Neural crest stem cell with high expression of KIF1BP as well as preparation method and application of neural crest stem cell

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a neural crest stem cell with high expression of KIF1BP as well as a preparation method and application of the neural crest stem cell. According to the invention, the KIF1BP is overexpressed in the NCSCs cells, so that the NCSCs KIF1BP can obtain more excellent migration ability and neuronal differentiation ability. According to the invention, high expression of KIF1BP is associated with migration of neural crest stem cells and neuronal differentiation capacity for the first time, and the limitation that the prior art depends on growth factors or physical induction to directionally differentiate NCSCs is broken through. Meanwhile, the autonomous migration ability of NCSCs is enhanced through high expression of KIF1BP, dependence on in-vitro pre-differentiation can be reduced, the colonization efficiency of transplanted cells in a focus area can be improved, and the treatment targeting and effectiveness can be remarkably enhanced when the neural crest stem cells are used for treating diseases, so that the effect of NCSCs in cell treatment is effectively improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a neural crest stem cell with high expression of KIF1BP, a preparation method thereof, and uses thereof. Background Art

[0002] Neural Crest Stem Cells (NCSCs) are a group of pluripotent stem cells with unique biological characteristics during the embryonic development of vertebrates. They originate from the neural crest structure during the neural tube closure stage. As a transitional tissue, the neural crest endows NCSCs with the potential to differentiate across germ layers. During embryonic development, NCSCs can migrate to multiple systems throughout the body and differentiate into various cell types by virtue of this potential, such as sympathetic ganglia and Schwann cells in the peripheral nervous system, chromaffin cells in the adrenal medulla of endocrine cells, as well as melanocytes and head and neck mesenchymal tissues. This multi-directional differentiation ability and migration characteristics of NCSCs make them the core objects for studying neural development mechanisms, tissue regeneration and repair, and disease modeling.

[0003] However, there are still certain technical bottlenecks in using NCSCs as seed cells for cell therapy, which are mainly manifested in the following aspects: (1) Insufficient migration ability: The migration efficiency of neural crest stem cells in vivo plays a decisive role in their therapeutic effect. When repairing extensive nerve injuries or targeting lesion areas, if the migration ability of neural crest stem cells is insufficient, they cannot effectively reach the corresponding sites, thereby greatly reducing the regeneration effect. (2) Low neural differentiation efficiency of neural crest stem cells during in vitro culture: In the natural state, these stem cells tend to differentiate into glial cells, such as Schwann cells, but are not easily differentiated into functional neurons. This results in the therapeutic effect of nerve regeneration being difficult to reach an ideal state after transplantation. (3) There are problems in the source and ethical limitations of NCSCs: Traditional methods for obtaining neural crest stem cells rely on embryos or fetuses, which have caused many ethical controversies. Relatively speaking, in vitro induction and differentiation techniques, such as the directed differentiation of embryonic stem cells or induced pluripotent stem cells, can break through this bottleneck to a certain extent.

[0004] In view of this, it is necessary to improve NCSCs by starting from the approach of obtaining NCSCs, so that they have better migration ability and neuronal differentiation ability, and improve their therapeutic effect in vivo. Summary of the Invention

[0005] To overcome the deficiencies of the above-mentioned existing technologies, the present invention provides a method for preparing neural crest stem cells with high expression of KIF1BP. By constructing a plasmid expressing KIF1BP and then using the method of lentiviral transfection, NCSCs overexpress the KIF1BP protein, enabling NCSCs to obtain better migration ability and neuronal differentiation ability, thereby greatly improving the therapeutic effect of NCSCs in vivo.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] The present invention provides a method for preparing neural crest stem cells with high expression of KIF1BP, and the method comprises the following steps:

[0008] S1. Digest hPSCs into single-cell suspension, induce neural crest successively through the D-1 stage and the D0-D7 stage, and then obtain P75 high NCSCs through flow sorting, and continue to culture;

