Self-replicating RNA and application thereof

Abstract

Provided are a replicable RNA molecule and uses thereof, the present invention relates to a replicable RNA molecule comprising, from the 5'end to the 3 'end, a 5' cap, a 5 'UTR, an open reading frame encoding an RNA replicase, a promoter, a sequence of interest, a 3' UTR, and a poly (A) tail wherein the RNA replicase is capable of amplifying the replicable RNA molecule and an RNA molecule containing the sequence of interest and the 3 'UTR wherein the RNA replicase is derived from the group consisting of the group consisting of the MosdPedras virus, MDPV, EVEV, Riogro virus, Mycovirus, Mycovirus, Mycovirus, Mycovirus, Mycovirus, Mycovirus, Mycovirus, Mycovirus, Mycovirus, Mycovirus, Mycovirus and Mycovirus. RnV, Muslim virus, MUCV, Highland J virus, PIXV, TROV, Cabassu virus, TONV, Bebaru virus, BEBV, Formun virus, GETV, or Nnumu virus, and NDUV can be used in the treatment of a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, a disease, and a disease.

Description

[0001] Cross - reference to related applications

[0002] This application claims the priority of Chinese Patent Applications with Application Nos. CN202410102577.7 filed on January 24, 2024 and CN202411074843.6 filed on August 6, 2024, the entire contents of which are incorporated herein by reference. Technical Field

[0003] This application provides a replicable RNA molecule that can amplify and express a target sequence intracellularly. This application also relates to the use of the replicable RNA molecule in the preparation of a target peptide or protein, and in the treatment or prevention of certain diseases. Background Art

[0004] Messenger RNA (mRNA) is a single-stranded RNA molecule that serves as a template for protein synthesis in cells. In recent years, scientists have continuously optimized the molecular properties of mRNA in an effort to enable it to be used as an active pharmaceutical ingredient for various types of therapeutic interventions. After administration to patients, mRNA molecules can express almost any target protein. Potential applications include cancer treatment, protein replacement, and infectious disease vaccination. Compared with traditional protein therapies or other types of nucleic acid therapies (such as plasmid DNA or viral vectors), the advantages of mRNA are that it can synthesize proteins in their native conformation and there is no risk of genomic integration. In addition, the production process of mRNA is relatively simple, requiring only enzymatic reactions and simple downstream purification in vitro, which has great advantages in process scale-up. With the successful application of the COVID-19 mRNA vaccine, mRNA-based pharmaceutical products have attracted great interest from the scientific community and the public.

[0005] Despite numerous advantages, mRNA still has many limitations in practical applications, mainly because mRNA is extremely unstable and easily degraded, and its short half-life greatly limits its application as a therapeutic drug. To address this issue, two new types of mRNA have been developed. The first is self-replicating RNA (saRNA, also known as self-amplifying RNA), which can continuously amplify in cells the in vitro synthesized RNA with the help of the viral replicase system, achieving higher and more persistent expression of the target protein. The second is circular RNA, which is more stable and can express the target protein more persistently by changing the conformation of RNA to make it resistant to RNase degradation.

[0006] The saRNA sequence is derived from the modification of the dicistronic genome of positive-strand RNA viruses (e.g., alphavirus, flavivirus, lentivirus, measles virus, and rhabdovirus, etc.). In addition to conventional mRNA elements such as the cap, 5'UTR, 3'UTR, and poly(A) tail, the saRNA contains a very large open reading frame at the 5' end, encoding four non-structural proteins (nsP) of the positive-strand RNA virus, and the viral structural protein gene originally located behind the subgenomic promoter (SGP) is replaced with a gene encoding the protein of interest. Once the saRNA enters the host cytoplasm, it first translates four non-structural proteins (nsP1, nsP2, nsP3, and nsP4), which polymerize to form an RNA-dependent RNA polymerase complex, also known as RNA replicase. The RNA polymerase complex first synthesizes a complementary antisense-strand RNA using the sense-strand RNA as a template, and then, using this antisense strand as a template, synthesizes a sense-strand RNA copy of the original full-length RNA, as well as multiple subgenomic sense-strand RNAs encoding the protein of interest located downstream of the SGP. The former further enters the amplification cycle, and the latter translates the protein of interest. This is the reason why saRNA can achieve efficient and persistent expression of the protein of interest at a low dose.

[0007] Compared with traditional non-replicating linear mRNA, saRNA has higher and more persistent protein expression. However, during the amplification process, saRNA forms dsRNA structures, which may induce a strong host innate immune response in cells. This may be beneficial in terms of the recruitment and activation of antigen-presenting cells and cells of the adaptive immune system in the case of saRNA expressing protein vaccines. At the same time, the immune response of host cells inhibits the translation of the protein of interest in the saRNA subgenome. How to both promote the recruitment and activation of downstream immune responses and eliminate the adverse effects on the protein of interest in the subgenome is the key goal in the development of saRNA molecules.

[0008] In recent years, researchers have tried various strategies to design and optimize the sequences of saRNA vector skeletons to reduce the host's innate immune response and enhance the intensity and duration of the expression of target proteins by saRNA. In 2017, Ugur Sahin, in order to reduce the stimulation of saRNA on intracellular pattern recognition receptors and relieve the inhibitory effect during the translation of target proteins by saRNA, first co-delivered the non-replicating mRNA encoding the immune escape proteins E3 / K3 / B18 and the saRNA encoding luciferase. This method significantly inhibited the PKR and IFN pathways in cells and greatly enhanced the translation efficiency of luciferase encoded by saRNA in mice. However, the co-delivery of the two mRNAs significantly increased the injection dose of mRNA, losing the advantage of the low-dose application of self-replicating mRNA. In 2019, Yingzhong Li et al. constructed an in vitro evolution strategy based on the VEEV replicon system and screened for mutant VEEV replicon sequences with high expression and low immunogenicity. In addition to artificially screening mutant replicons, there are a large number of naturally occurring mutant sequences in viral replicons. For example, the VEEV-TC83 strain has a higher expression effect compared to the original VEEV. Therefore, screening natural viral replicons is also one of the effective means to optimize saRNA sequences. In addition, the mRNA replicated intracellularly for target protein expression has basically the same structure as traditional non-replicating mRNA. Therefore, the sequence optimization of traditional non-replicating mRNA may also be applicable to the sub-genetic sequences of self-replicating RNA. However, the expression levels of target proteins of the self-replicating RNAs reported currently, especially the VEEV replicon system, far from meet the requirements of many clinical trials. Summary of the Invention

[0009] The inventors of the present application have screened out viral replicons with high replication ability. When used to construct self-replicating RNA for expressing target proteins, the protein expression level is significantly higher than that of self-replicating RNA constructed with, for example, VEEV TC83. In addition, through UTR optimization and cis-expression of auxiliary proteins, the self-replicating RNA vector has a more efficient target protein expression ability and lower immunogenicity.

[0010] Therefore, in a first aspect, the present application provides a replicable RNA molecule, which may comprise, from the 5'-end to the 3'-end, a 5' cap, a 5' UTR, an open reading frame encoding an RNA replicase, a promoter, a target sequence, a 3' UTR, and a poly(A) tail, wherein the RNA replicase is capable of amplifying the replicable RNA molecule and is capable of amplifying an RNA molecule containing the target sequence and the 3' UTR.

[0011] The replicable RNA molecule may be a single-stranded RNA molecule.

[0012] The RNA replicase can be a non-structural protein derived from Mosquito Das Perdas virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mucambo virus (MUCV), High Plains J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV), or a functional variant thereof. The non-structural protein can comprise nsP1, nsP2, nsP3, and / or nsP4. In some embodiments, the non-structural protein can be nsP123 and nsP4. In some embodiments, the non-structural protein can be nsP1234. The open reading frame encoding the RNA replicase can comprise a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 12, 36, 52, 56, 60, 16, 20, 24, 28, 32, 40, 44, or 48, or be constituted by the above sequences.

[0013] The RNA replicase can have the ability to amplify a replicable RNA molecule, including the ability to transcribe a complementary RNA strand from the replicable RNA molecule, and the ability to transcribe a replicable RNA molecule from the transcribed RNA strand. The RNA replicase has the ability to amplify an RNA molecule containing a target sequence and a 3' UTR, or an RNA molecule constituted by a target sequence and a 3' UTR, including the ability to transcribe a complementary RNA strand from the replicable RNA molecule, transcribe an RNA molecule containing a target sequence and a 3' UTR, or an RNA molecule constituted by a target sequence and a 3' UTR from the transcribed RNA strand, and optionally add a 5' cap and a poly(A) tail to the RNA molecule. In some embodiments, the amount of the RNA molecule containing a target sequence and a 3' UTR, or an RNA molecule constituted by a target sequence and a 3' UTR amplified by the RNA replicase is greater than the amount of the replicable RNA molecule amplified.

[0014] The RNA replicase can have the activities of an RNA-dependent RNA polymerase, a protease, a helicase, a terminal adenylyl transferase, a methyltransferase, and / or a guanylyl transferase.

[0015] The 5' UTR, promoter, and / or 3' UTR in a replicable RNA molecule can cooperate with an RNA replicase to effect amplification of the replicable RNA molecule and / or an RNA molecule containing a target sequence and a 3' UTR or consisting of a target sequence and a 3' UTR. In some embodiments, the 5' UTR, promoter, and 3' UTR in a replicable RNA molecule can cooperate with an RNA replicase to effect amplification of the replicable RNA molecule and an RNA molecule containing a target sequence and a 3' UTR or consisting of a target sequence and a 3' UTR. The RNA molecule containing a target sequence and a 3' UTR can be a subgenomic RNA molecule of a virus.

[0016] In some embodiments, the 5' UTR, promoter, and 3' UTR can be from the genome of the same virus as the RNA replicase, such as Mosquito Das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV).

[0017] In some embodiments, the 5' UTR can be from the genome of Mosquito Das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV).

[0018] In some embodiments, the promoter can be derived from the genome of Mosquito Daspeiras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV). The promoter can be the subgenomic promoter (SGP) of Mosquito Daspeiras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV).

[0019] In some embodiments, the 3’UTR can be derived from the genome of Mosquito Daspeiras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV).

[0020] In some embodiments, the 5'UTR, the open reading frame encoding an RNA replicase, the promoter, and the 3'UTR may each comprise a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with (1) SEQ ID NO: 11, 12, 13 and 14; (2) SEQ ID NO: 35, 36, 37 and 38; (3) SEQ ID NO: 51, 52, 53 and 54; (4) SEQ ID NO: 55, 56, 57 and 58; (5) SEQ ID NO: 59, 60, 61 and 62; (6) SEQ ID NO: 15, 16, 17 and 18; (7) SEQ ID NO: 19, 20, 21 and 22; (8) SEQ ID NO: 23, 24, 25 and 26; (9) SEQ ID NO: 27, 28, 29 and 30; (10) SEQ ID NO: 31, 32, 33 and 34; (11) SEQ ID NO: 39, 40, 41 and 42; (12) SEQ ID NO: 43, 44, 45 and 46; or (13) SEQ ID NO: 47, 48, 49 and 50, or be composed of the above sequences.

[0021] The 5' cap can be a natural 5' cap or a 5' cap analog. The 5' cap analog can be Cap-AU or Cap-AG. The poly(A) tail can comprise consecutive adenosines or consist of consecutive adenosines. Alternatively, the poly(A) tail can comprise 2 - 5 consecutive adenosine segments separated by spacer sequences, where the spacer sequences comprise 1 - 20 nucleotides and each consecutive adenosine segment comprises 10 - 100 consecutive adenosines.

[0022] The target sequence can be any sequence. In some embodiments, the target sequence can be an open reading frame encoding a target peptide or protein. The target peptide or protein can be a disease-related antigen or a therapeutic agent.

[0023] This application also provides an RNA combination, which may comprise a first RNA molecule and a second RNA molecule.

[0024] The first RNA molecule can comprise, from the 5' end to the 3' end, a 5' cap, a 5'UTR, an open reading frame encoding an RNA replicase, a 3'UTR, and a poly(A) tail.

[0025] The second RNA molecule may comprise a 5' cap, 5' UTR, conserved sequence element, promoter, target sequence, 3' UTR, and poly(A) tail. In some embodiments, the second RNA molecule may comprise a 5' cap, 5' UTR, conserved sequence element, promoter, target sequence, 3' UTR, and poly(A) tail from the 5' end to the 3' end. In some embodiments, the second RNA molecule may comprise a 5' cap, 5' UTR, first conserved sequence element, second conserved sequence element, promoter, target sequence, 3' UTR, and poly(A) tail from the 5' end to the 3' end.

[0026] The first RNA molecule may be a single-stranded RNA molecule.

[0027] The second RNA molecule may be a single-stranded RNA molecule.

