitored regularly. When the tumor grew to 1 cm³, in vivo imaging and biodistribution experiments were performed. The preparation method of the negative control Bx-PC3 mice was referred to that of the subcutaneous multiple myeloma tumor model, with the only difference being that the H929 cells were replaced with Bx-PC3 cells (ATCC, CRL-1687).

[0177] The purified recombinant single-domain antibody PFBC01 (1 mg / mL) was reacted with NOTA-NHS-ester (Macrocyclics, B-601) at a molar ratio of 1:10 in carbonate buffer at pH 9.2 for 2 hours (25 °C). Subsequently, the free chelator was removed using a PD-10 desalting column, and the NOTA-labeled recombinant single-domain antibody PFBC01 was collected, aliquoted, and stored at 4 °C.

[0178] The 68 Ge- 68 Ga germanium-gallium generator (German ITM Isotope Technologies) was eluted with 0.05 M high-purity hydrochloric acid to obtain 4 mL 68 of GaCl3 eluate. The 1 mL 68 GaCl3 solution with the highest specific activity was taken, and 80 μL of 2 M sodium acetate was added to adjust the pH of the solution system to 4-4.5. Subsequently, the recombinant single-domain antibody PFBC01 conjugated with NOTA (a chelator) was added, and the mixed solution was placed on an oscillator at 37 °C for 15 minutes. Then the solution was filtered through a PD10 column to obtain 68 the Ga-NOTA-PFBC01 single-domain antibody-labeled probe.

[0179] The radiochemical purity of the labeled product and its in vitro stability in PBS (Gibco, 10010023) and FBS (Gibco, 10270106) solutions were determined by thin-layer chromatography (TLC) technique. First, a line was drawn with a pencil 1 cm from the end of the chromatography paper, and the sample (the probe incubated in PBS / FBS) was gently spotted on the line. The chromatography paper was developed in the developing agent (EDTA:sodium citrate = 9:1), air-dried, and then placed in a MINI-SCAN thin-layer chromatograph (Eckert&Ziegler). The marked point was aligned with the 0 scale line of the chromatograph, and FLOW-COUNT (Eckert&Ziegler) was started to detect the radioactive distribution (scanning time 1 min, energy range 450 - 750 keV). It was measured that 68 the radiochemical purity of the 68Ga-NOTA-PFBC01 single-domain antibody-labeled probe was >95% after 2 hours in both PBS and FBS solutions (see Figure 6 ).

[0180] Example 7 PET imaging and biodistribution analysis of the PFBC01 single-domain antibody probe in a tumor-bearing mouse model When the tumor volume reached the experimental requirement, 11.1 MBq of 68 68Ga-NOTA-PFBC01 was injected into the tail vein of H929 tumor-bearing mice. Then, the mice were anesthetized under an isoflurane atmosphere (2% isoflurane - 30% oxygen / air) at 1 h and 2 h, and imaging was performed using micro-PET / CT (Beijing Yongxin Medical Equipment Co., Ltd.). The imaging results are shown as Figure 7 follows. The results showed that in the BCMA-positive H929 model, 68 high radioactivity accumulation was observed in the tumor 1 hour after the injection of 68Ga-NOTA-PFBC01, and a high uptake rate was still maintained at 2 h; obvious uptake of the probe was observed in the kidneys, indicating that the probe was mainly excreted through the kidneys.

[0181] Regions of interest (ROIs) were drawn using software, and the radioactive uptake in the tumor and major organs at each time point was quantitatively analyzed. The results are shown as Figure 8 a in. The radioactive uptake in the tumor of H929 was 3.21 %ID / ccMax at 1 h and 3.12 %ID / ccMax at 2 h. The ratios of the tumor to muscle and blood were calculated based on the ROI uptake values. The results are shown as Figure 8As shown in b, the ratio of tumor to muscle was 9.13 at 1 hour, and even higher at 2 hours, reaching 15.93; the ratio of tumor to blood was 3.83 at 1 hour, and also even higher at 2 hours, reaching 5.10. The above results confirm that the probe exhibits excellent tumor targeting 1-2 hours after injection, with not only a high tumor uptake, but also an ideal target-to-blood ratio, indicating that the probe has excellent in vivo metabolic kinetics.