[0009] S2. Extract RNA from healthy human PBMCs cells, reverse transcribe it into cDNA, and then PCR amplify the KIF1BP gene. Then, digest the pLVX series lentiviral vector and the KIF1BP gene with BamHI and EcoRI respectively, and then recombinantly ligate the vector and the gene fragment through Hieff one-step method, transform DH5α competent cells, and finally select positive clone single colonies to obtain the recombinant plasmid;

[0010] S3. Transfect the recombinant plasmid, the packaging plasmid psPAX2, and the envelope plasmid pMD2.G into 293T cells using Lipofectamine 3000 for lentiviral packaging, collect the virus solution to infect the sorted NCSCs, and finally obtain neural crest stem cells with high expression of KIF1BP through expression detection.

[0011] By overexpressing KIF1BP in NCSCs cells, the present invention enables NCSCsKIF1BP to obtain better migration ability and neuronal differentiation ability. Using such neural crest stem cells to treat diseases will significantly enhance the targeting and effectiveness of the treatment, thereby effectively improving the effect of NCSCs in cell therapy.

[0012] Preferably, the D-1 stage is induced using CDM culture medium, and the preparation method of the CDM culture medium is as follows: using DMEM / F-12 as the basal medium, and successively adding the following components: 1% N2, 2% B27, 0.05% BSA, 1% non-essential amino acids, 2 mM GlutaMax, 0.1 mM 2-mercaptoethanol, 20 ng / mL bFGF, 10 μM Y-27632, and 1% double antibody.

[0013] Preferably, the induction in the D0-D7 stages is carried out using NCCM culture medium. The preparation method of the NCCM culture medium is as follows: using DMEM / F-12 as the basal medium, adding 1% N2, 1 μM Chir99021, and 0.5 μM SB431542 thereto.

[0014] Preferably, the primers used for PCR amplification of the KIF1BP gene are as shown in SEQ ID NO.1 and SEQ ID NO.2.

[0015] Preferably, mTeSR TM 1 medium is used as the culture medium for hPSCs.

[0016] Preferably, the sorted NCSCs are inoculated into a six-well plate. When the density reaches 60%, fresh culture medium is changed, and then virus solution is added for infection.

[0017] Preferably, the infection time for infecting the sorted NCSCs with the virus solution is 12 - 16 h.

[0018] The present invention also provides neural crest stem cells with high expression of KIF1BP prepared by the above-mentioned preparation method.

[0019] The present invention also provides the application of the above-mentioned neural crest stem cells with high expression of KIF1BP in the preparation of drugs for treating nervous system-related diseases.

[0020] Preferably, the nervous system-related diseases include tissue ischemia diseases, neurodegenerative diseases, and cerebral ischemia injury diseases.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] On the premise of not interfering with the inherent phenotype of neural crest stem cells (NCSCs) themselves and maintaining their neural differentiation potential, the present invention promotes the overexpression of the KIF1BP gene through specific technical means, thereby obtaining NCSCs KIF1BP cells. Compared with ordinary NCSCs, NCSCs KIF1BP exhibit extremely prominent advantages. In the in vivo environment, it can accurately reach the damaged tissue site with a stronger migration ability. Moreover, its neuron differentiation ability is also more excellent, and it can more efficiently differentiate into the required neuron cells. The synergistic effect of these two characteristics greatly improves the therapeutic effect of NCSCs on related diseases or injuries in vivo, bringing new hope to the field of nerve repair treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is a bright field image of hPSCs differentiating into NCSCs;

[0024] Figure 2 Flow cytometry detection results of NCSCs;

[0025] Figure 3 Overexpression detection results of NCSCs mRNA;

[0026] Figure 4 For NCSCs KIF1BP Migration detection of cells;

[0027] Figure 5 For NCSCs KIF1BP Neuronal differentiation of cells;

[0028] Figure 6 For NCSCs KIF1BP Results of neuronal immunofluorescence staining of cells;