[0028] The RNA replicase may be a non-structural protein or a functional variant thereof obtained from Mosquito Das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukamba virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV). The non-structural protein obtained from Mosquito Das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukamba virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV) may comprise nsP1, nsP2, nsP3, and / or nsP4. In some embodiments, the non-structural protein may be nsP123 and nsP4. In some embodiments, the non-structural protein may be nsP1234. The open reading frame encoding the RNA replicase may comprise a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 12, 36, 52, 56, 60, 16, 20, 24, 28, 32, 40, 44, or 48, or consist of the above sequences.

[0029] The RNA replicase can have the activities of an RNA-dependent RNA polymerase, a protease, a helicase, a terminal adenylyl transferase, a methyltransferase, and / or a guanylyl transferase.

[0030] The RNA replicase in the first RNA molecule can amplify the second RNA molecule. The RNA replicase has the ability to amplify the second RNA molecule, including the ability to transcribe an RNA strand complementary to the second RNA molecule and to transcribe the second RNA molecule using the transcribed RNA strand. The 5′ UTR, conserved sequence element, promoter, and / or 3′ UTR in the second RNA molecule can cooperate with the RNA replicase in the first RNA molecule to amplify the second RNA molecule. In particular, the 5′ UTR, conserved sequence element, promoter, and 3′ UTR in the second RNA molecule can be derived from the same virus as the RNA replicase in the first RNA molecule. In some embodiments, the conserved sequence element can overlap completely or partially with the promoter and / or UTR (especially the 5′ UTR).

[0031] The promoter in the second RNA molecule can be the subgenomic promoter (SGP) of Moussa da Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV). The second RNA molecule can be the subgenomic RNA molecule of a virus. In some embodiments, the open reading frame encoding the RNA replicase in the first RNA molecule, and the 5’ UTR, promoter, and 3’ UTR in the second RNA molecule can respectively comprise nucleotide sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with (1) SEQ ID NO: 12, 11, 13, and 14; (2) SEQ ID NO: 36, 35, 37, and 38; (3) SEQ ID NO: 52, 51, 53, and 54; (4) SEQ ID NO: 56, 55, 57, and 58; (5) SEQ ID NO: 60, 59, 61, and 62; (6) SEQ ID NO: 16, 15, 17, and 18; (7) SEQ ID NO: 20, 19, 21, and 22; (8) SEQ ID NO: 24, 23, 25, and 26; (9) SEQ ID NO: 28, 27, 29, and 30; (10) SEQ ID NO: 32, 31, 33, and 34; (11) SEQ ID NO: 40, 39, 41, and 42; (12) SEQ ID NO: 44, 43, 45, and 46; or (13) SEQ ID NO: 48, 47, 49, and 50, or be composed of the above sequences.

[0032] The RNA replicase in the first RNA molecule can have the ability to amplify the first RNA molecule.

[0033] In some embodiments, the RNA replicase in the first RNA molecule is capable of amplifying the first RNA molecule. The RNA replicase may have the ability to amplify the first RNA molecule, including the ability to transcribe an RNA strand complementary to the first RNA molecule and the ability to transcribe the first RNA molecule using the transcribed RNA strand. In some embodiments, the amount of the second RNA molecule amplified by the RNA replicase is greater than the amount of the first RNA molecule amplified. The 5' UTR and / or 3' UTR of the first RNA molecule may cooperate with the RNA replicase to amplify the first RNA molecule. In particular, the 5' UTR and / or 3' UTR of the first RNA molecule may be derived from the same virus as the RNA replicase. In some embodiments, the 5' UTR, open reading frame encoding the RNA replicase, and 3' UTR in the first RNA molecule may respectively comprise nucleotide sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with (1) SEQ ID NO: 11, 12 and 14; (2) SEQ ID NO: 35, 36 and 38; (3) SEQ ID NO: 51, 52 and 54; (4) SEQ ID NO: 55, 56 and 58; (5) SEQ ID NO: 59, 60 and 62; (6) SEQ ID NO: 15, 16 and 18; (7) SEQ ID NO: 19, 20 and 22; (8) SEQ ID NO: 23, 24 and 26; (9) SEQ ID NO: 27, 28 and 30; (10) SEQ ID NO: 31, 32 and 34; (11) SEQ ID NO: 39, 40 and 42; (12) SEQ ID NO: 43, 44 and 46; or (13) SEQ ID NO: 47, 48 and 50, or consist of the above sequences.

[0034] The 5' cap in the first RNA molecule and the second RNA molecule may be a natural 5' cap or a 5' cap analog. The 5' cap analog may be Cap-AU or Cap-AG.

[0035] The poly(A) tail in the first RNA molecule and the second RNA molecule may comprise consecutive adenylates or consist of consecutive adenylates. Alternatively, the poly(A) tail in the first RNA molecule and the second RNA molecule may comprise 2 - 5 consecutive adenylate segments separated by spacer sequences, where the spacer sequences comprise 1 - 20 nucleotides and each consecutive adenylate segment comprises 10 - 100 consecutive adenylates.

[0036] The target sequence can be any sequence. In some embodiments, the target sequence can be an open reading frame encoding a target peptide or protein. The target peptide or protein can be a disease-related antigen or a therapeutic agent.

[0037] In a second aspect, the present application provides a replicable RNA molecule that can comprise, from the 5'-end to the 3'-end, a 5' cap, a 5' UTR, an open reading frame encoding an RNA replicase, a promoter, a second 5' UTR, a target sequence, a 3' UTR, and a poly(A) tail, wherein the RNA replicase is capable of amplifying the replicable RNA molecule and is capable of amplifying an RNA molecule containing the second 5' UTR, the target sequence, and the 3' UTR.

[0038] The replicable RNA molecule can be a single-stranded RNA molecule.

[0039] The RNA replicase can be a non-structural protein derived from a replicating virus or a functional variant thereof. The non-structural protein can comprise nsP1, nsP2, nsP3, and / or nsP4. In some embodiments, the non-structural protein can be nsP123 and nsP4. In some embodiments, the non-structural protein can be nsP1234. The self-replicating virus can be an alphavirus, flavivirus, measles virus, or rhabdovirus. The alphavirus can be any alphavirus, including but not limited to Aura virus (AURV), Barmah Forest virus (BFV), Bebaru virus (BEBV), Cabassou virus (CABV), Chikungunya virus (CHIKV), Eastern equine encephalitis virus (EEEV), Eilat virus (ELIV), Everglades virus (EVEV), Fort Morgan virus (FMV), Getah virus (GETV), Mayaro virus (MAYV), Madariagavirus (MADV), Mosso das Pedras virus (MDPV), Ndumu virus (NDUV), O'nyong-nyong virus (ONNV), Pixuna virus (PIXV), Ross River virus (RRV), Semliki forest virus (SFV), Sindbis virus (SINV), Tonate virus (TONV or TV), Trocara virus (TROV), Venezuelan equine encephalitis virus (VEEV), Unavirus (UNAV), Highlands J virus (HJV), Mucambo virus (MUCV), Ruhugu virus (RHGV), Rio Negro virus (RNV), Rustrela virus (RUSV), and Sagiyama virus (SAGV).In some embodiments, the alphavirus can be Mosquito Das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukamba virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV). In some embodiments, the RNA replicase can be a non-structural protein or a functional variant thereof derived from Mosquito Das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukamba virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV). In some embodiments, the open reading frame encoding the RNA replicase can comprise a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 12, 36, 16, 20, 24, 28, 32, 40, 44, or 48. In some embodiments, the sequence of the open reading frame encoding the RNA replicase can be as shown in SEQ ID NO: 12, 36, 52, 56, 60, 16, 20, 24, 28, 32, 40, 44, or 48.

[0040] The RNA replicase can have the ability to amplify a replicable RNA molecule, including the ability to transcribe a complementary RNA strand from the replicable RNA molecule and the ability to transcribe a replicable RNA molecule from the transcribed RNA strand. The RNA replicase has the ability to amplify an RNA molecule containing a second 5' UTR, a target sequence, and a 3' UTR, or an RNA molecule consisting of a second 5' UTR, a target sequence, and a 3' UTR, including the ability to transcribe a complementary RNA strand from the replicable RNA molecule, transcribe an RNA molecule containing a second 5' UTR, a target sequence, and a 3' UTR, or an RNA molecule consisting of a second 5' UTR, a target sequence, and a 3' UTR from the transcribed RNA strand, and optionally add a 5' cap and a poly(A) tail to the RNA molecule. In some embodiments, the amount of the RNA molecule containing a second 5' UTR, a target sequence, and a 3' UTR, or an RNA molecule consisting of a second 5' UTR, a target sequence, and a 3' UTR amplified by the RNA replicase is greater than the amount of the replicable RNA molecule amplified.

[0041] The RNA replicase can have the activities of an RNA-dependent RNA polymerase, a protease, a unwindase, a terminal adenylyl transferase, a methyltransferase, and / or a guanylyl transferase.

[0042] The 5' UTR, promoter, and / or 3' UTR in the replicable RNA molecule can cooperate with the RNA replicase to amplify the replicable RNA molecule and / or an RNA molecule containing a second 5' UTR, a target sequence, and a 3' UTR, or composed of a second 5' UTR, a target sequence, and a 3' UTR. In some embodiments, the 5' UTR, promoter, and 3' UTR in the replicable RNA molecule can cooperate with the RNA replicase to amplify the replicable RNA molecule and an RNA molecule containing a second 5' UTR, a target sequence, and a 3' UTR, or composed of a second 5' UTR, a target sequence, and a 3' UTR. In some embodiments, the 5' UTR, promoter, and 3' UTR in the replicable RNA molecule can cooperate with the RNA replicase to amplify the replicable RNA molecule and / or an RNA molecule containing a second 5' UTR, a target sequence, and a 3' UTR. In some embodiments, the 5' UTR, promoter, and 3' UTR in the replicable RNA molecule can cooperate with the RNA replicase to amplify the replicable RNA molecule and an RNA molecule composed of a second 5' UTR, a target sequence, and a 3' UTR. The promoter can be a subgenomic promoter (SGP) of a self-replicating virus. The RNA molecule containing a second 5' UTR, a target sequence, and a 3' UTR can be a subgenomic RNA molecule.

[0043] In some embodiments, the 5'UTR, promoter, and 3'UTR can be obtained from the same self-replicating virus as the RNA replicase, such as an alphavirus, a flavivirus, a measles virus, or a rhabdovirus. In some embodiments, the 5'UTR, promoter, and 3'UTR can be obtained from the genome of an alphavirus with the RNA replicase. In some embodiments, the 5'UTR, promoter, and 3'UTR can be obtained from the genome of a alphavirus with the RNA replicase. In some embodiments, the 5'UTR, promoter, and 3'UTR can be obtained from the genome of a Bama Forest virus (BFV), Bebaru virus (BEBV), Kabasu virus (CABV), Chikungunya virus (CHIKV), Eastern equine encephalitis virus (EEEV), Eilat virus (ELIV), Everglades virus (EVEV), Fort Morgan virus (FMV), Geta virus (GETV), Mayaro virus (MAYV), Mos das Pedras virus (MDPV), Ndumu virus (NDUV), O'Neal virus (ONNV), Pixun a virus (PIXV), Ross River virus (RRV), Semliki Forest virus (SFV), Sindbis virus (SINV), Tonate virus (TONV or TV), Trocara virus (TROV), Venezuelan equine encephalitis virus (VEEV), Una virus (UNAV), Aura virus (AURV), Highland J virus (HJV), Madariaga virus (MADV), Mukumbu virus (MUCV), Ruhugu virus (RHGV), Rio Negro virus (RNV), Rustrelela virus (RUSV), or Sao Aguinaldo virus (SAGV). In some embodiments, the 5'UTR, promoter, and 3'UTR can be obtained with an RNA replicase from Mos das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukambu virus (MUCV), Highland J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Kabasu virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Geta virus (GETV), or Ndumu virus (NDUV).