[0182] Blocking experiment: 11.1 MBq of 68 The mice were co-injected with 1 mg of recombinant single-domain antibody PFBC01 at the same time as Ga-NOTA-PFBC01, and then anesthetized under isoflurane atmosphere (2% isoflurane-30% oxygen / air) at 1 h and imaged using micro-PET / CT (Beijing Yongxin Medical Equipment Co., Ltd.). The images are shown in Figure 9 As shown in a. The results showed that in the BCMA-positive H929 model ( Figure 9 In H929), 68 The tumor showed higher radioactivity concentration 1 hour after Ga-NOTA-PFBC01 injection, while the blocking group ( Figure 9 The H929-block in the middle maintained a low uptake rate. The region of interest (ROI) was drawn by software and the radioactive uptake in the tumor and major organs at each time point was quantitatively analyzed. The results are as follows Figure 9 As shown in b. The tumor uptake of H929 in the non-blocking group was 3.21%ID / ccMax at 1 hour, while the uptake of H929 in the blocking group was only 1.60%ID / ccMax ( P <0.05), which proved that the probe could specifically bind to BCMA.

[0183] Negative control Bx-PC3 tumor-bearing mice were injected with 11.1 MBq of 68 Ga-NOTA-PFBC01 was then anesthetized under isoflurane atmosphere (2% isoflurane-30% oxygen / air) at 1 h and imaged using micro-PET / CT (Beijing Yongxin Medical Equipment Co., Ltd.). The imaging images are shown in Figure 10 As shown in a. It can be observed that 68 The uptake of Ga-NOTA-PFBC01 in H929 tumors was significantly higher than that in Bx-PC3. The region of interest (ROI) was drawn by software and the radioactive uptake in tumors and major organs at each time point was quantitatively analyzed. The results are shown in Figure 2. Figure 10 As shown in b. The tumor uptake of H929 was 3.21%ID / ccMax at 1 hour, while the uptake of the control group Bx-PC3 was only 0.51%ID / ccMax ( P(<0.05), further confirming the specific targeting ability of this probe to BCMA.

[0184] The H929 tumor-bearing mice were euthanized 1 hour after injection of the probe for biodistribution analysis. Various organs including blood, heart, lung, liver, kidney, spleen, bladder, stomach, bone, muscle, small intestine, brain, and tumor were collected and weighed, and counted using a gamma counter (Hidex). The radioactive uptake results were expressed as the percentage per gram of tissue (%ID / g, mean ± standard deviation). The results of in vivo biodistribution analysis are as Figure 11 shown, which are consistent with the PET imaging results, showing 68 that the uptake of P Ga-NOTA-PFBC01 in the H929 tumor was significantly higher than that in the blocking group ( P (<0.05). These results indicate that the PFBC01 single-domain antibody probe of the present invention has the ability to rapidly target BCMA and can achieve high-sensitivity imaging of small tumors.

[0185] Example 8 68 Pharmacokinetics of Ga-NOTA-PFBC01 in healthy cynomolgus monkeys 68Ga-NOTA-PFBC01 at a dose of 3.7 MBq / kg. PET / CT (uMI780; United Imaging Health Care) scanning was started immediately after injection, with the scanning range covering from the head to the abdomen. Scanning was continued for 60 minutes. During the imaging process, low-dose CT (tube voltage 120 kV, tube current 100 mA, matrix size 512×512) was used for attenuation correction and to provide anatomical reference. PET scanning was completed at 4 bed positions, with a matrix size of 192×192 for each bed and a scanning speed of 1.5 minutes / bed. All PET data were reconstructed using the OSEM (ordered subset expectation maximization) algorithm with reconstruction parameters of 2 iterations and 20 subsets. The reconstructed images were registered with the anatomical reference images to ensure the accuracy of analysis. Image post-processing was completed on a professional workstation (uXceed, version R001; United Imaging Health Care) to ensure the standardization and consistency of data processing. The image acquisition time points included: 1, 2, 5, 10, 20, 30, 40, 50, 60 minutes. The changes in standardized uptake values (SUV) in multiple tissues (heart, lung, liver, spleen, kidney, muscle, bone, and aorta) were recorded. The curve of the standardized uptake value (SUVmax) over time was calculated to compare the uptake and clearance characteristics of different tissues.

