Plant source HTR3A antagonist and application thereof in preparation of medicine for treating rosacea

Abstract

The invention discloses a plant-derived HTR3A antagonist and application thereof in preparation of a medicine for treating rosacea, and belongs to the field of biological medicines.The plant-derived HTR3A antagonist is screened aiming at HTR3A targets, and finally four compounds (D, H, E and T respectively) with high affinity with HTR3A are obtained; under a rosacea model constructed by THP-1 cells stimulated by LL-37 and neurotransmitter 5-HT (L5), through mRNA level detection of HTR3A and further verification and screening of an immunofluorescent staining experiment, the compounds D and T are determined to have remarkable effects. The invention provides a novel plant source compound and a regulation scheme for treating nervous rosacea, and has important application value.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to a plant-derived HTR3A antagonist and application thereof in preparing a drug for treating rosacea. Background Art

[0002] Rosacea is a chronic inflammatory skin disease with an increasing incidence in recent years. Its clinical features include paroxysmal facial flushing, erythema, papules, pustules, etc., and the disease is prone to recurrence, which has a serious impact on the patient's physical and mental health. The pathogenesis of rosacea is relatively complex, involving genetic factors, abnormal neurovascular regulation, abnormal immune function, impaired skin barrier function, and microbial factors.

[0003] At present, the drugs used clinically to treat rosacea mainly include the following categories: 1. Antibiotics: such as metronidazole and tetracycline, which are mainly used to inhibit the growth of Demodex follicles and anaerobic bacteria and reduce the release of inflammatory mediators; 2. β-adrenergic receptor blockers: such as propranolol and carvedilol, which can reduce the vasodilation caused by catecholamines by blocking β-adrenergic receptors, thereby alleviating the symptoms of paroxysmal facial flushing in patients with rosacea; 3. Antianxiety drugs: such as doxepin and buspirone, which mainly play an anti-anxiety role by adjusting 5-HT neurotransmission and reducing facial vascular reactions caused by mood swings. However, the drugs currently on the market cannot completely cure rosacea, but can only relieve symptoms and control the progression of the disease. Not only that, most drugs are not suitable for long-term use and have certain side effects. Therefore, the development of new targeted drugs that can effectively relieve, treat, and even cure rosacea has become a key issue that needs to be solved urgently, and is of great significance for improving the quality of life of patients and improving the level of clinical treatment.

[0004] 5-Hydroxytryptamine (5-HT), also known as serotonin, is a monoamine neurotransmitter widely distributed in mammalian tissues. In the central nervous system, 5-HT affects many aspects of brain activity, such as the regulation of emotions, energy, memory, and the shaping of outlook on life. In the human periphery, 5-HT is mainly synthesized in the intestine, and then transported to various parts of the body through platelets and released, thereby exerting a series of physiological effects. 5-HT must be mediated by the corresponding receptors to exert its effects. The classification of 5-HT receptors (HTR) is complex, and more than 20 types have been discovered, including 5-HT1, 5-HT2, 5-HT3 receptors, etc. 5-HT activates different HTRs to produce different pharmacological effects.

[0005] It has been reported in some studies that at the peripheral inflammatory sites, excessive 5-HT is produced in tissues, which enhances the ability of macrophages to respond to inflammation through HTR3A. Patent CN202010132159 mentions that inhibiting HTR3A can be used for the treatment and prevention of Alzheimer's disease, but there is currently no report on the use of its receptor antagonists in the treatment of rosacea. Summary of the Invention

[0006] The purpose of this section is to outline some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section, as well as in the abstract and title of the present application, to avoid obscuring the purpose of this section, the abstract, and the title, and such simplifications or omissions shall not be used to limit the scope of the present invention.

[0007] In view of the above and / or problems existing in the prior art, the present invention is proposed.

[0008] Therefore, an object of the present invention is to overcome the deficiencies in the prior art and provide a plant-derived HTR3A antagonist.

[0009] To solve the above technical problems, the present invention provides the following technical solution: A plant-derived HTR3A antagonist, which contains one or more of the compounds 2,7-Dihydrohomoerysotrine (D) and 1,2,15,16-Tetrahydrotanshinone (T) screened from plants.

[0010] The structural formula of the compound 2,7-Dihydrohomoerysotrine (D) is:

[0011]

[0012] The structural formula of the compound 1,2,15,16-Tetrahydrotanshinone (T) is:

[0013]

[0014] As a preferred embodiment of the plant-derived HTR3A antagonist of the present invention, wherein: the molar ratio of the compound 2,7-Dihydrohomoerysotrine (D) to the compound 1,2,15,16-Tetrahydrotanshinone (T) is 1-2:2-3.