[0044] In some embodiments, the 5’UTR, open reading frame encoding an RNA replicase, promoter, and 3’UTR may each comprise a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to (1) SEQ ID NO: 11, 12, 13 and 14; (2) SEQ ID NO: 35, 36, 37 and 38; (3) SEQ ID NO: 51, 52, 53 and 54; (4) SEQ ID NO: 55, 56, 57 and 58; (5) SEQ ID NO: 59, 60, 61 and 62; (6) SEQ ID NO: 15, 16, 17 and 18; (7) SEQ ID NO: 19, 20, 21 and 22; (8) SEQ ID NO: 23, 24, 25 and 26; (9) SEQ ID NO: 27, 28, 29 and 30; (10) SEQ ID NO: 31, 32, 33 and 34; (11) SEQ ID NO: 39, 40, 41 and 42; (12) SEQ ID NO: 43, 44, 45 and 46; or (13) SEQ ID NO: 47, 48, 49 and 50. In some embodiments, the 5’UTR, open reading frame encoding an RNA replicase, promoter, and 3’UTR sequences may be as shown in (1) SEQ ID NO: 11, 12, 13 and 14; (2) SEQ ID NO: 35, 36, 37 and 38; (3) SEQ ID NO: 51, 52, 53 and 54; (4) SEQ ID NO: 55, 56, 57 and 58; (5) SEQ ID NO: 59, 60, 61 and 62; (6) SEQ ID NO: 15, 16, 17 and 18; (7) SEQ ID NO: 19, 20, 21 and 22; (8) SEQ ID NO: 23, 24, 25 and 26; (9) SEQ ID NO: 27, 28, 29 and 30; (10) SEQ ID NO: 31, 32, 33 and 34; (11) SEQ ID NO: 39, 40, 41 and 42; (12) SEQ ID NO: 43, 44, 45 and 46; or (13) SEQ ID NO: 47, 48, 49 and 50 respectively.

[0045] The second 5’UTR can be any 5’UTR. The second 5’UTR can comprise a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO:5, 6, 7 or 8. In some embodiments, the second 5’UTR can comprise a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO:5. In some embodiments, the sequence of the second 5’UTR is as shown in SEQ ID NO:5, 6, 7 or 8.

[0046] The 5’ cap can be a natural 5’ cap or a 5’ cap analog. The 5’ cap analog can be Cap-AU or Cap-AG.

[0047] The poly(A) tail can comprise consecutive adenylates or consist of consecutive adenylates. Alternatively, the poly(A) tail can comprise 2-5 consecutive adenylate segments separated by spacer sequences, where the spacer sequences comprise 1-20 nucleotides and each consecutive adenylate segment comprises 10-100 consecutive adenylates.

[0048] The target sequence can be any sequence. In some embodiments, the target sequence can be an open reading frame encoding a target peptide or protein. The target peptide or protein can be a disease-related antigen or a therapeutic agent.

[0049] In a third aspect, the present application provides a replicable RNA molecule that can comprise, from the 5’ end to the 3’ end, a 5’ cap, a 5’UTR, an open reading frame encoding an RNA replicase, a promoter, a first target sequence, an internal ribosome entry site (IRES), a second target sequence, a 3’UTR, and a poly(A) tail, wherein the RNA replicase is capable of amplifying the replicable RNA molecule and is capable of amplifying an RNA molecule containing the first target sequence, the internal ribosome entry site (IRES), the second target sequence, and the 3’UTR.

[0050] The replicable RNA molecule can be a single-stranded RNA molecule.

[0051] One of the first target sequence and the second target sequence is an open reading frame encoding an immunosuppressive protein. For example, the first target sequence is an open reading frame encoding a target peptide or protein, and the second target sequence is an open reading frame encoding an immunosuppressive protein; or the first target sequence is an open reading frame encoding an immunosuppressive protein, and the second target sequence is an open reading frame encoding a target peptide or protein. The target peptide or protein can be a disease-related antigen or a therapeutic agent.

[0052] The immunosuppressive protein can be an interferon inhibitory protein, such as poxvirus E3L protein, poxvirus K3 protein, poxvirus B18 / B18R protein, influenza virus non-structural protein 1, parainfluenza virus PIV5 protein, or MERS ORF4a protein. In some embodiments, the immunosuppressive protein can be poxvirus E3L protein. The open reading frame encoding the poxvirus E3L protein can comprise the nucleotide sequence shown in SEQ ID NO:10.

[0053] The RNA replicase can be a non-structural protein of a self-replicating virus or a functional variant thereof. The non-structural protein can comprise nsP1, nsP2, nsP3, and / or nsP4. In some embodiments, the non-structural protein can be nsP123 and nsP4. In some embodiments, the non-structural protein can be nsP1234. The self-replicating virus can be an alphavirus, a flavivirus, a measles virus, or a rhabdovirus. The alphavirus can be any alphavirus, including but not limited to Barmah Forest virus (BFV), Bebaru virus (BEBV), Cabassou virus (CABV), Chikungunya virus (CHIKV), Eastern equine encephalitis virus (EEEV), Elat virus (ELIV), Everglades virus (EVEV), Fort Morgan virus (FMV), Getah virus (GETV), Mayaro virus (MAYV), Mosso das Pedras virus (MDPV), Ndumu virus (NDUV), O'nyong'nyong virus (ONNV), Pixuna virus (PIXV), Ross River virus (RRV), Semliki Forest virus (SFV), Sindbis virus (SINV), Tonate virus (TONV or TV), Trocara virus (TROV), Venezuelan equine encephalitis virus (VEEV), Una virus (UNAV), Aura virus (AURV), Highlands J virus (HJV), Madariaga virus (MADV), Mukumbu virus (MUCV), Ruhugu virus (RHGV), Rio Negro virus (RNV), Rustrela virus (RUSV), or Sagiyama virus (SAGV). In some embodiments, the alphavirus can be Mosso das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), Highlands J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV). In some embodiments, the RNA replicase can be a non-structural protein or a functional variant thereof obtained from Mosso das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), Highlands J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV).In some embodiments, the open reading frame encoding the RNA replicase can comprise a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 12, 36, 52, 56, 60, 16, 20, 24, 28, 32, 40, 44, or 48. In some embodiments, the sequence of the open reading frame encoding the RNA replicase can be as shown in SEQ ID NO: 12, 36, 52, 56, 60, 16, 20, 24, 28, 32, 40, 44, or 48.

[0054] The RNA replicase can have the ability to amplify a replicable RNA molecule, including the ability to transcribe a complementary RNA strand from the replicable RNA molecule, and the ability to transcribe the replicable RNA molecule from the transcribed RNA strand. The RNA replicase has the ability to amplify an RNA molecule containing a first target sequence, an internal ribosome entry site (IRES), a second target sequence, and a 3' UTR, or an RNA molecule composed of a first target sequence, an internal ribosome entry site (IRES), a second target sequence, and a 3' UTR, including the ability to transcribe a complementary RNA strand from the replicable RNA molecule, transcribe from the transcribed RNA strand an RNA molecule containing a first target sequence, an internal ribosome entry site (IRES), a second target sequence, and a 3' UTR, or an RNA molecule composed of a first target sequence, an internal ribosome entry site (IRES), a second target sequence, and a 3' UTR, and optionally add a 5' cap and a poly(A) tail to the RNA molecule. In some embodiments, the amount of the RNA molecule containing a first target sequence, an internal ribosome entry site (IRES), a second target sequence and optionally adding a 5' cap and a poly(A) tail to the RNA molecule, or an RNA molecule composed of a first target sequence, an internal ribosome entry site (IRES), a second target sequence and optionally adding a 5' cap and a poly(A) tail amplified by the RNA replicase is greater than the amount of the replicable RNA molecule amplified.

[0055] The RNA replicase can have the activities of an RNA-dependent RNA polymerase, a protease, a helicase, a terminal adenylyl transferase, a methyltransferase, and / or a guanylyl transferase.

[0056] The 5' UTR, promoter, and / or 3' UTR in a replicable RNA molecule can cooperate with an RNA replicase to amplify the replicable RNA molecule and / or an RNA molecule containing a first target sequence, an internal ribosome entry site (IRES), a second target sequence, and a 3' UTR, or consisting of a first target sequence, an internal ribosome entry site (IRES), a second target sequence, and a 3' UTR. In some embodiments, the 5' UTR, promoter, and 3' UTR in a replicable RNA molecule can cooperate with an RNA replicase to amplify the replicable RNA molecule and an RNA molecule containing a first target sequence, an internal ribosome entry site (IRES), a second target sequence, and a 3' UTR, or consisting of a first target sequence, an internal ribosome entry site (IRES), a second target sequence, and a 3' UTR. In some embodiments, the 5' UTR, promoter, and 3' UTR in a replicable RNA molecule can cooperate with an RNA replicase to amplify the replicable RNA molecule and / or an RNA molecule containing a first target sequence, an internal ribosome entry site (IRES), a second target sequence, and a 3' UTR. In some embodiments, the 5' UTR, promoter, and 3' UTR in a replicable RNA molecule can cooperate with an RNA replicase to amplify the replicable RNA molecule and an RNA molecule consisting of a first target sequence, an internal ribosome entry site (IRES), a second target sequence, and a 3' UTR. The promoter can be a subgenomic promoter (SGP) of a self-replicating virus. The RNA molecule containing a first target sequence, an internal ribosome entry site (IRES), a second target sequence, and a 3' UTR can be a subgenomic RNA molecule of a virus.

[0057] In some embodiments, the 5’UTR, promoter, and 3’UTR may be from the genome of a self-replicating virus from which the RNA replicase is derived, such as the genome of an alphavirus, flavivirus, measles virus, or rhabdovirus. In some embodiments, the 5’UTR, promoter, and 3’UTR may be from an alphavirus from which the RNA replicase is derived. In some embodiments, the 5’UTR, promoter, and 3’UTR may be from Barmah Forest virus (BFV), Bebaru virus (BEBV), Cabassou virus (CABV), Chikungunya virus (CHIKV), Eastern equine encephalitis virus (EEEV), Eilat virus (ELIV), Everglades virus (EVEV), Fort Morgan virus (FMV), Getah virus (GETV), Mayaro virus (MAYV), Mossuril virus (MDPV), Ndumu virus (NDUV), O’nyong’nyong virus (ONNV), Pixuna virus (PIXV), Ross River virus (RRV), Semliki Forest virus (SFV), Sindbis virus (SINV), Tonate virus (TONV or TV), Trocara virus (TROV), Venezuelan equine encephalitis virus (VEEV), Una virus (UNAV), Aura virus (AURV), High J virus (HJV), Madariaga virus (MADV), Mukumbu virus (MUCV), Ruhugu virus (RHGV), Rio Negro virus (RNV), Rustrela virus (RUSV), or Sagiyama virus (SAGV). In some embodiments, the 5’UTR, promoter, and 3’UTR may be from Mossuril virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV). The promoter may be a subgenomic promoter of the virus.

[0058] In some embodiments, the 5’UTR, open reading frame encoding an RNA replicase, promoter, and 3’UTR may each independently comprise a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to (1) SEQ ID NO: 11, 12, 13, and 14; (2) SEQ ID NO: 35, 36, 37, and 38; (3) SEQ ID NO: 51, 52, 53, and 54; (4) SEQ ID NO: 55, 56, 57, and 58; (5) SEQ ID NO: 59, 60, 61, and 62; (6) SEQ ID NO: 15, 16, 17, and 18; (7) SEQ ID NO: 19, 20, 21, and 22; (8) SEQ ID NO: 23, 24, 25, and 26; (9) SEQ ID NO: 27, 28, 29, and 30; (10) SEQ ID NO: 31, 32, 33, and 34; (11) SEQ ID NO: 39, 40, 41, and 42; (12) SEQ ID NO: 43, 44, 45, and 46; or (13) SEQ ID NO: 47, 48, 49, and 50, or consist of the above sequences.

[0059] A second 5’UTR may be included between the promoter and the first target sequence. The second 5’UTR may be any 5’UTR. The second 5’UTR may comprise a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 5, 6, 7, or 8. In some embodiments, the second 5’UTR may comprise a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 5. In some embodiments, the sequence of the second 5’UTR may be as shown in SEQ ID NO: 5, 6, 7, or 8. The RNA replicase may amplify an RNA molecule comprising, or consisting of, the second 5’UTR, the first target sequence, an internal ribosome entry site (IRES), the second target sequence, and the 3’UTR.

[0060] The IRES can be any suitable IRES, such as the IRES derived from coxsackievirus B3 (CVB3). The IRES of coxsackievirus B3 (CVB3) can contain the nucleotide sequence shown in SEQ ID NO:9.

[0061] The 5' cap can be a natural 5' cap or a 5' cap analog. The 5' cap analog can be Cap-AU or Cap-AG.

[0062] The poly(A) tail can contain consecutive adenosines or consist of consecutive adenosines. Alternatively, the poly(A) tail can contain 2 - 5 fragments of consecutive adenosines separated by spacer sequences, where the spacer sequences contain 1 - 20 nucleotides and each fragment of consecutive adenosines contains 10 - 100 consecutive adenosines.

[0063] In a fourth aspect, the present application provides a DNA molecule encoding the RNA molecules of the first to third aspects of the present application.

[0064] The DNA molecule can contain a first strand that, from the 5' end to the 3' end, contains a promoter and a sequence encoding the RNA molecules of the first to third aspects of the present application.

[0065] The DNA molecule can contain a second strand complementary to the first strand.

[0066] The DNA molecule can be a linear molecule.

