Plasmid, haemophilus parasuis surface display vector and construction method and application thereof

Abstract

The invention belongs to the field of biology, and discloses a plasmid which contains a haemophilus parasuis Omp Am outer membrane protein gene and a mycoplasma hyopneumoniae membrane protein gene. The mycoplasma hyopneumoniae membrane protein gene is one or a combination of more of a mycoplasma hyopneumoniae membrane protein P46 gene, a mycoplasma hyopneumoniae membrane protein P65 gene and a mycoplasma hyopneumoniae membrane protein P159 gene. The plasmid contains an Omp Am outer membrane protein gene and a mycoplasma hyopneumoniae membrane protein gene, recombinant haemophilus parasuis is prepared from a target gene amplified from the vector through a primer in a natural transformation mode, one or more of Mhp antigen proteins such as P46 protein, P65 protein and P159 protein can be effectively expressed, and the effect of double immunization is achieved. Meanwhile, the invention also provides recombinant haemophilus parasuis and application thereof.

Description

Technical Field

[0001] The present invention relates to the field of biology, and particularly to a plasmid, a Haemophilus parasuis surface display vector, and a construction method and application thereof. Background Art

[0002] The infection of Haemophilus parasuis is widespread globally. Generally, pigs from week-old to month-old are most susceptible. The main pathological changes include multiple polyserositis, arthritis, meningitis, acute pneumonia without polyserositis, and acute septicemia. The endotoxin of Haemophilus parasuis can cause disseminated intravascular coagulation and microthrombi in multiple tissues. The use of a large amount of antibiotics for treatment after infection with this bacterium and death due to unsuccessful treatment have brought huge economic losses to the vast number of pig farmers. After the outbreak of Haemophilus parasuis infection in pig herds and healthy pig herds, it will cause a high incidence and mortality. When infecting ordinary pig herds, it will cause respiratory diseases.

[0003] In 1980, Movva et al. first determined the amino acid sequence of the Omp A signal peptide, which contains 21 amino acid residues and guides Omp A to be secreted into the outer membrane in a Sec B-dependent post-translational transport manner.

[0004] Outer membrane protein (Omp) is one of the possible virulence factors of Haemophilus parasuis. Among them, outer membrane protein Omp A is a major adhesion protein of this bacterium, which is related to bacterial colonization. It is one of the main outer membrane proteins of Haemophilus parasuis. The polyclonal antiserum prepared with it has cross-reactivity with the antigens of HPS strains of each serotype and is a possible protective antigen.

[0005] Mycoplasmal pneumonia of swine (MPS) is a chronic contagious respiratory disease caused by Mycoplasma hyopneumoniae (Mhp). In clinical practice, it is often mixed-infected with other pathogens. Mycoplasma hyopneumoniae membrane proteins P46, P65, and P159 proteins are the main immunodominant proteins on the surface of Mhp, which have a high species specificity and are often used as target proteins for detecting Mycoplasma hyopneumoniae in research. During the late stage of mycoplasma infection, Haemophilus parasuis, as a common bacterium in pig farms, invades the lungs for secondary infection due to damaged cilia and weak immune ability of the body, resulting in severe secondary infection. When the two diseases are mixed-infected, the effects of conventional drugs are not good, and ultimately the death of diseased pigs is aggravated.

[0006] For the relevant literature on the double or multiple vaccines for Mycoplasmal pneumonia of swine and Haemophilus parasuis, the following information can be referred to:

[0007] CN119303069A, Porcine circovirus, Mycoplasma hyopneumoniae, Haemophilus parasuis triple vaccine;

[0008] CN104208667A, A method for preparing a triple inactivated vaccine;

[0009] CN103083655A, A vaccine composition for preventing and treating infections caused by porcine circovirus type 2, Haemophilus parasuis and Mycoplasma hyopneumoniae and a preparation method thereof;

[0010] The above-mentioned solutions all adopt the method of multi-valent inactivated vaccines for epidemic prevention.

[0011] From the existing research, the prevention and treatment of Mycoplasma hyopneumoniae and Haemophilus parasuis only stop at the level of multi-valent vaccines. Summary of the Invention

[0012] The object of the present invention is to provide a plasmid, which contains the Omp Am outer membrane protein gene of Haemophilus parasuis and the membrane protein gene of Mycoplasma hyopneumoniae. The target gene amplified from this vector by primers is then used to prepare recombinant Haemophilus parasuis by natural transformation, which can effectively express one or more of the Mhp antigen proteins such as P46 protein, P65 protein, and P159 protein, achieving the effect of dual immunization.

[0013] Meanwhile, the present invention also provides recombinant Haemophilus parasuis and its application.

[0014] The specific solution of the present invention is as follows:

[0015] A plasmid, the plasmid contains the Omp Am outer membrane protein gene of Haemophilus parasuis and the membrane protein gene of Mycoplasma hyopneumoniae; the membrane protein gene of Mycoplasma hyopneumoniae is one or more combinations of the Mycoplasma hyopneumoniae membrane protein P46 gene, the Mycoplasma hyopneumoniae membrane protein P65 gene, and the Mycoplasma hyopneumoniae membrane protein P159 gene.

[0016] In the above plasmid, the nucleotides of the plasmid are as shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.