[0029] Figure 7 For NCSCs KIF1BP Statistical results of the proportion of neuronal differentiation of cells;

[0030] Figure 8 Schematic diagram of the model establishment and treatment of MCAO rats;

[0031] Figure 9 Results of TTC staining of the brain tissue of MCAO rats;

[0032] Figure 10 Statistical results of TTC staining of MCAO rats;

[0033] Figure 11 Results of blood vessel staining of MCAO rats. Specific implementation manners

[0034] The following further describes the specific implementation manners of the present invention. It should be noted here that the description of these implementation manners is used to help understand the present invention, but does not constitute a limitation to the present invention. In addition, the technical features involved in the following various implementation manners of the present invention can be combined with each other as long as they do not conflict with each other.

[0035] The experimental methods in the following examples are all conventional methods unless otherwise specified, and the test materials used in the following examples can all be obtained through conventional commercial channels unless otherwise specified.

[0036] The present invention constructs an in vitro induction and differentiation system based on small molecules to achieve the directional differentiation of human pluripotent stem cells (hPSCs) into neural crest stem cells, and discovers that P75 sorted by flow cytometry highNCSCs have good cell migration characteristics and neuronal differentiation ability, which may be related to their high KIF1BP gene expression. And with the passage of in vitro culture, the expression of KIF1BP gene decreases, and its migration characteristics and neuronal differentiation ability also gradually decrease. Therefore, it is preliminarily determined that the high expression of KIF1BP gene may improve the migration and neuronal differentiation function of NCSCs, and it is expected to obtain high-quality NCSCs seed cells in vitro by overexpressing KIF1BP gene.

[0037] KIF1BP (Kinesin Family Member 1Binding Protein), as a key member of the kinesin superfamily, plays a multi-dimensional regulatory role in neural stem cell proliferation and differentiation, neuronal migration, and synaptic function integration by regulating microtubule dynamics, axonal transport, and signal transduction networks. Early studies have found that KIF1BP function is closely related to neuronal survival, synapse formation, and cell migration. KIF1BP gene mutations are associated with peripheral neuropathy such as Charcot-Marie-Tooth Disease (CMT2A), indicating that it plays a key role in neural development.

[0038] Subsequently, the present invention further studied and found that high expression of KIF1BP may enhance the function of neural crest stem cells through the following mechanisms: ① Improve migration ability: Enhanced kinesin activity can promote cytoskeleton reorganization and accelerate the directional migration of cells in complex microenvironments. ② Regulate neuronal differentiation: KIF1BP directly induces neural crest stem cells to differentiate into functional neurons by transporting neurotrophic factors (such as BDNF) or regulating differentiation-related signal pathways (such as Wnt, Notch).

[0039] Therefore, the present invention associates the high expression of KIF1BP with the migration and neuronal differentiation ability of neural crest stem cells for the first time, and breaks through the limitation of the existing technology that relies on growth factors or physical induction to differentiate NCSCs. At the same time, by enhancing the autonomous migration ability of NCSCs cells through high expression of KIF1BP, it is possible to reduce the dependence on in vitro pre-differentiation and improve the colonization efficiency of cells in the lesion area after transplantation, so that it is expected to be applied to diseases related to the nervous system, such as brain injury, neurodegenerative diseases, etc. On the one hand, neural function can be reconstructed by transplanting neural crest stem cells that can migrate and differentiate efficiently; on the other hand, by constructing a cell line that highly expresses KIF1BP, it can be used for mechanism research of neurodegenerative diseases or drug toxicity testing.

[0040] In order to comprehensively and clearly present the technical solutions and significant advantages of the present invention, the present invention is described in detail below in conjunction with detailed specific embodiments.

[0041] Example 1: NCSCs induction, phenotype identification and gene manipulation

[0042] 1. Induction and phenotypic identification of NCSCs

[0043] 1.1. Experimental preparation

[0044] (1) Pretreatment of well plates

[0045] ① Pre-treat the culture well plates with Matrigel. Slowly add Matrigel to the bottom of the well plates, and carefully ensure that it evenly covers every area of the bottom of the well plates during the operation.