[0067] The promoter can be an RNA polymerase promoter derived from T7 virus, T6 virus, SP6 virus, T3 virus, or T4 virus. In some embodiments, the promoter can be the T7 promoter.

[0068] In a fifth aspect, the present application provides a vector containing the DNA molecule of the fourth aspect. The vector can be a plasmid, a viral vector, etc. The vector can be circular or linear. In some embodiments, the vector can be linear. In some embodiments, the vector can be circular and processed to be linear. In some embodiments, the vector can be used to prepare the RNA molecules of the first to third aspects. The vector of the present application can transcribe a replicable RNA molecule of about 500 to about 18000 nt.

[0069] In a sixth aspect, the present application provides a cell containing the DNA molecule of the fourth aspect or the vector of the fifth aspect. The cell can be a host cell, such as a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell can be a mammalian cell.

[0070] In a seventh aspect, the present application provides a method for preparing the RNA molecules of the first to third aspects of the present application, comprising: i) providing the DNA molecule of the fourth aspect of the present application, ii) optionally, linearizing the DNA molecule, and iii) performing in vitro transcription under suitable conditions. The suitable conditions in step iii) include providing RNA polymerase, ATP, UTP, CTP, GTP, cap analogs, etc.

[0071] The present application also protects the RNA molecules prepared by the method of the present application.

[0072] In an eighth aspect, the present application provides a composition comprising the RNA molecules (including RNA combinations) of the first aspect of the present application, the RNA molecules of the second aspect of the present application, the RNA molecules of the third aspect of the present application, the DNA molecules of the fourth aspect of the present application, the cells of the sixth aspect of the present application, or the RNA molecules obtained by the method of the seventh aspect of the present application.

[0073] The RNA molecules in the composition can be encapsulated in liposomes, such as nano-liposomes.

[0074] The composition may further comprise a suitable carrier.

[0075] In some embodiments, the composition may be a pharmaceutical composition comprising an effective amount of the RNA molecules (including RNA combinations) of the first aspect of the present application, the RNA molecules of the second aspect of the present application, the RNA molecules of the third aspect of the present application, the DNA molecules of the fourth aspect of the present application, the cells of the sixth aspect of the present application, or the RNA molecules obtained by the method of the seventh aspect of the present application, and a pharmaceutically acceptable carrier.

[0076] In a ninth aspect, the present application provides a method for using the RNA molecules (including RNA combinations) of the first aspect of the present application, the RNA molecules of the second aspect of the present application, the RNA molecules of the third aspect of the present application, or the RNA molecules obtained by the method of the seventh aspect of the present application to prepare a target peptide or protein, comprising:

[0077] i) introducing the RNA molecule or RNA combination into a host cell, wherein the RNA molecule in the RNA molecule or RNA combination comprises an open reading frame encoding the target peptide or protein,

[0078] ii) culturing the host cell under appropriate conditions. The method may further include recovering the target peptide or protein from the host cell or the host cell culture medium. In some embodiments, the RNA molecule in the RNA molecule or RNA combination comprises an open reading frame encoding a tagged target peptide or protein.

[0079] Step (i) may include directly transfecting an RNA molecule or an RNA combination into a host cell, or transfecting it into the cell by liposome transfection, electroporation, or encapsulation with a nanocarrier. The nanocarrier may be, for example, a lipid, a polymer, or a lipid-polymer hybrid.

[0080] Specifically, the present application provides a method for preparing a target peptide or protein, comprising:

[0081] i) providing the RNA molecule (including the RNA combination) of the first aspect of the present application, the RNA molecule of the second aspect of the present application, the RNA molecule of the third aspect of the present application, or the RNA molecule obtained by the method of the seventh aspect of the present application, wherein the target sequence in the RNA molecule is an open reading frame encoding the target peptide or protein, and

[0082] ii) introducing the RNA molecule into the cell.

[0083] The cell may be any host cell, such as a prokaryotic cell or a eukaryotic cell. In some embodiments, the host cell may be a mammalian cell.

[0084] The method may further include culturing the host cell under appropriate conditions. The method may further include recovering the target peptide or protein from the host cell or the host cell culture medium. In the tenth aspect, the present application provides a method for treating or preventing a disease in a subject in need thereof, comprising administering the pharmaceutical composition of the present application to the subject. Among them, the RNA molecule in the RNA molecule or RNA combination of the present application in the pharmaceutical composition contains an open reading frame encoding the target peptide or protein. The target peptide or protein may be a disease-related antigen or a therapeutic agent. The disease-related antigen may be a peptide or protein on the surface of a microorganism, such as a virus, a bacterium, a mycoplasma, etc., or a tumor-related antigen. The therapeutic agent may be, for example, an antibody.

[0085] When the target peptide or protein is a peptide or protein on the surface of a microorganism, such as a virus, a bacterium, a mycoplasma, etc., the method of the present application can be used to treat or prevent diseases associated with the infection of the microorganism.

[0086] When the target peptide or protein is a tumor-related antigen or a protein targeting a tumor-related antigen, such as an antibody, the method of the present application can be used to treat a tumor associated with the tumor-related antigen.

[0087] The target peptide or protein may also be a normal protein expressed in a mammal, such as a human, which can be used for replacement therapy in a subject lacking the normal protein.

[0088] The subject may be a mammal, such as a human.

[0089] This application also protects the use of the RNA molecules (including RNA combinations) of the first aspect of this application, the RNA molecules of the second aspect of this application, the RNA molecules of the third aspect of this application, or the RNA molecules obtained by the method of the seventh aspect of this application in the preparation of the target peptide or protein, or in the treatment or prevention of related diseases, as well as the use of the DNA molecules of the fourth aspect of this application in the preparation of the corresponding RNA molecules.

[0090] In this application, the same nucleotide sequence, such as the nucleotide sequence represented by the same SEQ ID NO, can represent both a DNA sequence and an RNA sequence, with the only difference being the substitution of T with U. BRIEF DESCRIPTION OF THE DRAWINGS

[0091] Figures 1A - 1C Shows the expression levels of EGFP protein at 24 h and 48 h in HEK293T cells ( Figure 1A and 1B ) and A549 cells ( Figure 1C ) of self-replicating RNA molecules constructed based on different alphaviruses.

[0092] Figure 2 Shows the amount of EGFP protein expressed by the VEEV-TC83 self-replicating RNA molecule with different subgenomic 5' UTRs after transfection of HEK293T cells for 24 h, 48 h, 72 h, and 144 h.

[0093] Figure 3A and 3B Shows the amount of EGFP protein expressed by the VEEV-TC83 or other alphavirus self-replicating RNA that cis-expresses E3L through IRES ( Figure 3A : unmodified self-replicating RNA, Figure 3B : m5C-modified self-replicating RNA) after transfection of A549 cells for 24 h and 48 h.

[0094] Figure 4A and 4B Shows the amount of IL-6 expressed by the cells measured after transfection of A549 cells for 48 h by the VEEV-TC83 or other alphavirus self-replicating RNA that cis-expresses E3L through IRES ( Figure 4A : unmodified self-replicating RNA, Figure 4B : m5C-modified self-replicating RNA).

[0095] Figure 5 Shows the cell viability after transfection of HEK293T cells for 24 h and 48 h by the VEEV-TC83 or other alphavirus self-replicating RNA that cis-expresses E3L through IRES.

[0096] Figures 6A - 6CShows the self-replicating RNA constructed in this application for expressing the gene of interest (GOI) ( Figure 6A ), the self-replicating RNA for expressing the gene of interest (GOI) and adding a subgenomic 5' UTR ( Figure 6B ), and the schematic structure of the self-replicating RNA for expressing the gene of interest (GOI), adding a subgenomic 5' UTR, and having E3L cis-expressed by IRES ( Figure 6C ).

[0097] Figure 7 Shows the specific antibody titers in the sera of mice at different times (10, 20, 30, 40, 50, 60, 70, 80, and 90 days after immunization) after immunization with SARS-CoV-2 RBD-saRNA-LNP that cis-expresses E3L by IRES. Detailed implementation manners

[0098] The terms used herein, unless otherwise specified, have the ordinary meanings in dictionaries, textbooks, technical reference books, or the meanings commonly understood by those skilled in the art. The following descriptions of some terms are only for the purpose of facilitating the understanding of this application and are not intended to specifically limit these terms, unless otherwise specified.

[0099] As used herein and in the appended claims, the singular forms "a", "an", and "the" include the plural forms of the indicated objects, unless the context clearly dictates otherwise.

[0100] The term "or" refers to a single element among the listed alternative elements, unless the context clearly indicates otherwise.

[0101] The term "comprising" or "including" means including the stated elements, integers, or steps, but does not exclude the addition of any other elements, integers, or steps. In the text, when the term "comprising" or "including" is used, unless otherwise specified, it also covers the combination of the stated elements, integers, or steps. The term "consisting of" or "composed of" generally means containing only the stated elements, integers, or steps, and no other elements, integers, or steps may be added.

[0102] The 5' end of a nucleic acid molecule can be the end with a free phosphate group, and the 3' end can be the end with a free hydroxyl group.

[0103] "Replicable RNA" or "self-replicating RNA" in this article refers to an RNA molecule that can be amplified by an RNA replicase encoded by itself. In particular, "replicable RNA" or "self-replicating RNA" has the genome of a modified self-replicating virus, which can use itself as a template, according to the base "complementary" principle, to amplify a complementary strand, and use this complementary strand as a template to amplify the full-length copy of this RNA itself, as well as multiple non-full-length copies. The RNA molecule itself and its full-length copy can enter a new amplification cycle to amplify more full-length copies and non-full-length copies.

[0104] "Complementary" in this article means that two nucleotides or two bases can pair and bind according to the base complementary principle of A-T, A-U, C-G. When a nucleotide sequence is "complementary" to another nucleotide sequence, it can mean that the two nucleotide sequences are 100% complementary to each other, or it can mean that the two nucleotide sequences have a high degree of complementarity, such as more than 90% complementarity.

[0105] "Replication" or "amplification" in this article refers to the synthesis of an RNA molecule based on the nucleotide sequence of a specified RNA molecule. The synthesized RNA molecule can be the same as or complementary to the template RNA molecule. RNA replication may synthesize a DNA intermediate. Alphavirus RNA replication does not involve a DNA intermediate, but is mediated by an RNA-dependent RNA polymerase, and the first RNA strand or a part of it is used as a template to synthesize the second RNA strand, and the second RNA strand or a part of it can be used as a template to synthesize the third RNA strand.

[0106] "RNA replicase" in this article refers to an RNA-dependent RNA polymerase, which is an enzyme that catalyzes the synthesis of RNA using RNA as a template. Under the catalysis of the alphavirus RNA-dependent RNA polymerase, the (-) complementary strand and the (+) genomic RNA strand of the genomic RNA are synthesized in sequence, causing RNA replication. In nature, RNA-dependent RNA polymerases are usually encoded by all RNA viruses except retroviruses, such as alphaviruses. In particular, the "RNA replicase" of this application can refer to the non-structural protein of a self-replicating virus, such as an alphavirus.

[0107] "Self-replicating virus" or "self-replicating RNA virus" refers to an RNA virus that can replicate autonomously in a host cell. Self-replicating viruses can have a single-stranded RNA genome, including alphaviruses, flaviviruses, measles viruses, and rhabdoviruses. Alphaviruses and flaviviruses have a sense-strand genome, while measles viruses and rhabdoviruses are antisense-strand ssRNA. Generally speaking, self-replicating viruses are viruses with a (+) strand RNA genome that can be directly translated after infecting cells, and this translation provides an RNA-dependent RNA polymerase, which then generates sense and antisense transcripts. A "transcript" generally refers to a gene transcription product, or a transcription unit, which is a nucleotide molecule complementary to the template strand. The (+) strand or sense strand can be the strand that contains or encodes genetic information.

[0108] "Alphavirus" should be understood in a broad sense to include any viral particle with alphavirus characteristics. The characteristics of alphaviruses include the presence of a (+) strand RNA encoding genetic information suitable for replication in a host cell (including RNA polymerase activity). This term includes alphaviruses found in nature, as well as any variants or derivatives thereof.

[0109] "Non-structural protein" refers to a protein encoded by a virus that does not form part of the viral particle. This term generally includes various enzymes and transcription factors used by viruses to replicate themselves, such as RNA-dependent RNA polymerase. "Alphavirus non-structural protein" refers to each non-structural protein of alphavirus origin, such as nsP1, nsP2, nsP3, and nsP4, or their polyproteins. In some embodiments, "alphavirus non-structural protein" refers to nsP123 and / or nsP4. In other embodiments, "alphavirus non-structural protein" refers to nsP1234. A "functional variant" of a non-structural protein refers to a variant that has mutations compared to the native non-structural protein but still has the required functions of the non-structural protein.