[0017] Meanwhile, the present invention also discloses a method for constructing a surface display vector of Haemophilus parasuis. The method is to perform natural transformation on the target gene and Haemophilus parasuis to obtain a recombinant strain of Haemophilus parasuis capable of expressing Mhp antigen protein; the preparation method of the target gene is: amplifying the target gene from the plasmid as described in claim 1 by using primers, and the target gene contains the Omp Am outer membrane protein gene of Haemophilus parasuis and the membrane protein gene of Mycoplasma hyopneumoniae; the upstream primer in the primers contains a USS sequence;

[0018] In the above method for constructing a Haemophilus parasuis surface display vector, the sequences of the primers are as shown in SEQ ID NO.5 and SEQ ID NO.6.

[0019] In addition, the present invention also discloses a Haemophilus parasuis surface display vector prepared by the method described above.

[0020] Meanwhile, the use of the Haemophilus parasuis surface display vector described above for preparing a vaccine is also disclosed.

[0021] Finally, the present invention also discloses a vaccine containing an inactivated Haemophilus parasuis surface display vector described above.

[0022] The beneficial effects of this application are as follows:

[0023] The plasmid of the present invention contains the outer membrane protein gene of Haemophilus parasuis Omp Am and the membrane protein gene of Mycoplasma hyopneumoniae. The target gene amplified from this vector by primers is then used to prepare recombinant Haemophilus parasuis by natural transformation, which can effectively express one or more Mhp antigen proteins such as P46 protein, P65 protein, and P159 protein, achieving the effect of dual immunization. Description of the Drawings

[0024] Figure 1 Electrophoresis result diagram of pET-28a(+)-p97-46-65-DH5α Escherichia coli;

[0025] Figure 2 Electrophoresis result diagram of pET-28a(+)-p159-DH5α Escherichia coli;

[0026] Figure 3 Staining diagram of protein rP97-46-65;

[0027] Figure 4 Staining diagram of protein rP159;

[0028] Figure 5 Detection principle diagram of indirect ELISA;

[0029] Figure 6 Non-Reducing SDS-PAGE electrophoresis diagram of the antibody after purification of rP97-46-65;

[0030] Figure 7 Non-Reducing SDS-PAGE electrophoresis diagram of the antibody after purification of rP159;

[0031] Figure 8 Electrophoresis diagram of the gene fragment of Omp Am outer membrane protein, with a length of 1929bp;

[0032] Figure 9 Electrophoretogram of the gene fragment of ompAm-P159, with a length of 2679 bp;

[0033] Figure 10 Electrophoretogram of the gene fragment of ompAm-P65, with a length of 2436 bp;

[0034] Figure 11 Electrophoretogram of the gene fragment of ompAm-P46, with a length of 2238 bp;

[0035] Figure 12 Electrophoretogram of the gene fragment of pDL02-ompAm, with a length of 2315 bp;

[0036] Figure 13 Electrophoretogram of the gene fragment of pDL02-ompAm-P159, with a length of 3071 bp;

[0037] Figure 14 Electrophoretogram of the gene fragment of pDL02-ompAm-P65, with a length of 2822 bp;

[0038] Figure 15 Electrophoretogram of the gene fragment of pDL02-ompAm-P46, with a length of 2624 bp;

[0039] Figure 16 Developed band diagram of Sc096-ompAm;

[0040] Figure 17 Developed band diagram of Sc096-ompAm-159;

[0041] Figure 18 Developed band diagram of Sc096-ompAm-159;

[0042] Figure 19 Developed band diagram of Sc096-ompAm-65;

[0043] Figure 20 Developed band diagram of Sc096-ompAm-46;

[0044] Figure 21 Developed band diagram of Sc096-ompAm-46 and Sc096-ompAm-65;

[0045] Figure 22 Chart of the detection results of the reactivity of immune serum with wild strain proteins;

[0046] Figure 23 Chart of the detection results of the total IgG level against rP159 antigen;

[0047] Figure 24 It is a chart of the test results for the total IgG level against the rP46 antigen;

[0048] Figure 25 It is a chart of the test results for the total IgG level against the rP65 antigen;

[0049] Figure 26 It is a chart of the test results for the total IgG level against the sc096 antigen;

[0050] Figure 27 It is a chart of the test results for the total IgG level against the sc096-ompA antigen. Detailed implementation manners

[0051] Next, in combination with the embodiments of the present invention, the present invention will be clearly and completely described. In the description of the present invention, it should be noted that for those not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For the reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained through commercial purchase.

[0052] The main research content of the present invention is divided into two parts. The first part is the preparation of mycoplasma protein polyclonal antibodies; the second part is the preparation and application of the Haemophilus parasuis surface display vector of the present invention.

[0053] The first part: Preparation of mycoplasma protein polyclonal antibodies

[0054] 1. Construction and verification of prokaryotic protein expression plasmids

[0055] 1.1 First, entrust Sangon to gene-synthesize the sequences of pET28a(+) mycoplasma protein-related plasmids;

[0056] The pET28a(+) mycoplasma protein-related plasmids include plasmid pET-28a(+)-p97-46-65 (SEQ ID NO.7) and plasmid pET-28a(+)-p159 (SEQ ID NO.8);

[0057] 1.2 Transformation: Take out two tubes of competent DH5α E. coli from -80°C, place them on ice. After 5 minutes, add 10 μL of plasmid pET-28a(+)-p97-46-65 and plasmid pET-28a(+)-p159. After reacting on ice for 25 minutes, perform heat shock for 45 seconds, quickly insert it back on ice, and after standing for 3 minutes, add 100 μL of antibiotic-free LB liquid culture medium respectively, and culture at 37°C and 200 r / min on a shaker for 1 hour;