[0186] As Figure 12 shown, within 2 minutes, 68 Ga-NOTA-PFBC01 was rapidly distributed to the heart, kidneys, and large blood vessel regions. With the prolongation of time, the radioactive signals in the heart and blood vessels gradually weakened, while the kidneys maintained a relatively high level and continued to increase, indicating that the kidneys were the main clearance pathway. The SUV values of the liver and spleen remained stable after 10 minutes. The SUVs of the bone and muscle remained relatively stable, with a relatively low overall uptake (SUVmax < 2). The SUVs of the heart and aorta rapidly reached a peak and then decreased rapidly at an early stage, indicating that the probe had the characteristics of rapid blood clearance and could rapidly distribute from the blood circulation to the target tissues.

[0187] Static scanning further verified this trend. As Figure 13 shown in a of Figure 13 , the whole-body static PET / CT imaging results at 1 hour and 2 hours showed that the kidneys were still the main radioactive accumulation sites, and this change was consistent with the trend observed in the dynamic scanning. The radioactive signals in the heart and large blood vessels were significantly weakened in the static scanning, indicating that the single-domain antibody had been basically cleared from the blood circulation at this time point. b of Figure 13 showed that the SUV values of the liver, spleen, lung, muscle, and bone still remained at a relatively low level (<1.0), indicating a relatively low overall uptake in the whole body tissues. The above results demonstrated that the radioactive tracer was rapidly cleared from normal organs, which was in line with the distribution and metabolism characteristics of the single-domain antibody.

[0188] In summary, the BCMA-specific single-domain antibody PFBC01 of the present invention not only exhibits excellent BCMA targeting ability in vivo, but also has good tumor penetrability, and is suitable for binding with anti-cancer drugs or imaging agents to support targeted tumor therapy and imaging applications.

[0189] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, the present invention is intended to include any modifications, uses, or improvements to the present invention, including those that depart from the scope disclosed in the present invention and are made by conventional techniques known in the art.

Claims

1. Single domain antibody, characterized in that: The single-domain antibody comprises three complementarity-determining regions named CDR1, CDR2, and CDR3 respectively; the amino acid sequences of CDR1, CDR2, and CDR3 comprise positions 28 to 35, positions 49 to 60, and positions 97 to 112 of SEQ ID NO:1 respectively.

2. The single-domain antibody according to claim 1, wherein: The single-domain antibody further comprises four framework regions named FR1, FR2, FR3, and FR4. FR1 comprises the amino acid sequence shown in at least one of (A11) or (A12): (A11) positions 1 to 27 of SEQ ID NO:1 (A12) an amino acid sequence having more than 70% identity with (A11); FR2 comprises the amino acid sequence shown in at least one of (A21) or (A22): (A21) positions 36 to 48 of SEQ ID NO:1 (A22) an amino acid sequence having more than 70% identity with (A21); FR3 comprises the amino acid sequence shown in at least one of (A31) or (A32): (A31) positions 61 to 96 of SEQ ID NO:1 (A32) an amino acid sequence having more than 70% identity with (A31); FR4 comprises the amino acid sequence shown in at least one of (A41) or (A42): (A41) positions 113 to 123 of SEQ ID NO:1 (A42) an amino acid sequence having more than 70% identity with (A41).