[0046] ② After the addition is completed, place the well plates at 37 °C for ≥ 1 hour or overnight at 4 °C to ensure the pretreatment effect.

[0047] (2) Reagent equilibration

[0048] Before use, the buffers, culture media, and digestive solutions required for the experiment need to be equilibrated at room temperature for 30 minutes to reduce the impact of temperature differences on the experiment.

[0049] (3) Preparation of culture media

[0050] 1) hPSCs medium: Select mTeSR TM 1 medium as the hPSCs medium.

[0051] 2) Prepare the induction D-1 culture medium (CDM):

[0052] ① Prepare 10 mM Y-27632 stock solution and 500 μg / mL bFGF stock solution in advance.

[0053] ② Using DMEM / F-12 as the basal medium, sequentially add the following components: 1% N2 (N2 cell culture additive), 2% B27, 0.05% BSA, 1% non-essential amino acids, 2 mM GlutaMax, 0.1 mM 2-mercaptoethanol, 20 ng / mL bFGF, 10 μM Y-27632, and 1% double antibody. Mix well and store at 4 °C (for use within two weeks).

[0054] 3) Prepare the induction D0-D7 culture medium (NCCM):

[0055] ① Prepare a stock solution of Chir99021 with a concentration of 10 mM and a stock solution of SB431542 in advance.

[0056] ② Using DMEM / F-12 as the basal medium, add 1% N2, 1 μM Chir99021, and 0.5 μM SB431542 to it, mix well, and then store at 4 °C (for use within two weeks).

[0057] 1.2. Cell treatment and induction ①

[0058] (1) hPSCs digestion

[0059] ① Culture hPSCs (human embryonic stem cells H9, from the Cell Bank of the Chinese Academy of Sciences) in a constant temperature cell incubator at 37 °C and 5% CO2 until the density reaches 80%. Aspirate the original culture medium for hPSCs, and then rinse the cells twice with 1×PBS to remove the residual original culture medium and impurities.

[0060] ② Add Accutase digestion solution (0.05 mL / cm 2 ), digest at 37 °C for 8 minutes, then add 5 times the volume of PBS to terminate the digestion. Subsequently, gently pipette the cells to make them into a single cell suspension, transfer the single cell suspension to a centrifuge tube, centrifuge at 250×g for 4 minutes, discard the supernatant, resuspend the cells with CDM medium and count.

[0061] 1.3 Neural crest induction

[0062] (1) D-1 stage: First, aspirate the Matrigel in the well plate pretreated with Matrigel, then add CDM medium, and then inoculate hPSCs cells at a density of 1×10 4 cells / cm 2 . After standing at room temperature for 5 minutes, place it in an incubator at 37 °C and 5% CO2 for 24 hours.

[0063] (2) D0-D7 stage: After 24 hours of culture, change the medium in the well plate to fresh NCCM medium, change the medium every day, and continue to culture for 6 days to maintain the stability of the cell growth environment and the sufficient supply of nutrients.

[0064] 1.4 Flow cytometry analysis and sorting

[0065] (1) Single cell suspension preparation

[0066] Use Accutase to digest the induced cells, then resuspend the cells with PBS containing 0.1% BSA and filter through a 200-mesh filter to remove cell clumps to ensure that the cells used in subsequent experiments are in a single cell state.

[0067] (2) Antibody incubation and washing

[0068] ① Transfer the filtered cell suspension to a centrifuge tube, centrifuge at 250×g for 5 minutes, discard the supernatant, then resuspend the cells with 50 - 150 μL of PBS containing 0.1% BSA, and add 1 test volume of flow cytometry antibody, incubate at 4 °C in the dark for 30 minutes.

[0069] ②After incubation, add 2 mL of PBS containing 0.1% BSA for mechanical washing, centrifuge at 250×g for 5 minutes, and discard the supernatant. Repeat this washing step once, resuspend, and store at 4°C in the dark.