[0058] 1.3 Sequencing identification: Spread 100 μL of the bacterial solution on a kanamycin LB agar plate. After the bacteria grew, pick single colonies of Escherichia coli pET-28a(+)-p97-46-65-DH5α and Escherichia coli pET-28a(+)-p159-DH5α for detection results;

[0059] The size of the target band is approximately 1452 bp ( Figure 1 ) and 993 bp ( Figure 2 ), indicating the presence of the target bands p97-46-65 and p159 in the plasmids pET-28a(+)-p97-46-65-DH5α and pET-28a(+)-p159-DH5α. Sequencing was performed on the bacterial solution corresponding to the positive bands;

[0060] Detection was carried out using the following primers P1 and P2

[0061] P1 TAATACGACTCACTATAGGG (SEQ ID NO.9)

[0062] P2 TGCTAGTTATTGCTCAGCGG (SEQ ID NO.10);

[0063] Figure 1 is the electrophoresis result diagram of Escherichia coli pET-28a(+)-p97-46-65-DH5α;

[0064] Figure 2 is the electrophoresis result diagram of Escherichia coli pET-28a(+)-p159-DH5α;

[0065] 1.4 Plasmid extraction and preservation: For the bacterial solution with correct sequencing results, perform an enlarged culture. Use a plasmid extraction kit to extract plasmids pET-28a(+)-p97-46-65-DH5α and pET-28a(+)-p159-DH5α, store them at -20 °C, and store the bacterial solution in LB liquid medium containing 15 - 20% glycerol at -80 °C.

[0066] 1.5 Re - transformation: Take out two tubes of competent BL21 E.coli from -80 °C, place them on ice. After 5 min, add 10 μL of the plasmids pET-28a(+)-p97-46-65-DH5α and pET-28a(+)-p159-DH5α in Section 1.4 above. After reacting on ice for 25 min, perform heat shock for 45 s, quickly insert it back on ice. After standing for 3 min, add 100 μL of antibiotic - free LB liquid culture medium respectively, and culture at 37 °C and 200 r / min on a shaker for 1 h;

[0067] 1.6 Sequencing identification: Spread 100 μL of the bacterial solution on a kanamycin LB agar plate. After the bacteria grew, pick single colonies of pET-28a(+)-p97-46-65-BL21 Escherichia coli and pET-28a(+)-p159-BL21 Escherichia coli. The size of the target bands detected was approximately 1452 bp and 993 bp, indicating the presence of the target bands p97-46-65 and p159 in the pET-28a(+)-p97-46-65-BL21 plasmid and the pET-28a(+)-p159-BL21 plasmid. Sequence the bacterial solution corresponding to the positive bands;

[0068] The detection primers are the same as P1 and P2;

[0069] 1.7 Plasmid extraction and preservation: For the bacterial solution with correct sequencing results, perform enlarged culture and store the bacterial solution in LB liquid medium containing 15 - 20% glycerol at -80 °C.

[0070] 2. Induced expression and purification of recombinant proteins

[0071] 2.1 Inoculate the above-obtained pET-28a(+)-p97-46-65-BL21 and pET-28a(+)-p159-BL21 bacterial solutions into 10 ml of liquid LB medium at a volume ratio of 1:100 respectively, add Km antibiotic at a ratio of 1:1000, and shake the bacteria overnight at 37 °C and 220 rpm;

[0072] 2.2 Transfer the two 10 mL bacterial solutions cultured overnight to 1 L of liquid LB medium containing 100 mg of Km antibiotic respectively, culture at 37 °C and 220 rpm for 3 - 4 h until the OD600 of the bacterial solution is 0.5, then add 1 mol / L IPTG to a final concentration of 0.5 mmol / L, and induce at low temperature at 16 °C and 220 rpm for 12 h;

[0073] 2.3 Collect the four induced bacterial cells using 500 ml centrifuge cups respectively, centrifuge at 4000 rpm for 40 min, and discard the supernatant to retain the bacterial cells;

[0074] 2.4 Resuspend and wash each type of bacterial cell with 30 ml of PBS solution, centrifuge at 1200 rpm at 4 °C for 15 min, and discard the supernatant to retain the bacterial cells;

[0075] 2.5 Resuspend each type of bacterial cell with 30 ml of purification washing solution, perform ice bath ultrasonic disruption, with an ultrasonic frequency of 40%, ultrasonic for 3 s, pause for 5 s, and ultrasonic for 20 min;

[0076] 2.6 Centrifuge at 12000 rpm at 4 °C for 15 min, collect the supernatant, filter it through a 0.45 μm filter membrane and store it at 4 °C;

[0077] 2.7 Pretreatment of nickel column: Let the preservation solution in the nickel column flow down, add ddH2O to wash the nickel column and then let it flow down, add purification washing solution to balance the nickel column, and drain the washing solution;

[0078] 2.8 Add the filtered protein supernatant to the balanced nickel column, place it on a shaker and bind at ice bath for 2 h to allow the target protein to bind to the nickel column packing, and discard the solution;

[0079] 2.9 Wash 4 times with purification washing solution, 5 min each time, to remove miscellaneous proteins;

[0080] 2.10 Elute 4 times with purification elution solution, 10 min each time, to elute the target protein;

[0081] The proteins are named rP97-46-65 and rP159.