[0110] The "promoter" in this article refers to a sequence that controls the synthesis of a transcript by providing a recognition and binding site for RNA polymerase. The promoter region can also include recognition or binding sites for other factors involved in transcriptional regulation. The promoter can be inducible, initiating transcription in response to an induction signal, or it can be constitutive. An inducible promoter causes little or no transcription in the absence of an induction signal. The promoter in this article can be a subgenomic promoter, such as the subgenomic promoter of alphavirus. Other specific promoters can be genomic (+) strand or (-) strand promoters, such as the genomic (+) strand or (-) strand promoters of alphavirus.

[0111] "Subgenomic promoter" refers to the nucleic acid sequence upstream of the target sequence (such as the open reading frame encoding the target peptide or protein) in the RNA molecule of the present application, which controls the transcription of the target sequence by providing a recognition and binding site for RNA polymerase (usually RNA-dependent RNA polymerase, especially the functional alphavirus non-structural protein). The subgenomic promoter may also contain recognition or binding sites for other factors. The subgenomic promoter is usually a genetic element of positive-strand RNA viruses. The subgenomic promoter of alphavirus is the nucleic acid sequence contained in the viral genomic RNA. The subgenomic promoter is characterized in that it enables the initiation of transcription, i.e., RNA synthesis, in the presence of RNA-dependent RNA polymerase (such as the functional non-structural protein). The RNA (-) strand, i.e., the complementary strand of the alphavirus genomic RNA, serves as a template for the synthesis of the (+) strand subgenomic transcript, and the synthesis of the (+) strand subgenomic transcript usually starts from or around the subgenomic promoter.

[0112] "Subgenomic RNA" or "subgenomic transcript" refers to an RNA molecule transcribed from a viral RNA genomic molecule and containing a sequence encoding a viral structural protein or a target sequence substituting the viral structural protein coding sequence, wherein the template RNA contains a subgenomic promoter that controls the transcription of the subgenomic transcript. The subgenomic transcript can be obtained in the presence of RNA-dependent RNA polymerase, especially the functional alphavirus non-structural protein. For example, the term "subgenomic transcript" can refer to an RNA transcript prepared using the complementary strand of the alphavirus genomic RNA as a template in alphavirus-infected cells and not containing the sequence encoding the viral non-structural protein. The subgenomic transcript can also be obtained by using the (-) complementary strand of the transcript containing the subgenomic promoter as a template. Thus, "subgenomic transcript" refers to an RNA molecule obtained by transcribing a fragment of the alphavirus genomic RNA and an RNA molecule obtained by transcribing a fragment of the replicon.

[0113] "Open reading frame" or "ORF" refers to a continuous base sequence starting from the start codon and ending at the stop codon, which can encode a complete polypeptide chain. In the mRNA sequence, every three consecutive bases (i.e., the triplet "codon") encode the corresponding amino acid. There is one start codon AUG and three stop codons UAA, UAG, and UGA. The ribosome starts translation from the start codon, synthesizes and extends the polypeptide chain along the mRNA sequence, and when it encounters the stop codon, the extension reaction of the polypeptide chain terminates.

[0114] "UTR" or "untranslated region" refers to the sequences located at both ends of a nucleic acid that are not translated. Specifically, the UTR located at the 5' end of a nucleic acid is called the 5'UTR, which usually starts from the 5' cap and extends to the start codon AUG, while the 3'UTR usually extends from the stop codon at the end of the coding region to the poly(A) tail. The nucleotide sequences of the 5' and 3' UTRs of viral genomes are highly conserved and usually form stem-loop or hairpin structures that contain cis-acting elements, which are mainly responsible for regulating the translation of viral proteins and the replication of viral genomes.

[0115] The "5' cap", also known as the 7-methylguanylate cap and abbreviated as m7G, usually plays a recognition role in the entry and exit of RNA from the nucleus and helps ribosomes recognize and bind to mRNA during translation.

[0116] The "poly(A) tail" is a sequence composed of multiple adenylate residues that can help avoid enzymatic degradation in the cytoplasm and contribute to transcriptional termination, as well as the export and translation of mRNA from the nucleus. The poly(A) tail can refer to a continuous poly(A) tail or a segmented poly(A) tail. A continuous poly(A) tail can contain consecutive adenylate residues. A segmented poly(A) tail can contain 2 - 5 consecutive adenylate fragments separated by spacer sequences, where the spacer sequences contain 1 - 20 nucleotides, each consecutive adenylate fragment contains 10 - 100 consecutive adenylate residues, and the two ends of the spacer sequence are non-A bases and the middle can be an A base or a non-A base.

[0117] "Internal ribosome entry site" or "IRES" refers to an RNA sequence that forms a secondary structure to attract the precursor of the transcriptional initiation complex to the translation initiation codon, such as AUG. IRES is usually located in the 5' UTR of RNA viruses and may also appear at other positions of mRNA. However, the mRNA of the dicistroviridae virus has two open reading frames, and the translation of each open reading frame can be guided by two different IRESs. Some mammalian intracellular mRNAs also have IRESs, which may be located in the mRNAs of genes encoding for stress response and other genes crucial for survival. IRESs also exist in picornaviruses and some pathogen viruses, including human immunodeficiency virus, hepatitis C virus, hand, foot and mouth disease virus, etc. Although these viral IRESs contain different sequences, many have similar secondary structures and initiate translation through similar elements. There are 4 classes of IRESs. The common feature of classes I-III IRESs is that they initiate translation at the AUG start codon, while class IV IRESs initiate translation at a non-AUG codon (such as GCU). Classes I-III IRESs require the initiator tRNA that delivers methionine with the help of eIF2 / GTP (eIF2 / GTP / Met-tRNAiMet). Activation of eIF2 under stress phosphorylates the α subunit of eIF2, which inhibits translation initiation at AUG. Translation guided by class IV IRESs is not inhibited by eIF2 phosphorylation.

[0118] "Immunosuppressive protein" refers to a protein that can inhibit or limit the immune response of a cell or an organism, such as "interferon inhibitory protein" or "IIP". The immunosuppressive protein or interferon inhibitory protein can reduce the immune response of a cell or an organism, such as the production of interferon, and reduce the immunogenicity of self-replicating RNA.

[0119] As used herein, "identity" or "sequence identity" refers to the percentage of nucleotides / amino acids in a sequence that are identical to the nucleotides / amino acid residues in a reference sequence after sequence alignment. If necessary, spaces are introduced in the sequence alignment to achieve the maximum percentage of sequence identity between the two sequences. Those skilled in the art can use various methods, such as using computer software, to perform pairwise sequence alignment or multiple sequence alignment to determine the percentage of sequence identity between two or more nucleic acid or amino acid sequences. Such computer software includes, for example, ClustalOmega, T-coffee, Kalign, and MAFFT, etc.

[0120] The term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, such as mammals and non-mammals, such as non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles, although mammals, such as non-human primates, sheep, dogs, cats, cows, and horses, are preferred.

[0121] The term "effective amount" refers to the amount of the RNA molecule or combination of RNAs of the present application used to achieve the desired result. "Therapeutically effective amount" refers to the amount of the RNA molecule or combination of RNAs of the present application sufficient to prevent or alleviate the symptoms associated with a disease or disorder. The effective amount or therapeutically effective amount is related to the specific scenario, in which those skilled in the art can conveniently determine the actual effective amount.

[0122] "Conserved sequence element" or "CSE" refers to a nucleotide sequence in a self-replicating virus such as alphavirus RNA. These sequence elements are "conserved" because orthologs are present in the genomes of different alphaviruses. In particular, orthologous CSEs of different alphaviruses share a high percentage of sequence identity and / or similar secondary or quaternary structures. The term CSE includes CSE1, CSE2, CSE3, and CSE4.

[0123] "CSE1" is required for the synthesis of the (+) strand from the (-) strand template. "CSE1" refers to the sequence on the (+) strand, and the complementary sequence of CSE1 on the (-) strand serves as the promoter for the synthesis of the (+) strand. In particular, CSE1 includes the nucleotides at the most 5' end of the alphavirus genome. CSE1 usually forms a conserved stem-loop structure. Without being bound by theory, it is believed that the secondary structure of CSE1 is more important than the primary structure. In the genomic RNA of Sindbis virus, CSE1 consists of a conserved sequence of 44 nucleotides, which is composed of the most 5' 44 nucleotides of the genomic RNA (Strauss & Strauss, (1994) Microbiol. Rev. 58:491-562).

[0124] "CSE2" refers to the nucleotide sequence required for the synthesis of the (-) strand from the (+) strand template. The (+) strand template is usually the alphavirus genomic RNA or RNA replicon. Subgenomic RNA replicons, which do not contain CSE2, thus do not serve as templates for the synthesis of the (-) strand. In the alphavirus genomic RNA, CSE2 is usually located within the coding sequence of nsP1. In the genomic RNA of Sindbis virus, CSE2 consists of 51 nucleotides and is located at nucleotide positions 155-205 of the genomic RNA (Frolov et al., (2001) RNA 7:1638-1651). CSE2 usually forms two conserved stem-loop structures. Without being bound by theory, it is believed that the secondary structure of CSE2 is more important than the primary structure.

[0125] "CSE3" refers to a nucleotide sequence derived from alphavirus genomic RNA and containing the start site of the subgenomic RNA. CSE3 initiates the transcription of the subgenomic RNA on the (-) complementary strand. In alphavirus genomic RNA, CSE3 usually overlaps with the region encoding the C-terminal fragment of nsP4 and extends into a short non-coding region upstream of the open reading frame encoding the structural proteins.

[0126] "CSE4" generally refers to a nucleotide sequence on alphavirus genomic RNA, adjacent upstream of the alphavirus genomic poly(A). CSE4 usually consists of 19 consecutive nucleotides. Without being bound by theory, CSE4 is considered to be the core promoter for initiating (-) strand synthesis (José et al., (2009) Future Microbiol 4:837-856); and / or the CSE4 and poly(A) tail sequences in alphavirus genomic RNA are considered to act together for efficient (-) strand synthesis (Hardy & Rice, (2005), J. Virol. 79:4630-4639).

[0127] "In cooperation with the RNA replicase" means that there are sequences in the RNA molecule that can be recognized and bound by the RNA replicase, such as CSE1, CSE2, CSE3, and / or CSE4, so that the RNA replicase can initiate the amplification program through these sequences.

[0128] Alphavirus is an enveloped positive-strand RNA virus, and its hosts include many organisms, including insects, fish, mammals, such as livestock and humans. Alphavirus can replicate in the cytoplasm of infected cells. The genomes of many alphaviruses are in the range of 11,000 - 12,000 nt in length, and the genomic RNA usually has a 5' cap and a 3' poly(A) tail. The genome of alphavirus encodes non-structural proteins and structural proteins, where the non-structural proteins are involved in viral RNA transcription, modification, replication, and protein modification, etc., and the structural proteins are used to form virus particles. There are usually two open reading frames (ORFs) in the genome. Four non-structural proteins (nsP1 - nsP4) are usually encoded by the first ORF near the 5' end of the genome, while the structural proteins are encoded by the second ORF. Generally speaking, the first ORF is larger than the second ORF.

[0129] In cells infected with alphaviruses, only non-structural proteins are translated from the genomic RNA, while structural proteins are translated from subgenomic transcripts. After infection, at the beginning of the viral cycle, the (+) strand genomic RNA directly translates the first ORF. In some alphaviruses, there is a UGA stop codon between the coding sequences of nsP3 and nsP4. When translation terminates at UGA, the polyprotein P123 is generated, and when UGA is translated, the polyprotein P1234 is generated. nsP1234 is hydrolytically cleaved into nsP123 and nsP4. The polypeptides nsP123 and nsP4 form a (-) strand RNA-dependent RNA polymerase complex, which then transcribes (-) strand RNA using the (+) strand genomic RNA as a template. Generally, in a subsequent stage, nsP123 is completely cleaved into the individual proteins nsP1, nsP2, and nsP3. The four proteins bind to form a (+) strand RNA-dependent RNA polymerase complex, which transcribes new (+) strand genomic and subgenomic RNAs using the (-) strand RNA as a template. The subgenomic RNA, as well as the new genomic RNA, has a 5' cap through nsP1 and a poly(A) tail through nsP4. The structures of both the subgenomic RNA and the genomic RNA are similar to those of mRNA.

[0130] The synthesis of alphavirus RNA is regulated by cis-acting RNA elements, including four conserved sequence elements (CSEs). The alphavirus genome contains these four CSEs, which are important for viral RNA replication in host cells. CSE1, located at or near the 5' end of the viral genome, is thought to be the promoter for the synthesis of (+) strand from (-) strand. CSE2, downstream of CSE1, near the 5' end, within the coding sequence of nsP1, is thought to be the promoter for the synthesis of (-) strand RNA from genomic RNA. Subgenomic RNA transcripts do not contain CSE2 and thus do not serve as templates for (-) strand synthesis. CSE3 is located at the junction of the coding sequences of non-structural and structural proteins and is the core promoter for efficient transcription of subgenomic transcripts. In some embodiments, the subgenomic promoter is the same as, overlaps with, or contains CSE3. CSE4, located in the 3' untranslated region upstream of poly(A), is thought to be the core promoter for initiating (-) strand synthesis. CSE4 and the poly(A) tail are thought to act together for efficient (-) strand synthesis.