[0015] As a preferred embodiment of the plant-derived HTR3A antagonist of the present invention, wherein: the molar ratio of the compound 2,7-Dihydrohomoerysotrine (D) to the compound 1,2,15,16-Tetrahydrotanshinone (T) is 1:3.

[0016] As a preferred embodiment of the plant-derived HTR3A antagonist of the present invention, wherein: the molar ratio of the compound 2,7-Dihydrohomoerysotrine (D) to the compound 1,2,15,16-Tetrahydrotanshinone (T) is 2:2.

[0017] Another object of the present invention is to overcome the deficiencies in the prior art and provide an application of a plant-derived HTR3A antagonist in the preparation of a drug for treating rosacea.

[0018] As a preferred embodiment of the above application of the present invention, wherein: the rosacea includes neurogenic rosacea.

[0019] As a preferred embodiment of the above application of the present invention, wherein: the antagonist reversely regulates the expression of the HTR3A gene at the mRNA level, and wherein the compounds D and T cause a significant decrease in the expression of the HTR3A gene.

[0020] As a preferred embodiment of the above application of the present invention, wherein: the compounds D and T in the antagonist have a competitive inhibitory ability on the binding of HTR3A to 5-HT and regulate inflammatory factors related to rosacea.

[0021] As a preferred embodiment of the above application of the present invention, wherein: both the compounds D and T in the antagonist significantly down-regulate the protein levels of IL-1β and TNF-α, and the compound D significantly down-regulates the protein levels of IL-8 and VEGF.

[0022] Another object of the present invention is to overcome the deficiencies in the prior art and provide a pharmaceutical composition for treating rosacea, comprising a plant-derived HTR3A antagonist and a pharmaceutically acceptable carrier, diluent or excipient.

[0023] Advantages of the present invention:

[0024] (1) The present invention provides a plant-derived HTR3A antagonist, verifies the magnitude of its binding energy through molecular docking, and verifies its inhibitory effect on the cellular HTR3A gene in a rosacea macrophage model. Therefore, it can be precise and efficient for rosacea, especially the intractable neurogenic rosacea.

[0025] (2) The plant-derived HTR3A antagonist proposed by the present invention has natural properties derived from plants, is renewable and biodegradable, greatly reducing the burden on the environment; at the same time, it has high safety, reducing the risk of side effects that may be caused by traditional treatment methods, and patients can use it for a long time.

[0026] (3) The plant-derived HTR3A antagonist proposed by the present invention has extremely strong specificity, can act on related targets with high selectivity, avoid interfering with other normal physiological functions, and improve the accuracy and effectiveness of treatment.

[0027] (4) The plant-derived HTR3A antagonist proposed by the present invention introduces a new natural treatment plan for the field of rosacea treatment, providing a new direction for the subsequent drug development of the correlation between nerves and skin diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained according to these drawings. Among them:

[0029] Figure 1 It is the cytotoxicity diagram of four compounds screened in the embodiments of the present invention.

[0030] Figure 2 It is the mRNA level diagram of HTR3A after THP-1 cells in the embodiments of the present invention were pre-incubated with drugs (D, E, H, T) for 1 h and stimulated with L5 for 24 h.

[0031] Figure 3 It is the immunofluorescence staining diagram of D and T in the embodiments of the present invention.

[0032] Figure 4 It is the expression diagram of inflammation-related factors of D and T in the rosacea model in the embodiments of the present invention.

[0033] Figure 5 It is the expression diagram of IL-8 and VEGF of D and T and their combinations in the rosacea model in the embodiments of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0034] The compound D used in the experiments of the present invention was purchased from Yunnan Xili Biotechnology Co., Ltd., and the compounds H, T, and E were purchased from Shanghai Yuanye Bio-Technology Co., Ltd., with a purity greater than 95%;

[0035] THP-1 (SCSP-567) cells were purchased from the Cell Bank of the Chinese Academy of Sciences; LL-37 was purchased from Selleck and dissolved in ddH2O at a final concentration of 4 μM for use;

[0036] 5-HT was purchased from Sigma. After dissolution in DMSO, it was diluted with ddH2O to a final concentration of 400 μM for use.