[0082] 3. SDS-PAGE identification of recombinant proteins

[0083] Prepare a 12% SDS-PAGE gel, perform SDS-PAGE gel electrophoresis on the protein sample obtained after purification in Section 2.10 above. Electrophorese at 80 V for 30 min, and then change to 120 V after the sample runs out of the stacking gel and continue electrophoresis. After electrophoresis, separate the protein gel from the glass plate, discard the stacking gel, stain the separating gel with Coomassie Brilliant Blue staining solution, stain on a shaker for 2 h, and then decolorize 3 times with decolorizing solution, 30 min each time until the background color of Coomassie Brilliant Blue is removed. Place it on a film viewing lamp to observe and take pictures.

[0084] Figure 3 It is the staining diagram of protein rP97-46-65;

[0085] Figure 4 It is the staining diagram of protein rP159;

[0086] 4. Preparation of polyclonal antibodies against recombinant proteins

[0087] 4.1 Animal immunization

[0088] Immunize 2 New Zealand white rabbits with rP97-46-65 and rP159 respectively. The immunization dose for each rabbit is 500 μg. For the first immunization, make an emulsifier by mixing the immunogen with an equal volume of complete Freund's adjuvant and inject it subcutaneously at multiple points on the back. After 2 weeks, take the same dose of immunogen and mix it with an equal volume of incomplete Freund's adjuvant to make an emulsifier, and take blood one week after the fourth immunization. Measure the serum titer by ELISA, and collect blood from the rabbit with a high serum titer for purification to prepare rabbit polyclonal antibody; for rabbits with unqualified serum titer, after an additional immunization, measure the serum titer by ELISA, and collect blood from the rabbit with a qualified serum titer for purification to prepare rabbit polyclonal antibody.

[0089] 4.2 Serum collection

[0090] One week after the last immunization, 3 - 4 mL of blood was collected from the marginal ear vein of the rabbit. After standing overnight at 4°C, it was centrifuged at 4000 rpm for 15 min at 4°C, and the upper - layer serum was separated for inspection.

[0091] 4.3 ELISA titer detection

[0092] The indirect ELISA method was used for serum titer detection, that is, to detect the binding of antiserum and antigen. The standard for qualified titer was (absorbance value of antiserum - absorbance value of blank) / (absorbance value of pre - immune negative control serum - absorbance value of blank)>2.1, and it could be used for serum purification to prepare rabbit polyclonal antibody.

[0093] The detection principle is as Figure 5 shown; Figure 5 Schematic diagram of the detection principle of indirect ELISA;

[0094] The detection steps are as follows.

[0095] (1) Coating: Take an appropriate amount of protein for detection, dissolve and dilute it with coating buffer to 0.1 μg / mL, 1 μg / mL, 5 μg / mL respectively, and then add 100 μL to each well of the 96 - well plate with a single - channel pipette. Tap the plate gently to mix the samples, seal it tightly with plastic wrap, and coat it overnight at 4°C; (2) Plate washing: Wash the plate once with 300 μL / well of washing solution, and drain the enzyme - labeled plate; (3) Blocking: Block the enzyme - labeled plate with 300 μL / well of blocking solution at room temperature for 1 h; (4) Plate washing: Wash the plate twice with 300 μL / well of washing solution, and drain the enzyme - labeled plate; (5) Sample addition: Add the serially diluted serum samples and sample diluent at 100 μL / well; (6) Secondary antibody addition: Add the detection antibody, add 100 μL / well to the 96 - well plate, and incubate together at room temperature for 2 h; (7) Plate washing: Then wash the plate five times with 300 μL / well of washing solution, and drain the enzyme - labeled plate; (8) Color development: Add 200 μL / well of color - developing solution and place it at room temperature for 12 min; (9) Termination and detection: Add 50 μL / well of termination solution to terminate the reaction, and then detect it with an enzyme - labeled instrument at a measurement wavelength of 450 nm.

[0096] 5. Polyclonal antibody purification

[0097] 5.1 Sample preparation

[0098] The collected rabbit blood was centrifuged using a table - top centrifuge under the conditions of 4200 r, 4°C for 30 min, and the centrifuged serum was collected; the centrifuged serum was filtered through a 0.45 μM filter membrane for standby.

[0099] 5.2 Antibody purification

[0100] The rabbit serum was purified successively by protein A affinity purification and antigen affinity purification to harvest rabbit polyclonal antibody. The operation steps are as follows.

[0101] 5.3 Protein A affinity purification, the steps are as follows:

[0102] (1) Water balance: Wash with ultrapure water for 3 CV to replace the 25% ethanol storage solution; (2) Equilibrate the chromatography column: Equilibrate with 1X AC Binding for 5 - 10 CV; (3) Load the sample: Load the centrifuged and filtered serum; (4) Wash: Wash with the wash solution for 5 - 10 CV; (5) Elute: Elute with 1X AC Elution; (6) Neutralize: Add 2M Tris, pH 8.0 to neutralize the eluted antibody; (7) Equilibrate: Equilibrate with AC Binding for 3 CV to neutral; (8) CIP cleaning: Clean with CIP for more than 5 CV; (9) Rinse with alkali: Wash with ultrapure water for 5 CV; (10) Storage: Equilibrate with 25% ethanol for 2 CV to store the column.