[0070] 1.5. Sorting and collection

[0071] ① Pretreatment of collection tubes: First, rinse the collection tubes with PBS (sorting and collection solution) containing 0.5% BSA, discard the liquid, and then add 1 mL of sorting and collection solution.

[0072] ② Sort the above-treated cells according to the standard operating procedure of the flow cytometer. Screen out the target cells NCSCs with high expression of P75 protein (strongly positive for CD271) through the flow antibody Anti-human CD271 (P75) (BD, #560326). After collection, centrifuge at 250×g for 5 minutes, discard the supernatant, resuspend, and use for subsequent culture.

[0073] 1.6. Culture and passage after sorting

[0074] (1) Adherent culture (taking one well of a 6-well plate as an example)

[0075] Add 1 mL of neural crest passage medium to one well of a 6-well plate, then inoculate 5×105 sorted and resuspended cells into this well, and culture at 37°C and 5% CO2. During the culture process, replace 1 / 2 volume of the medium (NCCM) every day to maintain the nutrients and environmental conditions required for cell growth.

[0076] (2) Passage: When the cell density reaches 90%, it indicates that the cells have grown to the stage where passage is required. At this time, pre-treat the new well plate with Matrigel in advance, and equilibrate the experimental reagents at room temperature. First, rinse the cells with PBS twice, then add Accutase to digest the cells, and after centrifugation, inoculate them into the new well plate at a ratio of 1:3 and continue to culture for 24 h.

[0077] 2. Construction of KIF1BP overexpression lentiviral vector and virus infection

[0078] 2.1. Experimental materials

[0079] (1) Cell line: 293T cells (for virus packaging).

[0080] (2) Vector: pLVX-M-Puro series lentiviral vector (Addgene, #125839).

[0081] (3) Reagents: Restriction endonucleases (such as BamHI, EcoRI), HieffClone recombinase, Lipofectamine 3000, TRIzol, reverse transcription kit, etc. KIF1BP specific primers containing restriction sites (the GeneID of KIF1BP in NCBI is 55735):

[0082] Forward F: 5’-GAGCTCATCGGGATC-ATGGCGAACGTTCCGTGGGC-3’ (SEQ ID NO.1);

[0083] Reverse R: 5’-GAGCATGTCGGAAATT-TTAAGTCAGGGCCATCTTGGT-3’ (SEQ ID NO.2); Used for amplifying the KIF1BP CDS sequence.

[0084] 2.2 Experimental procedures

[0085] (1) Acquisition of KIF1BP gene

[0086] ① RNA extraction: Obtain healthy human PBMCs cells, wash them with PBS, lyse them with TRIzol, separate layers with chloroform, precipitate RNA with isopropanol, wash with 75% ethanol, dissolve with DEPC water, and detect the purity by ultraviolet (A260 / A280 = 1.8 - 2.0).

[0087] ② Reverse transcription: Using 1 - 2 μg RNA as a template, configure the system with Oligo(dT) 18 primers, dNTPs, etc., and synthesize cDNA after 60 min at 42°C and 10 min at 70°C.

[0088] ③ PCR amplification: Using cDNA as a template, amplify the target gene with a high-fidelity enzyme (such as Pfu DNA polymerase), verify by agarose gel electrophoresis, and then recover and purify.

[0089] (2) Construction of recombinant plasmid

[0090] ① Double digestion: Digest the vector and the target gene with BamHI and EcoRI respectively, and then recover the digested products by gel extraction.

[0091] ② Ligation and transformation: Use Hieff One-step method to recombinantly ligate the vector and the gene fragment, then transform DH5α competent cells, and then spread the transformed cells on an LB plate containing antibiotics and culture at 37°C until single colonies form.

[0092] ③ Screening of positive clones: Identify by colony PCR and double digestion, and verify correct insertion by sequencing.