[0131] Taking advantage of the self-replicating property of alphaviruses, self-replicating RNA molecules carrying exogenous target genes have been constructed. That is, the genome of the positive-sense single-stranded virus is modified by replacing the viral structural protein sequence with the exogenous target gene. This self-replicating RNA enables the in vitro synthesized RNA to be continuously amplified in cells, achieving persistent expression of the exogenous target protein. In the past, each RNA vaccine required 30 - 100 micrograms of RNA, with two injections separated by several weeks. Using this self-replicating RNA, the injection dose can be greatly reduced to several micrograms.

[0132] Currently, self-replicating RNAs modified from Venezuelan equine encephalitis virus (VEEV), Sindbis virus (SINV), and Semliki Forest virus (SFV) are the most commonly used in the field. TC83, as an attenuated mutant strain of VEEV, has a long usage record in FDA IND human clinical trials. In recent years, self-replicating mRNAs based on this mutant strain have also been used in vaccine research and shown good results.

[0133] The inventors of the present application screened numerous members of the Togaviridae family, including Barmah Forest virus (BFV), Bebaru virus (BEBV), Cabassou virus (CABV), Chikungunya virus (CHIKV), Eastern equine encephalitis virus (EEEV), Eilat virus (ELIV), Everglades virus (EVEV), Fort Morgan virus (FMV), Getah virus (GETV), Mayaro virus (MAYV), Mosso das Pedras virus (MDPV), Ndumu virus (NDUV), O'nyong'nyong virus (ONNV), Pixuna virus (PIXV), Ross River virus (RRV), Semliki Forest virus (SFV), Sindbis virus (SINV), Tonate virus (TONV or TV), Trocara virus (TROV), Una virus (UNAV), Aura virus (AURV), Highlands J virus (HJV), Madariaga virus (MADV), Mukumbu virus (MUCV), Ruhugu virus (RHGV), Rio Negro virus (RNV), Rustrela virus (RUSV), and Sagiyama virus (SAGV), etc. Finally, replicons with performance superior to VEEV-TC83 (L01443.1) were screened out. Specifically, by replacing the structural protein sequences of each virus with a reporter gene (such as the sequence encoding EGFP), after transfection of HEK293T or A549 cells for 24 h and 48 h, the fluorescence intensity was observed and analyzed by fluorescence microscopy. It was found that for the self-replicating RNAs based on BEBV, CABV, EVEV, FMV, GETV, MDPV, NDUV, PIXV, TONV, TROV, HJV, MUCV, and RNV viruses, the EGFP expression level was significantly higher than that of the self-replicating EGFP RNA based on VEEV-TC83, as Figures 1A - 1C shown. In addition, it can also be seen from Figure 3A and 3B that for the self-replicating RNAs based on VEEV-TC83 with basically the same structure, the EGFP expression level was much lower than that of the self-replicating RNAs based on, for example, MDPV, EVEV, HJV, MUCV, and RNV. In addition, during the synthesis of the relevant DNA and the preparation of these self-replicating RNAs by in vitro transcription, it was found that the transcription purity of the BEBV, CABV, EVEV, FMV, GETV, MDPV, PIXV, TONV, TROV, HJV, MADV, RHGV, and SAGV RNA molecules was relatively high.

[0134] Thus, in one aspect of the present application, a replicable RNA molecule is provided, which may comprise a 5' cap, 5' UTR, open reading frame encoding an RNA replicase, promoter, target sequence, 3' UTR, and poly(A) tail from the 5' end to the 3' end, wherein the RNA replicase is capable of amplifying the replicable RNA molecule and the RNA molecule containing the target sequence and 3' UTR, and the RNA replicase may be a non-structural protein or a functional variant thereof derived from Mossur das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mucambo virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV).

[0135] The non-structural proteins derived from the above viruses have activities such as protease, helicase, terminal adenylyl transferase, methyltransferase, and / or guanylyl transferase in addition to RNA-dependent RNA polymerase activity. For example, nsP1 can add a 5' cap to the newly generated genomic RNA and subgenomic RNA, and nsP4 can add a poly(A) tail to the newly generated genomic RNA and subgenomic RNA. Thus, the structures of the newly generated subgenomic RNA and genomic RNA are similar to those of mRNA.

[0136] The non-structural proteins of alphaviruses may require specific sequences in the genome, such as CSE1, CSE2, CSE3, and / or CSE4, to initiate the amplification process. Thus, the 5' UTR, promoter, and / or 3' UTR in the replicable RNA molecule need to be able to cooperate with the RNA replicase (non-structural protein) for the amplification of genomic and subgenomic RNA. That is, the RNA replicase (non-structural protein) can recognize and bind to certain sequences in the replicable RNA molecule to initiate amplification. In some embodiments, the 5' UTR, promoter, and 3' UTR may be from the same virus as the RNA replicase, such as the genome of Mossur das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mucambo virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV). The promoter here may be the subgenomic promoter (SGP) of the above viruses.

[0137] In addition to cis-acting self-replicating RNAs, there are alphavirus-based trans-replication systems that rely on alphavirus nucleotide sequence elements on two separate nucleic acid molecules. Specifically, one RNA molecule can encode a viral RNA-dependent RNA polymerase (usually as the polyprotein nsP1234), and another RNA molecule can be trans-replicated by the RNA-dependent RNA polymerase (hence called trans-replication). Trans-replication requires the simultaneous presence of both RNA molecules in the host cell. The nucleic acid molecule that can be trans-replicated by the RNA-dependent RNA polymerase must contain certain alphavirus sequence elements so that the RNA-dependent RNA polymerase can recognize and carry out RNA synthesis.

[0138] The Mosdaspedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukamba virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV) discovered in the present application are also applicable to constructing a trans-replication system. Specifically, the present application can provide an RNA combination, which includes a first RNA molecule and a second RNA molecule. The first RNA molecule may include a 5' cap, 5' UTR, open reading frame encoding an RNA replicase, 3' UTR, and poly(A) tail from the 5' end to the 3' end. The second RNA molecule may include a 5' cap, 5' UTR, conserved sequence element, promoter, target sequence, 3' UTR, and poly(A) tail. The RNA replicase may be a non-structural protein derived from the Mosdaspedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukamba virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV), or a functional variant thereof. The RNA replicase in the first RNA molecule is capable of amplifying the second RNA molecule. The 5' UTR, conserved sequence element, promoter, and / or 3' UTR in the second RNA molecule can cooperate with the RNA replicase for the amplification of the second RNA molecule. In particular, the 5' UTR, conserved sequence element, promoter, and 3' UTR in the second RNA molecule may be from the same virus as the RNA replicase, such as the genome of the Mosdaspedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukamba virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV). The promoter may be a subgenomic promoter of the virus.

[0139] In some embodiments, the second RNA molecule may comprise, from the 5'-end to the 3'-end, a 5' cap, a 5' UTR, a conserved sequence element, a promoter, a target sequence, a 3' UTR, and a poly(A) tail. In some embodiments, the second RNA molecule may comprise, from the 5'-end to the 3'-end, a 5' cap, a 5' UTR, a first conserved sequence element, a second conserved sequence element, a promoter, a target sequence, a 3' UTR, and a poly(A) tail. The first conserved sequence element and the second conserved sequence element may be conserved sequence element 2 and conserved sequence element 3 obtained from the respective corresponding virus, respectively. In some embodiments, the conserved sequence element may overlap completely or partially with the subgenomic promoter of the virus and / or the UTR (especially the 5' UTR).

[0140] The RNA replicase in the first RNA molecule may have the ability to amplify the first RNA molecule. In particular, the 5' UTR and / or the 3' UTR of the first RNA molecule may be from the same virus as the RNA replicase.

[0141] The first RNA molecule may also be a non-replicating RNA. Through a series of modifications and optimizations, such as by adding a β-s-ARCA (D2) cap, a human α-globin 5' UTR, etc., the non-replicating RNA can have a longer half-life and a higher translation efficiency. Using such non-replicating first RNA and the above-mentioned second RNA, the overall effect is similar to the protein expression effect of the cis-acting self-replicating RNA (Beissert T et al., (2020) Mol Ther. 28(1):119-128).

[0142] During the replication process of the self-replicating RNA, the RNA polymerase complex first synthesizes a complementary negative-strand RNA intermediate from the sense-strand RNA, and then, using the latter as a template, synthesizes two different positive-strand RNAs. The first positive-strand RNA is a copy of the original full-length RNA, and the second positive-strand RNA is a large number of subgenomic RNAs encoding the target gene. The RNA polymerase complex will cap and poly(A)-tail the latter, and finally translate the target protein.

[0143] The translation regulation of the subgenome is the same as that of conventional mRNA, and is regulated by capping, UTR, and poly(A) tail. The inventors of the present application attempted to add a 5' UTR downstream of the subgenomic promoter to see if it could further improve the expression level of the foreign gene protein of the self-replicating RNA.

[0144] Thus, in one aspect, the present application provides a replicable RNA molecule that may comprise, from the 5'-end to the 3'-end, a 5' cap, a 5' UTR, an open reading frame encoding an RNA replicase, a promoter, a second 5' UTR, a sequence of interest, a 3' UTR, and a poly(A) tail, wherein the RNA replicase is capable of amplifying the replicable RNA molecule, as well as an RNA molecule containing the second 5' UTR, the sequence of interest, and the 3' UTR. The RNA replicase may be a non-structural protein derived from a replicating virus or a functional variant thereof. The promoter may be a subgenomic promoter of a virus.

[0145] The inventors selected 4 different UTRs, each containing the nucleotide sequence shown in SEQ ID NO: 5, 6, 7, or 8. It was found that regardless of which UTR was added downstream of the subgenomic promoter, the expression level of EGFP after transfection of cells was greatly increased compared to that of an RNA without a UTR between the subgenomic promoter and the sequence of interest, as Figure 2 shown.

[0146] In addition, similarly to the above, the 5’UTR, promoter, and / or 3’UTR in the replicable RNA molecule need to cooperate with the RNA replicase for the replicable RNA molecule, and / or for the amplification of an RNA molecule containing a second 5’UTR, a target sequence, and a 3’UTR, or consisting of a second 5’UTR, a target sequence, and a 3’UTR. In particular, the 5’UTR, promoter, and 3’UTR can be derived from the genome of the same self-replicating virus, such as the genome of alphavirus, flavivirus, measles virus, or rhabdovirus. In some embodiments, the 5’UTR, promoter, and 3’UTR can be derived from the genome of alphavirus with the RNA replicase. In some embodiments, the 5’UTR, promoter, and 3’UTR can be derived from the genome of Mosquito Das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV). The promoter can be a subgenomic promoter of the virus. The replication of self-replicating RNA starts with the RNA polymerase complex synthesizing a complementary negative-strand RNA intermediate from the sense-strand RNA. This dsRNA amplification intermediate will be recognized by the natural immune-related signaling pathways in cells, inducing a strong natural immune response, such as a type I interferon response caused by endosomal sensing mediated by TLR3, 7, and 8 and cytoplasmic sensing mediated by MDA5, RIG-I, PKR, OSA, etc. This is also the main reason for the strong immunogenicity of self-replicating RNA. Although this may be beneficial in terms of the recruitment and activation of antigen-presenting cells and adaptive immune system cells, interferon activation will cause the translational inhibition and degradation of intracellular mRNA, including the translational inhibition and degradation of the genomic RNA and subgenomic RNA of self-replicating RNA. Therefore, how to control the immunogenicity of self-replicating RNA, while promoting the recruitment and activation of downstream immune responses and reducing the negative impact on antigen expression, is an urgent problem in the field. In 2017, Ugur Sahin, for the first time, co-delivered a non-replicating mRNA combination encoding the vaccinia virus immune escape proteins E3 / K3 / B18 proteins with saRNA encoding luciferase to relieve the inhibitory effect of saRNA translation. This method significantly inhibited the PKR and IFN pathways in cells and greatly enhanced the translation efficiency of luciferase encoded by saRNA in mice.In 2021, Robin J. Shattock et al. cis-expressed the innate immune interferon inhibitory protein (IIP) through 2A peptides to screen for IIPs that could effectively enhance the expression and immunogenicity of saRNA target proteins. The paramyxovirus PIV5 protein and MERS ORF4a protein encoded by cis-acting could increase the expression level of exogenous gene proteins at the cellular level and in mice, and reduce the immunogenicity of saRNA encoding rabies virus G glycoprotein in rabbits.