[0103] 5.4 Antigen affinity purification, the steps are as follows:

[0104] (1) Water balance: Wash with ultrapure water for 3 CV to replace the 25% ethanol storage solution; (2) Equilibrate the chromatography column: Equilibrate with 1X AC Binding for 5 - 10 CV; (3) Load the sample: Load the elution peak purified by Protein A; (4) Wash: Wash with the wash solution for 5 - 10 CV; (5) Elute: Elute with 1X AC Elution; (6) Neutralize: Add 2M Tris, pH 8.0 to neutralize the eluted antibody; (7) Equilibrate: Equilibrate with AC Binding for 5 - 10 CV to neutral; (8) Wash with water: Wash with ultrapure water for 5 - 10 CV; (9) Storage: Equilibrate with 25% ethanol for 2 CV to store the column.

[0105] 5.5 Antibody identification

[0106] 5.5.1 Antibody concentration and purity detection

[0107] Start the micro - spectrophotometer, spot with the buffer corresponding to the test sample. When the absorbance value is between ±0.015 at a wavelength of 280 nm, it indicates that the instrument baseline is stable. Spot the purified antibody sample in sequence, record the absorbance value, and divide the detected data by the IgG extinction coefficient (1.414). The obtained value is the concentration of the test sample (unit: mg / mL).

[0108] The purity of the purified antibody was verified by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). According to the different molecular weights of proteins in the test samples, this method separates them in the electrophoresis gel, thereby verifying the purity of the target antibody. Take 5 μg of the test sample, add 5 μL of 4R / 4N, heat in a water bath at 100 °C, and then centrifuge at 10,000 rpm. Add sufficient 1× SDS electrode buffer to the electrophoresis tank, and use a micropipette to add the processed sample solution and protein molecular weight standard to the sample wells. Connect the power supply, first electrophorese at a constant voltage of 100 V until the bromophenol blue dye enters the separating gel from the stacking gel, then adjust the current to 140 V and continue electrophoresis until the bottom of the gel plate, and then turn off the power supply. Immerse the gel in the staining solution, heat it in a microwave oven for 60 s, and stain it at room temperature on a gently shaking platform. Replace the decolorizing solution to cover the gel, heat it in a microwave oven for 60 s, and decolorize it at room temperature on a gently shaking platform. Repeat the decolorization operation until blue bands and a clean background are obtained.

[0109] 5.5.2 ELISA Binding Detection

[0110] The indirect ELISA method was used to detect the binding of the purified rabbit polyclonal antibody to the antigen. The detection principle refers to the figure above, and the detection process is as follows.

[0111] (1) Coating: The concentration of the coated antigen protein is 0.1 μg / mL, 1 μg / mL, 100 μL / well, and coat overnight at 4 °C; (2) Blocking: Drain and pat dry the liquid in the plate, add 2% BSA, 300 μL / well, incubate at room temperature for 1 h after sealing; (3) Washing the plate: 300 μL / well of washing solution, wash the plate 2 times, and pat dry for the last time; (4) Antibody dilution and sample addition: Dilute the antibody to 0.1 μg / mL, add 100 μL each to the corresponding well plates, mix well, and react at room temperature for 2 h; (5) Washing the plate: 300 μL / well of washing solution, wash the plate 3 times, and pat dry for the last time; (6) Secondary antibody incubation: Dilute the Goat Anti-Rabbit IgG Fc / HRP secondary antibody to the working concentration, 100 μL / well, mix well, and incubate at room temperature for 1 h; (7) Washing the plate: 300 μL / well of washing solution, wash the plate 3 times, and pat dry for the last time; (8) Color development: Mix solution A and solution B at a ratio of 1:1, add 200 μL to each well, and incubate at room temperature in the dark for 20 min; (9) Termination and detection: Add 50 μL of termination solution to each well, and immediately measure the OD value at a wavelength of 450 nm.

[0112] The results are referred to Table 1 and Table 2;

[0113] Table 1 ELISA Detection Results of Serum after Four Immunizations (rP159)

[0114]

[0115] Table 2 Serum ELISA test results after four immunizations (rP97-46-65)

[0116]

[0117]

[0118] Figure 6 It is the Non-Reducing SDS-PAGE electrophoresis pattern of the antibody after rP97-46-65 purification;

[0119] Figure 7 It is the Non-Reducing SDS-PAGE electrophoresis pattern of the antibody after rP159 purification.

[0120] The second part Preparation and application of the Haemophilus parasuis surface display vector of the present invention

[0121] 1. First, entrust Sangon to synthesize the following plasmids:

[0122] pDL02-ompAm (SEQ ID NO.1)

[0123] pDL02-ompAm-P159 (SEQ ID NO.2)

[0124] pDL02-ompAm-P65 (SEQ ID NO.3)

[0125] pDL02-ompAm-P46 (SEQ ID NO.4)

[0126] 2. Natural transformation

[0127] TSB medium: Add 15 g of Tryptone, 5 g of Peptones soybean, and 5 g of NaCl to 1 L of deionized water, adjust the pH to neutral, set the autoclave at 121 °C, after steam sterilization, store it in a 4 °C refrigerator.

[0128] TSA medium: Add 40 g of Tryptone SOYA AGAR and 3 g of YEAST EXTRACT to 1 L of deionized water, set the autoclave at 121 °C, after steam sterilization, store it at room temperature.