[0093] (3) Lentivirus packaging

[0094] ① 293T cell culture: After resuscitating 293T cells, inoculate them into DMEM medium containing 10% fetal bovine serum and passage when the density reaches 80%-90%.

[0095] ② Transfection: Transfect the recombinant plasmid, packaging plasmid (psPAX2) and envelope plasmid (pMD2.G) into 293T cells using Lipofectamine 3000. Replace the medium 6-8 h after transfection and collect the supernatant 48-72 h later. Centrifuge to remove cell debris and store the virus solution at -80°C.

[0096] (4) Virus infection of NCSCs

[0097] Inoculate the sorted NCSCs into a six-well plate. When the cell density reaches 60%, replace with fresh medium, then add 100 μL of virus solution (multiplicity of infection MOI is 2) and 8 μg / mL polybrene. Replace the medium 12-16 h later and continue culturing for 36 h, and detect the overexpression of KIF1BP gene.

[0098] 1.3 Detection of overexpression

[0099] (1) RNA extraction and reverse transcription

[0100] After lysing the cells with TRIzol, extract RNA by chloroform extraction and precipitate with isopropanol. After dissolving the RNA, take 1 μg and reverse transcribe it into cDNA using Oligo(dT) 20 primer and M-MLV reverse transcriptase.

[0101] (2) qPCR detection

[0102] Use SYBR Green premix to prepare the reaction system (containing cDNA, KIF1BP detection primers, the sequences are F: GAGGTCTGCGAGAAATTCCAG (SEQ ID NO.3); R: CGCTGTATTTGGACTTGTATGGT (SEQ ID NO.4)). After pre-denaturation at 95°C for 10 min, analyze the Ct value through 40 cycles (95°C for 15 s, 60°C for 45 s) and calculate the gene expression level.

[0103] (3) Immunofluorescence staining

[0104] Fix the cells with 4% PFA for 2 h first, then permeabilize them with Triton X-100, block them with 10% horse serum, incubate with primary antibodies (mouse anti-TUBB3 primary antibody and rabbit anti-CD31 primary antibody respectively) overnight at 4°C, incubate with secondary antibodies (Goat Anti-Mouse IgGAlexa488 and Goat Anti-Rabbit IgGAlexa 555 respectively) in the dark at room temperature for 3 h, then stain the nuclei with Hoechst, mount the slides with anti-fluorescence quenching agent, and finally observe and take pictures under a fluorescence microscope.

[0105] 3. Experimental results

[0106] As Figure 1 shown, human pluripotent stem cells hPSCs are directed to differentiate into neural crest stem cells NCSCs; as Figure 2 shown, the CD271 strongly positive cell population is sorted and cultured by flow cytometry to represent that the proportion of neural crest stem cells with high expression of P75 (P75 high NCSCs) is about 27.4%; further, lentivirus is used to overexpress the KIF1BP gene to obtain NCSCs KIF1BP neural crest stem cells, and flow cytometry detection shows that the proportion of the co-expressing cell population of CD271 and KIF1BP reaches 96.9%, indicating that KIF1BP is successfully overexpressed in NCSCs; as Figure 3 shown, the expression level of KIF1BP mRNA in NCSCs KIF1BP is detected by qPCR method and has a significant difference compared with the control group, indicating that KIF1BP mRNA is successfully overexpressed in NCSCs.

[0107] Example 2: Migration and neuron differentiation ability of NCSCs

[0108] 1. Experimental method

[0109] (1) Transwell migration efficiency experiment: Inoculate NCSCs 4 cells at a density of 1×10 KIF1BP cells / well in the upper chamber, add DMEM / F-12 basal medium, add NCCM medium to the lower chamber, after culturing for 24 hours, wipe off the non-migrated cells in the upper chamber with a cotton swab, take pictures after crystal violet staining and count the number of cells (randomly select 5 fields of view per well for counting).