[0037] Example 1

[0038] Screening of plant-derived natural HTR3A:

[0039] A total of 71 compounds related to HTR3A were found through the TCMSP database. Considering bioavailability, 35 compounds were further screened using logP 1 - 4 as the standard.

[0040] The molecular binding affinity between the screened components and HTR3A was analyzed using the AutodockVina 1.5.7 program:

[0041] The three-dimensional structure of HTR3A (PDB ID: 6W1Y) was used as the docking substrate, and its protein structure was downloaded from the Protein Data Bank (PDB) database;

[0042] Subsequently, the substrate was hydrogenated using the autodock software. A pocket with a gild box of 60×60×60 was selected, and 5-HT was used as the reference substance to dock into the corresponding binding pocket; the screened compounds were docked. The screened compounds were docked using the best orientation of the already docked ligand, that is, the result of energy minimization.

[0043] As shown in Table 1.

[0044] Table 1 Top 10 Compounds Screened by Molecular Docking

[0045]

[0046] It can be seen that among the top 10 compounds, the following 4 compounds with the optimal energy conservation (molecular energy ≤ -9.0 kcal / mol) were obtained, namely 2,7-Dihydrohomoerysotrine (D), Epiquinidine (E), Hirsuteine (H), and 1,2,15,16-Tetrahydrotanshinone (T).

[0047] Meanwhile, TPS (Tropisetron), which has been reported as an HTR3A antagonist, was used as a positive control for analysis and comparison, and their respective structures are as follows:

[0048]

[0049] The results show that compared with 5-HT (-7.2 kcal / mol), the binding energies of four compounds D, E, H, and T are lower, which means they may have stronger affinity with HTR3A. And their affinity order is T > D > H > E. Compared with TPS (-10.2 kcal / mol), the affinity of T is stronger, and the affinity of D is close to that of TPS.

[0050] Example 2

[0051] Cytotoxicity of the screened HTR3A antagonistic ability:

[0052] To verify its effect at the cellular level, the present invention uses the rosacea model of THP-1 cells for research.

[0053] Therefore, first, the cytotoxicity of the screened HTR3A antagonists is measured. The specific method is as follows:

[0054] 1) Cell culture: THP-1 cells (SCSP-567) are purchased from the Cell Bank of the Chinese Academy of Sciences and cultured in RPMI 1640 medium (Gibco, USA) containing 10% fetal bovine serum (New Zerum, New Zealand) and 1% antibiotics (Gibco, USA);

[0055] The THP-1 cells are inoculated into 60-mm culture dishes at a density of 6×10 5 cells / mL; meanwhile, phorbol 12-myristate 13-acetate (PMA, Sigma Aldrich, USA) with a final concentration of 100 ng / mL is added to the culture dishes, and they are incubated for 24 hours to differentiate into macrophages;

[0056] Before any treatment, the THP-1 cells are allowed to stand in RPMI 1640 medium for 24 hours.

[0057] 2) Measurement of cytotoxicity: T (M.W. 280.31), H (M.W. 329.43), D (M.W. 366.46), and E (M.W. 324.42) are respectively dissolved in 100 μL of DMSO according to their molecular weights, and then 900 μL of RPMI 1640 (serum-free) is added to make a 1000 μM stock solution, and then diluted to the corresponding experimental concentrations with RPMI 1640 (serum-free). The above cells are seeded at 5×10 4Cells were inoculated at a density of 100 μL in a 96-well plate and incubated with drugs at various concentrations for 24 h. The cell viability of THP-1 macrophages was detected using a CCK-8 assay kit (Beyotime) according to the manufacturer's instructions.

[0058] The results Figure 1 showed that T had no cytotoxicity at concentrations below 1.56 μM, H at concentrations below 50 μM, D at concentrations below 300 μM, and E at concentrations below 150 μM.

[0059] Example 3

[0060] Screening the effect of the compound on the mRNA expression of HTR3A:

[0061] In order to prove the competitive antagonism of HTR3A in the present invention, a previously reported LL-37-induced THP-1 rosacea cell model was modified and verified at the mRNA level.

[0062] Cell treatment: Cells cultured and samples prepared according to the method in 1) of Example 2 were pretreated with 300 μM of D, 150 μM of E, 50 μM of H, and 1.56 μM of T for 1 h, and co-stimulated with 4 μM of LL-37 and 400 μM of 5-HT (L5) for 24 h.

[0063] Then, TRIzol method was used to extract mRNA from the above cultured cells. The A260 / A280 value of the extracted mRNA was measured using a nucleic acid and protein content detector, and the extraction quality of mRNA was detected by 1% formaldehyde denaturing gel electrophoresis.