[0129] Haemophilus parasuis strain SC096 (a series of gene deletion mutant strains of HPS serotype 4 SC096 strain, Zhang B, Feng S, et al. Serum resistance in Haemophilus parasuis SC096 strain requires outer membrane protein P2 expression. FEMS Microbiol Lett, 2012, 326:109–115. Zhang B, He Y, et al. Cytolethal distending toxin (CDT) of the Haemophilus parasuis SC096 strain contributes to serum resistance and adhesion to and invasion of PK-15 and PUVEC cells. Vet Microbiol, 2012, 157:237-242), from the National and Local Joint Engineering Laboratory of Zoonosis Control Agents, South China Agricultural University.

[0130] 2.1 Preparation of natural competence

[0131] Inoculate the activated Haemophilus parasuis strain SC096 into 5 ml of TSB medium, place it in a shaker at 37 °C and 220 rmp / min for culture. When the OD of the bacterial solution 600 is about 1.60, take 200 μL of the bacterial solution and spot it on the TSA medium to form an independent circular spot of about 100 mm, and culture it in a constant temperature incubator at 37 °C for 13 h. Resuspend it with TSB medium and adjust the bacterial concentration to 1 / 100 OD 600 to about 0.4.

[0132] 2.2 Natural transformation of fragments

[0133] 2.2.1 Amplify the Mycoplasma target gene fragments required for natural transformation with the synthesized plasmids pDL02-ompAm, pDL02-ompAm-P159, pDL02-ompAm-P46, and pDL02-ompAm-P65 using primers P3 and P4;

[0134] P3: atACCGCTTGTgATGAAAAAATC (SEQ ID NO.5)

[0135] P5: TGAACTTGGATTTCAACACGG (SEQ ID NO.6);

[0136] The amplification results are visible Figures 8 to 11 ;

[0137] Figure 8 It is the electrophoresis map of the gene fragment of Omp Am outer membrane protein, with a length of 1929 bp;

[0138] Figure 9 It is the electrophoresis map of the gene fragment of ompAm-P159 protein, with a length of 2679 bp;

[0139] Figure 10 It is the electrophoresis map of the gene fragment of ompAm-P65 protein, with a length of 2436 bp;

[0140] Figure 11 It is the electrophoresis map of the gene fragment of ompAm-P46 protein, with a length of 2238 bp;

[0141] 2.2.2 After determining that its size is correct by PCR, send it for the first-generation sequencing. After confirming no mutation, use a DNA gel extraction kit to recover and purify the target gene;

[0142] The PCR primers used in this step are:

[0143] P5: CGTTAATGGGATAATAAGCATATTCTTG

[0144] P6: CCTACAGGATTACGCTTCTGC;

[0145] Figure 12 It is the electrophoresis map of the gene fragment of pDL02-ompAm, with a length of 2315 bp;

[0146] Figure 13 It is the electrophoresis map of the gene fragment of pDL02-ompAm-P159, with a length of 3071 bp;

[0147] Figure 14 It is the electrophoresis map of the gene fragment of pDL02-ompAm-P65, with a length of 2822 bp;

[0148] Figure 15 It is the electrophoresis map of the gene fragment of pDL02-ompAm-P46, with a length of 2624 bp;

[0149] 2.2.3 Use a ultra-micro spectrophotometer to measure the concentration of the recovered product;

[0150] 2.2.4 Take 20 μL of the bacterial resuspension respectively, and add 2 μg of the ompAm, ompAm-P159, ompAm-P65, and ompAm-P46 fragments respectively. After mixing, let it stand at 37°C for 10 min. Spot the mixture onto the TSA medium to form a circular spot about 10 mm in diameter, and place it in a 37°C constant temperature incubator for cultivation. After culturing for 5 h, take it out, resuspend the bacteria with 100 μL of TSB medium, and spread the bacterial suspension onto the TSA medium containing GM resistance.

[0151] 2.2.5 Place the plate in a 37°C constant temperature incubator until the liquid is completely absorbed, invert the plate, and observe the results after culturing for 24 - 48 h;

[0152] 2.2.6 After the bacteria grow, pick a single colony for bacterial liquid PCR, and sequence the bacterial liquid corresponding to the positive band; detect it with the above-mentioned P3 and P4 primers;

[0153] 2.2.7 After the sequencing results are verified to be correct, obtain the pDL02-sc096-ompAm, pDL02-sc096-ompAm-P159, pDL02-sc096-ompAm-P65, and pDL02-sc096-ompAm-P46 strains, and at the same time, perform large-scale cultivation and freeze-dry and store the bacteria in an -80°C refrigerator.

[0154] 3. Recombinant identification of surface vector-displayed proteins

[0155] The following are the WB results of the pDL02-sc096-ompAm, pDL02-sc096-ompAm-P159, pDL02-sc096-ompAm-P65, and pDL02-sc096-ompAm-P46 strains;

[0156] The method for WB testing is as follows:

[0157] (1) Wash the collected bacteria with PBS and then prepare the sample. Incubate in a 100°C water bath for 10 min and perform SDS-PAGE;

[0158] (2) After electrophoresis, soak the PVDF membrane in methanol solution for 5 min, start transferring the membrane, 200 mA for 40 min;

[0159] (3) Wash the residual transfer buffer on the membrane with PBST solution, add the rapid blocking solution and block at room temperature for 15 min;

[0160] (4) Wash off the blocking solution with PBST, cut the blocked membrane, and incubate it separately with the prepared primary antibodies (rabbit anti-rP97-46-65 polyclonal antibody, rabbit anti-rP159 polyclonal antibody, both prepared above, diluted 1:1000; mouse anti-6×His monoclonal antibody, diluted 1:5000) at 4°C overnight;

[0161] (5) Wash away the primary antibody with PBST, 4 times, 2 minutes each time. Add the prepared secondary antibody (goat anti-rabbit IgG or goat anti-mouse IgG, 1:1000), and incubate at room temperature for 45 minutes;

[0162] (6) Wash away the secondary antibody with PBST, 3 times, 5 minutes each time. Finally, store the membrane in the PBST solution;

[0163] (7) Mix the two components of the ECL developing solution at 1:1, drip it onto the membrane, and develop in an ultrasensitive chemiluminescence imaging instrument.