[0110] (2) Efficiency of inducing differentiation into neuron cells: Add neuron induction culture medium based on DMEM / F-12 medium, containing 1% N2 additive, 10 ng / mL BDNF, 10 ng / mL GDNF, and 10 ng / mL NGF neurotrophic factors, and continue induction for 3 - 4 weeks. During the induction process, it can be seen through a microscope that the cell morphology changes significantly, showing multipolarity with slender protrusions, possessing typical neuron-like characteristics. Further, immunofluorescence staining is used to detect the expression of the neuron surface marker TUBB3 to evaluate the differentiation efficiency into neuron cells.

[0111] 2. Experimental results

[0112] The experimental results show that the attached figure can be seen: NCSCs KIF1BP has stronger migration ability compared to the control group ( Figure 4 ), NCSCs KIF1BP has stronger neuron differentiation ability compared to the control group ( Figure 5 ), immunofluorescence staining shows that the expression of TUBB3 protein in the NCSCs KIF1BP group is significantly higher than that in the control group ( Figure 6 ), and the statistical results show that the proportion of TUBB3-positive cells in NCSCs KIF1BP is higher than that in the control group, and there is a significant difference between the two groups ( Figure 7 ).

[0113] Example 3: Animal modeling and NCSCs cell therapy

[0114] 1. Experimental methods

[0115] 1.1 Construction of MCAO (Middle Cerebral Artery Occlusion) animal model

[0116] (1) Operations for the surgery group:

[0117] ① After fixing the rats under general anesthesia, make a midline incision in the neck and separate the common carotid artery (CCA), external carotid artery (ECA), and internal carotid artery (ICA).

[0118] ② Block the blood flow of CCA, block ICA with a cell clip, and ligate distally and fix proximally with a slipknot for ECA. Insert a thread embolism at the incision of MCA until the starting point, occlude for 1.5 h, then remove the embolism for reperfusion, and finally suture the wound.

[0119] (2) Operations for the sham operation group: Only separate the blood vessels without inserting a thread embolism.

[0120] 1.2 Intervention operations

[0121] (1) Ischemia and injection time: On the first day, MCAO ischemia was induced in rats for 60 minutes. On the second day, rats with a Longa score of over 3 were screened. On the third day, stereotaxic injection into the brain was performed (site: AP ± 0.5 mm, ML 3 mm, DV - 5 mm).

[0122] (2) Group settings: Sham operation control group, normal saline control group, and cell therapy group (NCSCs con group and NCSCs KIF1BP group) were set up.

[0123] 1.3 Stereotaxic injection into the brain

[0124] The rats were anesthetized and fixed. With the Bregma point as the origin, the coordinates (ML, AP, DV) were adjusted to determine the lateral ventricle site. After drilling a hole, neural crest stem cells (NCSCs con and NCSCs KIF1BP ) were slowly injected. The cell concentration was 1×105 / μL, 2.5 μL / site, at a rate of 1 μL / min. The control group was injected with the same volume of normal saline. The needle was left in place for 10 minutes and then removed. The skin was sutured. Cyclosporine A (10 mg / kg / time) was injected subcutaneously every 3 days. Samples were taken after 14 - 28 days of feeding.

[0125] 1.4 Detection of cerebral ischemic injury

[0126] The cerebral ischemic injury was detected by TTC staining. After perfusion with normal saline, the brain was removed, frozen at -80°C and sectioned (2 mm thick). Then it was stained with 2% TTC staining solution at 37°C for 20 minutes, and after fixation with 4% PFA, the ischemic volume percentage was measured using ImageJ.