[0064] GAPDH was selected as the internal reference gene. The primer sequences designed based on the sequence of the human HTR3A gene were forward primer 5'-3': TGCCAGAAAAGGTGAAATCC, and reverse primer 5'-3': AGGGCACCACATCACCACAA.

[0065] The extracted mRNA samples, random primers, RT mix (reverse transcription mixture), dNTP mixture, and diethyl pyrocarbonate (DEPC) water were prepared according to the reverse transcription reaction system.

[0066] The specific reaction procedure was:

[0067] Reverse transcription at 37 °C for 60 min, followed by heating at 90 °C for 5 min to inactivate the reverse transcriptase, thus completing the reverse transcription synthesis of cDNA.

[0068] Place 2×QuantiNova SYBR Green PCR Master Mix, 10×miScript Nucleics Mix universal primer, template cDNA, and RNase-Free water on ice, and gently mix to prepare the PCR reaction system;

[0069] Set the reaction program of the Bio-Rad fluorescence quantitative PCR instrument as follows: pre-denature at 95°C for 2 min, for 1 cycle; denature at 95°C for 5 s, anneal and extend at 60°C for 10 s, for 40 cycles;

[0070] Using GAPDH as an internal reference, calculate the relative expression of the target gene mRNA by the 2-△△Ct method.

[0071] The experimental results are shown in Figure 2 , and it can be seen from the figure that after stimulating the samples with L5, compared with the normal group, the expression of the HTR3A gene in the samples was significantly increased, indicating that the rosacea model was successfully constructed. Further comparison of each experimental group with the model group found that the effects of sample groups E and H on reducing the expression of the HTR3A gene were not obvious; while sample groups D and T significantly decreased the expression of the HTR3A gene, indicating that samples D and T have a reverse regulatory effect on the expression of the HTR3A gene.

[0072] Example 4

[0073] Verification of immunofluorescence staining for screening compounds D and T:

[0074] To verify the binding efficacy of the drug to HTR3A, the present invention uses the method of immunofluorescence staining for verification.

[0075] Treatment of cells, administer drugs according to the method of Example 3 , That is, administer drugs at D: 300 μM, T: 1.56 μM, and establish its model. Then, fix the cell samples with 4% paraformaldehyde for 15 minutes;

[0076] Block with 5% bovine serum albumin (BSA, Beyotime, China) for 1 hour;

[0077] Then, incubate anti-5-hydroxytryptamine (5-HT), anti-HTR3A, and anti-p65 antibodies (Thermo Fisher Scientific (Invitrogen), USA) overnight at 4°C; the next day, incubate the secondary antibodies labeled with Alexa Fluor 488 and Cy3 (Beyotime, China) for 1 hour, and counterstain with 4',6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific (Invitrogen), USA) for 10 minutes;

[0078] Immunofluorescence staining of HTR3A (green) and 5-HT (red) in THP-1 macrophages (scale bar: 25 μm);

[0079] The results are as Figure 3 shown. When comparing the blank group without 5-HT addition with the model group (L5), the binding phenomenon of 5-HT on the cell surface of the model group was observed. Compared with the model group, the red fluorescence intensity in the D administration group and the T administration group was weaker, and no red fluorescence was seen in some cells (indicated by white arrows), but the cell nuclei (stained blue with DAPI) were clearly visible. This indicates that D and T have a certain competitive inhibitory ability on the binding of HTR3A and 5-HT, and this experimental result corroborates the result of molecular docking (Example 1).

[0080] When comparing D and T, the green fluorescence intensity of T was weaker than that of D, which indicates that the expression level of HTR3A in the sample treated with T was lower than that in the sample treated with D. This result corroborates the conclusion of Example 3. However, in terms of the surface red fluorescence intensity, T was greater than D, which means that T was more involved in the expression process of HTR3A.

[0081] Example 5

[0082] Screening of compounds D and T for inflammation-related factors in the rosacea model:

[0083] To further verify their regulatory effects on inflammation-related factors in the rosacea cell model, the method in Example 3 was used to collect the supernatant of cell samples, which was centrifuged and then used for enzyme-linked immunosorbent assay (ELISA);

[0084] The ELISA kits for detecting human interleukin 1β (IL-1β), interleukin 8 (IL-8), tumor necrosis factor α (TNF-α), and vascular endothelial growth factor (VEGF) were purchased from SignalwayAntibody (SAB) Company in the United States and were operated according to the manufacturer's instructions;

[0085] The results are as Figure 4 shown. The significant differences when comparing the model group with the sample group were indicated by *(p < 0.05), (p < 0.01), *(p < 0.001); the significant difference when comparing the model group with the blank group was indicated by (p < 0.001).