[0164] The primary antibodies used were polyclonal antibodies against rP159 and rP97-46-65, and a monoclonal antibody against mouse anti-6×His. The developed bands were all consistent with the predicted sizes.

[0165] Figure 16 It is the developed band diagram of Sc096-ompAm; the primary antibody of Sc096-ompAm is 6×his. As a control group, the non-specific band above the OmpAm band can be determined. All the bands hybridized with 6his have this non-specific band;

[0166] Figure 17 It is the developed band diagram of Sc096-ompAm-159; the primary antibody of Sc096-ompAm-159 is 6×his. As a control group, it is compared with the band hybridized with the polyclonal antibody P97-46-65 as the primary antibody. Theoretically, the two target bands are of the same size;

[0167] Figure 18 It is the developed band diagram of Sc096-ompAm-159; the primary antibody of Sc096-ompAm159 is the polyclonal antibody p159. The target band is the same as the result of 6HIS, proving that the result is successful;

[0168] Figure 19 It is the developed band diagram of Sc096-ompAm-65; the primary antibody of Sc096-ompAm-65 is 6×his. As a control group, it is compared with the band hybridized with the polyclonal antibody P97-46-65 as the primary antibody. Theoretically, the two target bands are of the same size;

[0169] Figure 20 It is the developed band diagram of Sc096-ompAm-46; the primary antibody of Sc096-ompAm-46 is 6×his. As a control group, it is compared with the band hybridized with the polyclonal antibody P97-46-65 as the primary antibody. Theoretically, the two target bands are of the same size;

[0170] Figure 21The bands of Sc096-ompAm-46 and Sc096-ompAm-65 are shown in Figure 1. The primary antibody of Sc096-ompAm-46 and Sc096-ompAm-65 is the polyclonal antibody p97-46-65. The target bands are the same as those of 6HIS, which proves that the results are successful. 1 is Sc096-ompAm-46; 2 is Sc096-ompAm-65.

[0171] 4. Vaccine preparation

[0172] The four freeze-dried strains for seedling preparation were respectively:

[0173] pDL02-sc096-ompAm, pDL02-sc096-ompAm-P159, pDL02-sc096-ompAm-P65, and pDL02-sc096-ompAm-P46 strains were inoculated into TSB-YE medium (containing 5% calf serum and 1% NAD) for recovery, and then transferred to TSA-YE medium and cultured at 37°C for 12 hours. A single colony was picked from the TSA-YE medium and inoculated into TSB-YE medium (5 mL / tube), and cultured at 37°C and 200 r / min for 12 hours. After that, the culture was transferred into new TSB-YE medium at a ratio of 1:100, and cultured at 37°C and 200 r / min for 18 hours. Bacterial counts and miscellaneous bacteria tests were performed, and the total number of colonies in the bacterial solution should reach 1.0×10 9 CFU / mL.

[0174] The culture solutions of the four strains for seedling production were inactivated by using formaldehyde at a final concentration of 0.3% at 37°C for 24 hours. Then, 1 mL of the inactivated solution was inoculated into TSA-YE medium and cultured at 37°C for 24 hours. No bacterial growth was observed and the inactivation was complete. The guinea pigs were divided into six groups and injected subcutaneously on the back. There were six pigs in each group.

[0175] The blood samples were collected from the immunized and control guinea pigs on day 0 and 21 days after immunization by the orbital venous sinus sampling method, with 6 guinea pigs in each group.

[0176] Immunization data can be found in Table 3 ;

[0177] Table 3 shows the immune data of guinea pigs

[0178]

[0179] The immunization results are as follows:

[0180] 4.1 Reactivity test between immune serum and wild-type strain protein

[0181] To investigate whether the antibodies induced in immunized guinea pigs can recognize the native proteins of Mhp, referring to relevant literature (if possible, give the literature source: Marchioro SB, Simionatto S, Galli V, FR, Brum CB, Fisch A, Gomes CK, Dellagostin OA. Production and characterization of recombinant transmembrane proteins from Mycoplasma hyopneumoniae. Vet Microbiol. 2012 Feb 24;155(1):44-52. doi:10.1016 / j.vetmic.2011.08.001. Epub 2011 Aug 7. PMID:21890287.), the crude extract of Mhp sc096 strain was used as an antigen to coat the ELISA plate (10 μg / well). After adsorption overnight at 4°C, it was placed in a -80°C refrigerator for 2 h, then thawed at room temperature and subjected to ELISA detection.

[0182] The primary antibody was the serum taken on the 21st day, and the dilution ratio was 1:100 for all. The secondary antibody was HRP-labeled goat anti-guinea pig IgG, diluted 1:1000. The detection of all serum samples was repeated three times, and finally the absorbance value at a wavelength of 450 nm was measured.