[0147] In this application, the inventors attempted to reduce the immunogenicity of self-replicating RNA molecules by adding an exogenous gene and an immunosuppressive protein coding sequence to the subgenomic open reading frame and adding an IRES between the two. It was found that when such self-replicating RNA was transfected into cells for 48 h, the IL-6 expression level of the cells was comparable to that of the blank / negative control, and the cell viability at 24 h and 48 h of transfection was very high, comparable to that of the blank / negative control. It can be seen that cis-expression of immunosuppressive proteins can reduce the immunogenicity induced by self-replicating RNA, reduce the innate immunity of cells caused by it, and minimize the toxicity to cells.

[0148] In addition, the inventors also found that by adding an IRES between the exogenous gene and the immunosuppressive protein coding sequence, compared with the 2A peptides used in other studies, no additional amino acids remained on the exogenous gene protein, and no uncleaved fusion protein appeared, with higher safety.

[0149] Thus, in one aspect, the present application provides a replicable RNA molecule that may comprise a 5' cap, 5' UTR, an open reading frame encoding an RNA replicase, a promoter, a first target sequence, an internal ribosome entry site (IRES), a second target sequence, 3' UTR, and a poly(A) tail from the 5' end to the 3' end, wherein the RNA replicase is capable of amplifying the replicable RNA molecule and the RNA molecule containing the first target sequence, internal ribosome entry site (IRES), second target sequence, and 3' UTR. The RNA replicase may be a non-structural protein derived from a replicating virus or a functional variant thereof.

[0150] Specifically, the 5' UTR, promoter, and 3' UTR may be derived from the genome of the same self-replicating virus, such as the genome of an alphavirus, flavivirus, measles virus, or rhabdovirus.

[0151] One of the first target sequence and the second target sequence may be an open reading frame encoding an immunosuppressive protein. For example, the first target sequence is an open reading frame encoding a target peptide or protein, and the second target sequence is an open reading frame encoding an immunosuppressive protein; or the first target sequence is an open reading frame encoding an immunosuppressive protein, and the second target sequence is an open reading frame encoding a target peptide or protein. The target peptide or protein may be a disease-related antigen or a therapeutic agent.

[0152] Compared with traditional self-replicating RNAs, the self-replicating RNAs of the present application are applicable not only to applications such as tumor immunity or vaccines, but also to applications such as antibody immunotherapy, protein replacement therapy, and gene editing due to their lower immunogenicity. For example, in gene editing, Cas9 protein can be expressed intracellularly by self-replicating RNA.

[0153] The beneficial technical effects of the present application include: 1) new virus replicons are screened out, which have higher replication and expression capabilities and / or in vitro transcription efficiency; 2) the 5' UTR sequence of conventional mRNA is introduced before the target sequence of the self-replicating RNA to further enhance the expression of foreign proteins; 3) the immunosuppressive protein is cis-expressed through the IRES element, reducing the immunogenicity of the self-replicating RNA and further enhancing the expression of foreign proteins.

[0154] The biggest challenge for self-replicating RNA molecules as therapeutic or prophylactic agents lies in how to deliver a sufficient amount of RNA molecules to target cells or target tissues. The self-replicating RNA construct is a relatively large anionic molecule about 9000 - 15,000 nt in length and cannot be efficiently taken up by cells. Although naked saRNA can also be used, the three main delivery platforms are polymeric nanoparticles, lipid nanoparticles, and nanoemulsions. The delivery strategy is basically to condense the anionic saRNA into nanoparticles of about 100 nm with a cationic carrier, which can protect the saRNA from degradation and can be taken up into target cells (Blakney AK, Ip S, Geall AJ. (2021). Vaccines (Basel). 9(2):97). In the present application, the self-replicating RNA encapsulated with lipid nanoparticles can induce the production of antibodies more persistently in animals.

[0155] The technical solutions of the present invention will be further described in detail below through examples and in conjunction with the accompanying drawings. Unless otherwise specified, the methods and materials described in the following examples are conventional products that can be obtained through market purchase. Those skilled in the art to which the present invention pertains will understand that the methods and materials described below are merely exemplary and should not be regarded as limiting the scope of the present invention.

[0156] Example 1. Construction and characterization of virus replicon - based self - replicating RNA

[0157] The virus includes Bama Forest virus (BFV), Bebaru virus (BEBV), Kabasu virus (CABV), Chikungunya virus (CHIKV), Eastern equine encephalitis virus (EEEV), Eilat virus (ELIV), Everglades virus (EVEV), Fort Morgan virus (FMV), Geta virus (GETV), Mayaro virus (MAYV), Mosso das Pedras virus (Mosso das Pedras virus) Replicons of the alphavirus family, including Pedras, MDPV), Ndumu virus (NDUV), O'Negro virus (ONNV), Pixuna virus (PIXV), Ross River virus (RRV), Semliki Forest virus (SFV), Sindbis virus (SINV), Tonate virus (TONV or TV), Trocara virus (TROV), Una virus (UNAV), Aura virus (AURV), Highland J virus (HJV), Madariaga virus (MADV), Mukambu virus (MUCV), Ruhugu virus (RHGV), Rio Negro virus (RNV), Rustrelela virus (RUSV) and Sagittaria virus (SAGV), were tested to screen for viruses that are more suitable than the attenuated mutant strain TC83 of Venezuelan equine encephalitis virus (VEEV) for constructing self-replicating RNA for expressing foreign proteins.

[0158] In brief, the DNA genome sequences corresponding to the above viruses were taken, a T7 promoter was added to the 5' end, the sequence encoding the viral structural protein in the genome was replaced with the sequence encoding EGFP, and a polyA sequence consisting of 68 A's was added to the 3' end of the genome sequence, such as Figure 6A As shown. That is, the modified coding chain DNA fragment contains T7 mini promoter sequence (SEQ ID NO: 1), viral 5'UTR sequence, sequence encoding viral non-structural protein nsP1-4, viral subgenomic promoter, sequence encoding EGFP (SEQ ID NO: 2), viral 3'UTR sequence, polyA sequence, and restriction enzyme site sequence for plasmid linearization from 5' to 3' end. The genomic DNA sequence accession number corresponding to each virus, the position of the nucleotides used to encode structural proteins and replaced by the EGFP coding sequence in the genomic DNA sequence, and the restriction enzyme site sequence are all listed in the following Table 1.

[0159] Table 1. Corresponding genomic DNA sequences and vector construction information of members of the alphavirus family

[0160]

[0161]

[0162]

[0163]

[0164]

[0165] The above DNA fragments and their complementary strands were synthesized and cloned into the pUC57-mini-Kana-BsmBI terminatorless-T7 deletion vector (GenScript) respectively. The obtained pUC57-saRNA plasmid was transformed into competent cells, inoculated on a Kana-resistant plate for screening. Single colonies were picked, and clones with correct sequences were screened by Sanger sequencing. All the above experiments were conducted by Nanjing Genscript Biotech Co., Ltd.

[0166] The pUC57-saRNA plasmid was taken and digested with the corresponding restriction endonuclease targeting SEQ ID NO: 3 or SEQ ID NO: 4 to linearize the plasmid. The linearized plasmid was recovered by two alcohol precipitation methods, its concentration was measured by Nanodrop, and 1% agarose gel electrophoresis was performed. The electrophoresis results showed that the band of the linearized product was single and there were no obvious impurity bands.

[0167] The transcription system was prepared according to Table 2 (adding CTP or modified 5-Me-CTP) to perform in vitro transcription (ITV) on the obtained linearized plasmid. Specifically, the transcription system in Table 2 was incubated at 37 °C for 3 h. Then, 2 μl of DNase I was added, mixed well, and incubated at 37 °C for 30 min to obtain the transcription stock solution.

[0168] Table 2. In vitro transcription system

[0169]

[0170] 22 μl of enzyme-free water and 20 μl of 8 M LiCl solution were added to the IVT stock solution to make the LiCl concentration 2.5 M. After mixing well, it was incubated in a -20 °C refrigerator for more than 30 min. Centrifuged at 4 °C and 12000 g for 15 min, and the supernatant was discarded. 1 ml of 75% ethanol was added, inverted and mixed well, centrifuged at 4 °C and 12000 g for 5 min, the supernatant was discarded, and this was repeated once. Centrifuged at 4 °C and 12000 g for 2 min, the supernatant was completely aspirated, 100 μl of enzyme-free water was added to dissolve the RNA, and the RNA concentration was detected on Nanodrop. The results showed that except for EEEV, RNA products could be transcribed, including unmodified RNA products and RNA products containing m5C modification.

[0171] Subsequently, capillary electrophoresis was performed on each RNA product using the Agilent 5200 Fragment Analyzer system. Specifically, an RNA analysis kit (Agilent, DNF-472-1000) was used to detect the RNA length and integrity according to the instructions of the Agilent 5200 Fragment Analyzer and the RNA kit. The results showed that except for the unsuccessful transcription of EEEV and the abnormal peak shape of RRV due to abnormal transcription yield, the integrity of the transcription products in the remaining groups was above 80%.Specifically, the purity of the unmodified complete products of Bebaru virus (BEBV), Barmah Forest virus (BFV), Cabassou virus (CABV), Chikungunya virus (CHIKV), Eilat virus (ELIV), Everglades virus (EVEV), Fort Morgan virus (FMV), Getah virus (GETV), Mayaro virus (MAYV), Mosquito das Pedras virus (MDPV), Ndumu virus (NDUV), O'nyong'nyong virus (ONNV), Pixuna virus (PIXV), Ross River virus (RRV), Semliki Forest virus (SFV), Sindbis virus (SINV), Tonate virus (TONV or TV), Trocara virus (TROV), Una virus (UNAV), Aura virus (AURV), Highlands J virus (HJV), Madariaga virus (MADV), Mukamba virus (MUCV), Ruhugu virus (RHGV), Rio Negro virus (RNV), Rustrela virus (RUSV), Sagiyama virus (SAGV), and Venezuelan equine encephalitis virus (VEEV) are 95.7%, 95.6%, 94.0%, 88.0%, 99.5%, 92.3%, 99.9%, 95.8%, 93.3%, 99.5%, 89.5%, 91.0%, 96.6%, 78.3%, 96.8%, 96.6%, 91.2%, 93.9%, 97.1%, 90.5%, 94.1%, 96.4%, 89.2%, 98.0%, 84.7%, 92.2%, 97.3%, and 85.4% respectively; the purity of the m5C-modified complete products of Aura virus (AURV), Bebaru virus (BEBV), Cabassou virus (CABV), Eilat virus (ELIV), Everglades virus (EVEV), Fort Morgan virus (FMV), Getah virus (GETV), Highlands J virus (HJV), Madariaga virus (MADV), Mosquito das Pedras virus (Mosso das Pedras, MDPV), Mukamba virus (MUCV), Ndumu virus (NDUV), Pixuna virus (PIXV), Ruhugu virus (RHGV), Rio Negro virus (RNV), Rustrela virus (RUSV), Sagiyama virus (SAGV), Tonate virus (TONV), Trocara virus (TROV), and Venezuelan equine encephalitis virus (VEEV) are: 85.0%, 95.7%, 94.0%, 92.0%, 95.5%, 94.0%, 95.0%, 93.5%, 84.0%, 95.0%, 90.7%, 96.7%, 92.5%, 96.7%, 80.9%, 97.4%, 98.2%, 88.1%, 97.7%, and 85.7% respectively.

[0172] Further, the RNA purified from each group of LiCl was transfected into HEK293T cells and A549 cells for expression testing. Specifically, HEK293T cells in the logarithmic growth phase were seeded in a 96-well plate at 2×10 4 cells per well and cultured in an incubator at 37°C and 5% CO2 for about 30 h. Lipofectamine TM MessengerMAX TM transfection reagent (ThermoFisher, LmRNA015) was used for transfection when the cell confluence reached about 70 - 90%. The transfection complex was prepared, and the addition amounts of the transfection reagent and mRNA are shown in Table 3. After mixing Solution A and Solution B and incubating at room temperature for 10 min, 10 μL of the mixture was added to each well, and the cells were cultured in an incubator at 37°C and 5% CO2.