[0127] 2 Experimental results

[0128] Figure 8 is a schematic diagram of the time for MCAO model establishment and cell therapy, showing that NCSCs cell injection therapy was performed on the third day after model establishment. Figure 9 The TTC staining of KIF1BP shows the lesion areas of the control group and the experimental group. The results show that the area of the cerebral ischemic injury region in the NCSCs con treatment group is smaller than that in the NCSCs KIF1BP group, indicating that the treatment effect of NCSCs Figure 10 The statistical results of the TTC staining area of KIF1BP show that the area of the ischemic injury region in the NCSCs Figure 11 group is significantly smaller than that in the control group, indicating a better treatment effect. KIF1BP The CD31 staining of KIF1BP shows that the number of newly formed blood vessels in the NCSCs treatment group is more than that in the control group, indicating that the treatment effect of NCSCs

[0129] In summary, by overexpressing KIF1BP in NCSCs, the NCSCs KIF1BP can obtain better migration ability and neuron differentiation ability. Using such neural crest stem cells to treat diseases will significantly enhance the targeting and effectiveness of the treatment, thereby effectively improving the effect of NCSCs in cell therapy.

[0130] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principle and spirit of the present invention, various changes, modifications, substitutions, and variations made to these embodiments still fall within the protection scope of the present invention.

Claims

1. A method for preparing neural crest stem cells with high expression of KIF1BP, characterized in that, It includes the following steps: S1. Digest hPSCs into single cell suspensions, induce neural crest through D-1 stage and D0-D7 stages in sequence, and then obtain P75 high NCSCs through flow sorting, and continue the culture; S2. Extract RNA from healthy human PBMCs cells, reverse transcribe it into cDNA, and then PCR amplify the KIF1BP gene. Then, digest the pLVX series lentiviral vectors with BamHI and EcoRI respectively, and then use Hieff One-step recombination to ligate the vector and the gene fragment, transform DH5α competent cells, and finally select positive clone single colonies to obtain recombinant plasmids; S3. Transfect the recombinant plasmid, packaging plasmid psPAX2, and envelope plasmid pMD2.G into 293T cells using Lipofectamine 3000 for lentivirus packaging, collect the virus solution to infect the sorted NCSCs, and finally obtain neural crest stem cells highly expressing KIF1BP after expression detection.

2. The preparation method of a neural crest stem cell with high expression of KIF1BP according to claim 1, characterized in that In the D-1 stage, induction is carried out using CDM culture medium. The preparation method of CDM culture medium is as follows: Based on DMEM / F-12 as the basal medium, successively add the following components: 1% N2, 2% B27, 0.05% BSA, 1% non-essential amino acids, 2 mM GlutaMax, 0.1 mM 2-mercaptoethanol, 20 ng / mL bFGF, 10 μM Y-27632, and 1% double antibody.

3. The preparation method of a kind of neural crest stem cells highly expressing KIF1BP according to claim 1, characterized in that, In the D0-D7 stage, induction is carried out using NCCM culture medium. The preparation method of NCCM culture medium is as follows: Based on DMEM / F-12 as the basal medium, add 1% N2, 1 μM Chir99021, and 0.5 μM SB431542 to it.

4. The preparation method of a neural crest stem cell with high expression of KIF1BP according to claim 1, characterized in that, The primers used for PCR amplification of the KIF1BP gene are shown as SEQ ID NO.1 and SEQ ID NO.

2.

5. The preparation method of a kind of neural crest stem cells with high expression of KIF1BP according to claim 1, characterized in that, Select mTeSR TM 1medium as the culture medium for hPSCs.

6. The preparation method of a neural crest stem cell highly expressing KIF1BP according to claim 1, characterized in that The sorted NCSCs are inoculated into a six-well plate. When the density reaches 60%, change to fresh medium and then add the virus solution for infection.

7. The preparation method of a kind of neural crest stem cells with high expression of KIF1BP according to claim 1, characterized in that, The infection time for infecting the sorted NCSCs with the virus solution is 12-16 h.

8. Neural crest stem cells highly expressing KIF1BP prepared by the preparation method described in any one of claims 1-7.

9. Use of the neural crest stem cells highly expressing KIF1BP described in claim 8 in the preparation of drugs for treating nervous system-related diseases.

10. The application according to claim 9, characterized in that, The nervous system-related diseases include tissue ischemia diseases, neurodegenerative diseases, and cerebral ischemia injury diseases.

Images