[0183] The results are referred to Figure 22 , Figure 22 In, for the crude extract of Mhp sc096 strain as an antigen, the antibody levels in the Mhp immunized group were significantly higher than those in the blank control group (P<0.0001), indicating successful immunization with the Mhp sc096 strain.

[0184] 4.2 Analysis and detection of serum antibody levels

[0185] The humoral immune effect was reflected by measuring the serum antibody levels through indirect ELISA. The specific steps of ELISA referred to 4.1. The difference was that the ELISA plate was coated with prokaryotically expressed rP97-46-65 and rP159 (section 2.10 above), with a concentration of 0.1 μg / well. The primary antibody was the serum taken on the 0th and 21st days, and the dilution ratio was 1:100 for all. The secondary antibody was HRP-labeled goat anti-guinea pig IgG, diluted 1:1000. The detection of all serum samples was repeated three times, and finally the absorbance value at a wavelength of 450 nm was measured.

[0186] The results are referred to Figures 23 to 27, in the serum on the 21st day, the IgG levels against rP65 and rP159 were significantly higher (P<0.0001) than those in the blank control group, and there was no significant difference in the IgG level against rP46 between the two groups (P>0.05). The IgG levels against sc096 and sc096-ompA in the two positive control groups were significantly higher (P<0.0001) than those in the blank control group, indicating that only pDL02-sc096-ompAm-P65 and pDL02-sc096-ompAm-P159 expressing mycoplasma antigens were successfully expressed. The successful display of surface display vectors pDL02-sc096-ompAm-P65 and pDL02-sc096-ompAm-P159 was obtained through the results of the indirect ELISA experiment.

[0187] Figure 22 It is a chart of the reactivity detection results of immune serum and wild strain proteins;

[0188] Figure 23 It is a chart of the detection results of the total IgG level against rP159 antigen;

[0189] Figure 24 It is a chart of the detection results of the total IgG level against rP46 antigen;

[0190] Figure 25 It is a chart of the detection results of the total IgG level against rP65 antigen;

[0191] Figure 26 It is a chart of the detection results of the total IgG level against sc096 antigen;

[0192] Figure 27 It is a chart of the detection results of the total IgG level against sc096-ompA antigen.

[0193] The core innovation points of the present invention are as follows:

[0194] 1. The present invention constructs plasmid pDL02-ompAm, and based on this plasmid, the Mycoplasma hyopneumoniae membrane protein gene is ligated to obtain a variety of plasmids. These plasmids can be combined with Haemophilus parasuis SC096 strain by the method of natural transformation to obtain two surface display vectors pDL02-sc096-ompAm-P65 and pDL02-sc096-ompAm-P159 capable of expressing Mhp antigen proteins.

[0195] 2. Based on the basic method of surface display vectors, through the method of natural transformation and using the uptake signal sequence USS, the present invention successfully realizes a surface display vector with a double immune effect.

[0196] It should be noted that the related technology based on the uptake signal sequence USS has been applied in the applicant's previous application CN105331601B, a method for efficient genetic recombination of Haemophilus parasuis based on natural transformation and its application; however, it is the natural transformation of the target gene of the same strain, and there has been no report on the natural transformation of the target gene of other types of strains;

[0197] It can also be seen from the experiments of the present invention that not all Mhp antigen protein genes can be successfully expressed.

[0198] 3. The successful construction of the surface display vector of the present invention is, in our opinion, inseparable from the following factors: the structure of the plasmid, the selection of the Mhp antigen protein gene, and the reasonable application of the natural transformation technology based on the uptake signal sequence.

[0199] The present invention overcomes the drawbacks of the prior art that the method of using a combined inactivated vaccine must be used to prepare the vaccine, and has good immune effect and high immune efficiency.

Claims

1. A plasmid, characterized in that, The plasmid contains the outer membrane protein gene of Haemophilus parasuis Omp Am and the membrane protein gene of Mycoplasma hyopneumoniae; the membrane protein gene of Mycoplasma hyopneumoniae is one or a combination of the membrane protein P46 gene of Mycoplasma hyopneumoniae, the membrane protein P65 gene of Mycoplasma hyopneumoniae, and the membrane protein P159 gene of Mycoplasma hyopneumoniae.

2. The plasmid according to claim 1, characterized in that, The nucleotides of the plasmid are as shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

4.

3. A method for constructing a Haemophilus parasuis surface display vector, characterized in that, The method is natural transformation using the target gene and Haemophilus parasuis to obtain a recombinant strain of Haemophilus parasuis capable of expressing the Mhp antigen protein; the preparation method of the target gene is: amplifying the target gene from the plasmid as described in claim 1 using primers, and the target gene contains the outer membrane protein gene of Haemophilus parasuis Omp Am and the membrane protein gene of Mycoplasma hyopneumoniae; the upstream primer in the primers contains a USS sequence.

4. The construction method of the Haemophilus parasuis surface display vector according to claim 3, characterized in that, The sequences of the primers are as shown in SEQ ID NO.5 and SEQ ID NO.

6.

5. A Haemophilus parasuis surface display vector, characterized in that, Prepared by the method as described in claim 3 or 4.

6. Use of the Haemophilus parasuis surface display vector as described in claim 5 for preparing a vaccine.

7. A vaccine, characterized in that, Containing the inactivated Haemophilus parasuis surface display vector as described in claim 5.

Images