[0086] Compared with the model group (L5), both compounds D and T could significantly down-regulate the protein levels of IL-1β and TNF-α, and the effect of D was better than that of T. However, in terms of the effect on the protein levels of IL-8 and VEGF, only compound D showed a significant down-regulating effect.

[0087] Example 6

[0088] Determination of inflammation-related factors by screening compounds and their combinations in a rosacea model:

[0089] In Example 5, in view of the fact that the effect of the compound on the protein levels of IL-8 and VEGF did not reach the expected ideal effect, a compounding scheme was adopted to solve this problem.

[0090] Specifically, D and T were compounded in different ratios, and the molar ratios were D:T = 4:0, 3:1, 2:2, 1:3, 0:4, and the corresponding concentrations were 300:0, 225:0.39, 150:0.78, 100:1.17, 0:1.56 μM.

[0091] The experimental results are as Figure 5 shown. When D:T = 2:2, the inhibitory activity against IL-8 is the best. At this ratio, the two act synergistically, can reduce the expression of IL-8 to the greatest extent, and effectively inhibit the related inflammatory response. The ratios of 1:3 and 3:1 are slightly inferior in inhibiting the activity of IL-8, but also show good effects. In terms of the inhibitory activity against VEGF, the best effect is achieved when D:T = 1:3. The synergistic effect of D and T at this ratio makes the inhibition of VEGF the strongest. At the same time, the ratios of 4:0, 3:1 and 2:2 also show good inhibitory effects, and the combinations of D and T play a synergistic role in inhibiting the activity of VEGF.

[0092] In view of the current treatment difficulties of rosacea, especially neurogenic rosacea, the inventor screened and obtained a natural HTR3A antagonist of plant origin. This antagonist can effectively relieve and treat rosacea, especially has a significant curative effect on neurogenic rosacea. As a natural product, it not only has the remarkable advantages of being renewable, degradable and having high safety, but also shows extremely strong specificity and has unique value in the treatment field.

[0093] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not restrictive. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered within the scope of the present invention.

Claims

1. A plant-derived HTR3A antagonist, characterized in that: The antagonist comprises one or more of the compounds 2,7-Dihydrohomoerysotrine (D) and 1,2,15,16-Tetrahydrotanshinone (T) screened from plant sources; The structural formula of the compound 2,7-Dihydrohomoerysotrine (D) is: The structural formula of the compound 1,2,15,16-Tetrahydrotanshinone (T) is:

2. The plant-derived HTR3A antagonist according to claim 1, wherein: The molar ratio of the compound 2,7-Dihydrohomoerysotrine (D) to the compound 1,2,15,16-Tetrahydrotanshinone (T) is 1-2:2-3.

3. The plant-derived HTR3A antagonist according to claim 2, wherein: The molar ratio of the compound 2,7-Dihydrohomoerysotrine (D) to the compound 1,2,15,16-Tetrahydrotanshinone (T) is 1:

3.

4. The plant-derived HTR3A antagonist according to claim 2, wherein: The molar ratio of the compound 2,7-Dihydrohomoerysotrine (D) to the compound 1,2,15,16-Tetrahydrotanshinone (T) is 2:

2.

5. Use of the plant-derived HTR3A antagonist according to any one of claims 1 to 4 in the preparation of a medicament for treating rosacea.

6. The application according to claim 5, wherein: The rosacea includes neurogenic rosacea.

7. The application according to claim 5, characterized in that: The antagonist reversely regulates the expression of the HTR3A gene at the mRNA level, wherein the compounds D and T significantly decrease the expression of the HTR3A gene.

8. The application according to claim 5, wherein: The compounds D and T in the antagonist have a competitive inhibitory ability for the binding of HTR3A and 5-HT, and regulate the inflammatory factors related to rosacea.

9. The application according to claim 5, wherein: Both the compounds D and T in the antagonist significantly down-regulate the protein levels of IL-1β and TNF-α, and the compound D significantly down-regulates the protein levels of IL-8 and VEGF.

10. A pharmaceutical composition for treating rosacea, characterized in that: Comprising the plant-derived HTR3A antagonist according to claim 1 and a pharmaceutically acceptable carrier, diluent or excipient.

Images