3. The single-domain antibody according to claim 1 or 2, characterized in that: The amino acid sequence of the single-domain antibody comprises SEQ ID NO:1 or has at least 70% identity with SEQ ID NO:

1.

4. An immunoconjugate, characterized in that: The immunoconjugate comprises (I) and (II): (I) an antibody, and the antibody comprises the single-domain antibody described in any one of claims 1 to 3; (II) a conjugate moiety: the conjugate moiety is selected from a detectable label, a drug, a toxin, a nucleic acid, or a combination thereof.

5. Probe molecule, characterized in that: The probe molecule contains the single-domain antibody described in any one of claims 1 to 3.

6. The probe molecule according to claim 5, wherein: The probe molecule is a radioactive probe.

7. The probe molecule according to claim 6, wherein: The radioactive probe comprises the single-domain antibody and a radionuclide conjugated to the single-domain antibody.

8. Reagent or kit, characterized in that: It comprises the single-domain antibody described in any one of claims 1 to 3, the immunoconjugate described in claim 4, and / or the probe molecule described in any one of claims 5 to 7.

9. A polypeptide, characterized in that: The polypeptide comprises the single-domain antibody described in any one of claims 1 to 3.

10. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises the single-domain antibody described in any one of claims 1 to 3, the immunoconjugate described in claim 4, the probe molecule described in any one of claims 5 to 7, and / or the polypeptide described in claim 9.

11. Use of the single-domain antibody described in any one of claims 1 to 3, the immunoconjugate described in claim 4, the probe molecule described in any one of claims 5 to 7, and / or the polypeptide described in claim 9 in at least one of the following (C1) to (C7): (C1) preparing a detection reagent, a detection kit, a detection plate, or a developer for recognizing or assisting in recognizing BCMA protein; (C2) preparing a detection reagent, a detection kit, a detection plate, or a developer for binding or assisting in binding BCMA protein; (C3) Preparing a detection reagent, detection kit, detection plate or developer for detecting or assisting in detecting the expression level of BCMA in cells; (C4) Preparing a detection reagent, detection kit, detection plate or developer for diagnosing or assisting in diagnosing BCMA-positive diseases; (C5) Preparing a detection reagent, detection kit, detection plate or developer for diagnosing or assisting in diagnosing the stage of BCMA-positive diseases; (C6) Preparing a detection reagent, detection kit, detection plate or developer for monitoring or assisting in monitoring the therapeutic effect of BCMA-positive diseases; (C7) Preparing a pharmaceutical composition for treating and / or preventing BCMA-positive diseases.

12. Biomaterial, characterized in that: The biological material is any one of the following: (E1) A nucleic acid molecule encoding the single-domain antibody according to any one of claims 1 to 3; (E2) An expression cassette containing the nucleic acid molecule described in (E1); (E3) A recombinant vector containing the nucleic acid molecule described in (E1) or / and the expression cassette described in (E2); (E4) A recombinant cell containing the nucleic acid molecule described in (E1), the expression cassette described in (E2) or / and the recombinant vector described in (E3); (E5) A recombinant microorganism containing the nucleic acid molecule described in (E1), the expression cassette described in (E2) or / and the recombinant vector described in (E3).

13. The biomaterial according to claim 12, wherein: (E1) The nucleic acid molecule is the DNA molecule described in at least one of the following or the RNA molecule transcribed from the DNA molecule: (F1) A DNA molecule whose nucleotide sequence of the coding strand includes the DNA molecule shown in SEQ ID NO: 2; (F2) A DNA molecule having more than 70% identity with (F1) and encoding the above single-domain antibody.

14. The biomaterial according to claim 12 or 13, characterized in that: (E4) The cell described is a cell derived from an animal, a plant or a microorganism.

15. A method for preparing a single-domain antibody, characterized in that: The single-domain antibody is the single-domain antibody according to any one of claims 1 to 3, and the method includes the step of expressing the coding gene of the single-domain antibody in a cell to obtain the single-domain antibody.

Images