[0173] Table 3. Preparation table of transfection reagent

[0174]

[0175] After 24 h and 48 h of culture after transfection, photos were taken with a fluorescence microscope (Mshot, MF53-N), and the fluorescence intensity was analyzed. The expression results in HEK293T cells are shown in Figure 1A and 1B . For the unmodified and m5C-modified self-replicating RNAs constructed based on BEBV, CABV, EVEV, FMV, GETV, MDPV, NDUV, PIXV, TONV, TROV, HJV, MUCV, and RNV viruses, the EGFP expression levels were significantly higher than those of the self-replicating RNAs constructed based on other viruses, including the self-replicating RNA based on VEEV-TC83; the expression results in A549 cells are shown in Figure 1C . The unmodified and m5C-modified self-replicating RNAs constructed from EVEV, HJV, MDPV, MUCV, NDUV, PIXV, and RNV showed better expression in immunogenicity-sensitive A549 cells, indicating that the self-replicating RNAs constructed from these viruses may have lower immunogenicity. As shown in Figure 1B , the m5C-modified self-replicating RNAs constructed based on BEBV, CABV, EVEV, FMV, GETV, HJV, PIXV, SAGV, and TONV viruses had higher expression levels in HEK293T cells than the unmodified self-replicating RNAs.

[0176] Example 2. Addition of the 5’UTR upstream of the sub - genomic sequence enhances the expression of foreign proteins by self - replicating RNA

[0177] The DNA fragment constructed based on VEEV-TC83 in Example 1 was taken, and a sequence encoding 5' UTR was inserted between the viral subgenomic promoter and the sequence encoding EGFP, as shown in Figure 6BAs shown, to test whether the addition of this 5' UTR can enhance the generation of self-replicating RNA.

[0178] The modified DNA fragment contains, from the 5' end to the 3' end, the T7 mini promoter sequence (SEQ ID NO: 1), the sequence of the VEEV-TC83 virus 5' UTR, the sequence encoding the non-structural proteins nsP1-4 of the VEEV-TC83 virus, the subgenomic promoter of the VEEV-TC83 virus, the sequence of the additionally added 5' UTR (SEQ ID NO: 5, 6, 7 or 8, see Table 4 for details), the sequence encoding EGFP (SEQ ID NO: 2), the sequence of the VEEV-TC83 virus 3' UTR, the polyA sequence (68 As), and the BspQI restriction enzyme cleavage site sequence for plasmid linearization. The DNA fragment without the newly added 5' UTR was used as a control, designated as VEEV-NC.

[0179] As described in Example 1, the above DNA fragment was synthesized, cloned into the pUC57-mini-Kana-BsmBI terminator-free -T7 deletion vector, transfected into competent cells, the vector with the correct sequence was picked, linearized with BspQI single enzyme digestion, the linearized plasmid was recovered by two alcohol precipitation methods, and according to the transcription system in Table 2, the obtained linearized plasmid was subjected to in vitro transcription (IVT), and the IVT transcription stock solution was purified by LiCl.

[0180] Table 4. 5' UTR inserted between the viral subgenomic promoter and the sequence encoding EGFP

[0181]

[0182]

[0183] In addition, as described in Example 1, capillary electrophoresis of each RNA product was performed using the Agilent 5200 Fragment Analyzer system to detect the RNA length and integrity. The results showed that the integrity of the RNAs prepared by in vitro transcription containing different newly added 5' UTRs was all above 70%. Specifically, the purity of the complete products of the self-replicating RNAs containing UTR-1, UTR-2, UTR-3, and UTR-4 was 73.1%, 75.1%, 72.9%, and 72.8% respectively.

[0184] Furthermore, as described in Example 1, each LiCl-purified RNA was transfected into HEK293T cells for expression testing. Specifically, the EGFP expression in each group was observed at 24 h, 48 h, 72 h, and 144 h after transfection. The results were as Figure 2As shown, the expression levels of self-replicating RNAs with a 5' UTR added to the subgenome were all significantly higher than those of self-replicating RNAs without the subgenomic 5' UTR, and there were no significant differences in protein expression among different newly added 5' UTR groups. This result indicates that adding the subgenomic 5' UTR can enhance the ability of self-replicating RNAs to translate foreign proteins.

[0185] Example 3. Construction and characterization of self - replicating RNA containing the sequence encoding an immunosuppressive protein

[0186] The immunosuppressive protein was expressed cis through the IRES signal to test its effect on the expression of foreign proteins in self-replicating RNAs.

[0187] Specifically, based on VEEV-TC83, EVEV, HJV, MDPV, MUCV, NDUV, PIXV, RNV, or TONV, DNA fragments for transcribing self-replicating RNAs were constructed, and the sequences encoding IRES and E3L were placed after the stop codon of the reporter gene (EGFP), as Figure 6C shown.

[0188] The DNA fragment based on VEEV-TC83 contains, from the 5' end to the 3' end, the T7 mini promoter sequence (SEQ ID NO:1), the sequence of the VEEV-TC83 virus 5' UTR, the sequence encoding the non-structural proteins nsP1-4 of the VEEV-TC83 virus, the VEEV-TC83 virus subgenomic promoter, the sequence of UTR-1 (SEQ ID NO:5), the sequence encoding EGFP (SEQ ID NO:2), the sequence of CVB3-IRES (SEQ ID NO:9), the sequence encoding the vaccinia virus E3L protein (SEQ ID NO:10), the sequence of the VEEV-TC83 virus 3' UTR, the polyA sequence (68 A), and the BspQI restriction enzyme cleavage site sequence for plasmid linearization.

[0189] The DNA fragments based on EVEV, HJV, MDPV, MUCV, NDUV, PIXV, RNV, and TONV contain, from the 5' end to the 3' end, the T7 mini promoter sequence (SEQ ID NO:1), the sequences of the respective virus 5' UTRs, the sequences encoding the non-structural proteins nsP1-4 of the respective viruses, the respective virus subgenomic promoters, the sequence of UTR-1 (SEQ ID NO:5), the sequence encoding EGFP (SEQ ID NO:2), the sequence of CVB3-IRES (SEQ ID NO:9), the sequence encoding the vaccinia virus E3L protein (SEQ ID NO:10), the sequences of the respective virus 3' UTRs, the polyA sequence (68 A), and the BspQI restriction enzyme cleavage site sequence for plasmid linearization, as shown in Table 5 specifically.

[0190] Table 5. DNA sequences for constructing self-replicating RNAs based on various viruses

[0191]

[0192] As described in Example 1, the above DNA fragments were synthesized, cloned into the pUC57-mini-Kana-BsmBI terminatorless-T7 deletion vector, transfected into competent cells, the vectors with correct sequences were picked, linearized by single digestion with BspQI, the linearized plasmids were recovered by two alcohol precipitation methods, and according to the transcription system in Table 2 (adding CTP or modified 5-Me-CTP), the obtained linearized plasmids were subjected to in vitro transcription (IVT), and the IVT transcription stock solution was purified by LiCl. Each of the RNA products after LiCl purification (including unmodified RNA products and RNA products containing m5C modification) was transfected into A549 cells for expression testing. As Figure 3A and 3B shown, compared with the case without cis-expression of E3L, the expression levels of the target proteins of the unmodified self-replicating RNAs (EVEV-E3L, HJV-E3L, MDPV-E3L, MUCV-E3L, NDUV-E3L, PIXV-E3L, RNV-E3L and TONV-E3L) or m5C-modified self-replicating RNAs (EVEV-E3L-5mC, HJV-E3L-5mC, MDPV-E3L-5mC, MUCV-E3L-5mC, NDUV-E3L-5mC, PIXV-E3L-5mC, RNV-E3L-5mC and TONV-E3L-5mC) that cis-express the E3L protein through IRES were significantly increased. Moreover, all the self-replicating RNAs showed higher EGFP expression 48 h after transfection into A549 cells.

[0193] In addition, the above A549 cells transfected with the RNA were detected for the level of IL-6 in the culture supernatant by a human IL-6 ELISA kit 48 h after transfection to evaluate the immunogenicity of each self-replicating RNA.

[0194] Specifically, a human IL-6 ELISA kit (ThermoFisher, EH2IL6) was used to detect the IL-6 level in the supernatant of the above A549 cells transfected for 48 h according to the instructions. A549 cells without transfection treatment were used as a negative control, designated as NC. A549 cells transfected with ordinary linear mRNA encoding EGFP were also used as a control, designated as EGFP, where the ordinary linear mRNA encoding EGFP contained a 5' cap, 5' UTR (SEQ ID NO:3), a sequence encoding EGFP (SEQ ID NO:2, with all T replaced by U), 3' UTR (SEQ ID NO:4), and a polyA sequence (100 As) from the 5' end to the 3' end.

[0195] The detection results of the IL-6 expression level are as Figure 4A and 4B shown. Transfection with self-replicating RNA significantly upregulated the expression level of the inflammation-related cytokine IL-6 in cells, while cis-expression of E3L through CVB3 IRES significantly reduced the expression of IL-6 in cells in most unmodified and m5C-modified saRNA transfection groups. However, in some saRNA transfection groups, a decrease in the IL-6 level was not observed, and even a slight increase was seen. On the one hand, this may be related to the differences in the signal pathways of immune responses induced by saRNAs from different virus sources. A comprehensive evaluation of other inflammatory cytokines such as IFN-α and IFN-β can better reflect the immune response. On the other hand, one of the high immunogenicity sources of self-replicating RNA is the dsRNA structure formed during the replication process. While adding immunosuppressive proteins such as E3L to inhibit the cellular immune response and increase the expression of self-replicating RNA, more dsRNA will also be produced, further inducing the cellular immune response and affecting the expression of inflammation-related cytokines. In summary, the above results indicate that cis-expression of the immunosuppressive protein E3L can reduce the immunogenicity induced by self-replicating RNA and reduce the innate immunity of cells caused by it, which greatly improves the expression of the target protein in self-replicating RNA.

[0196] In addition, the self-replicating RNA purified by LiCl above was transfected into HEK293T cells, and the cell viability was measured by the CCK-8 method at 24 h and 48 h after transfection.

[0197] Specifically, HEK293T cells in the logarithmic growth phase were seeded in a 96-well plate at 1×10 4 cells per well, and after seeding, they were placed in an incubator at 37 °C and 5% CO2 for about 30 h. Lipofectamine TM MessengerMAX TMTransfection reagent (ThermoFisher, LMRNA015), and transfection was carried out when the confluence of HEK293T cells reached about 70 - 90%. Prepare the transfection complex. After mixing solution A and solution B in Table 3 and incubating at room temperature for 10 min, add 10 μL of the transfection reagent to each well, and then place it in an incubator at 37 °C and 5% CO2 for culture. At 24 h and 48 h after transfection, add 10 μL of CCK-8 (Beyotime, C0038) solution to each well, continue to incubate in the cell incubator for 1 h, and detect the absorbance value at OD450 nm. HEK293T cells treated only with the transfection reagent without adding mRNA were used as negative control, called LIP. HEK293T cells transfected with the above-mentioned ordinary linear mRNA encoding EGFP were also used as control, called EGFP.

[0198] The results are as Figure 5 shown. At 24 h and 48 h after transfection, compared with the negative control, the cell viability of each transfection group did not decrease significantly, indicating that the self-replicating RNA, whether expressing E3L or not, did not produce obvious cytotoxicity at least within 48 h after transfection.

[0199] Example 4. In vivo activity test of self - replicating RNA

[0200] Test the immune effect in animals of the SARS-COV2 RBD (delta) antigen test self-replicating RNA designed based on the TONV self-replicating RNA containing the immunosuppressive protein E3L.

[0201] To express the SARS-COV2 RBD antigen, we constructed a TONV-based DNA fragment containing, from the 5' end to the 3' end, the T7 mini promoter sequence (SEQ ID NO:1), the sequence of the viral 5' UTR (SEQ ID NO:27), the sequence of non-structural proteins nsP1-4 (SEQ ID NO:28), the subgenomic promoter (SEQ ID NO:29), the sequence of UTR-1 (SEQ IDNO:5), the sequence encoding the RBD protein (SEQ ID NO:67), the sequence of CVB3-IRES (SEQ ID NO:9), the sequence encoding the vaccinia virus E3L protein (SEQ ID NO:10), the sequence of the viral 3' UTR (SEQ ID NO:30), the polyA sequence (68 A), and the BspQI restriction enzyme cleavage site sequence for plasmid linearization.

[0202] As described in Example 1, the above DNA fragment was synthesized and cloned into the pUC57-mini-Kana-BsmBI terminator-free-T7 deletion vector. Competent cells were transfected, and the vector with the correct sequence was selected. It was linearized by single digestion with BspQI, and the linearized plasmid was recovered by two ethanol precipitation methods. According to the transcription system in Table 2 (adding modified 5-Me-CTP), the obtained linearized plasmid was subjected to in vitro transcription (IVT), and the IVT transcription stock solution was purified by LiCl. The 5200CE results showed that the purity of RBD saRNA was 88.8%.

[0203] Through microfluidic technology, the lipid components (SM102, cholesterol, DSPC, and DMG-PEG-2000, molar ratio: 50:38.5:10:1.5) and RBD saRNA self-assembled to form an RNA-LNP complex. After buffer replacement and concentration, the final LNP product could be obtained. After preparation, a particle size analyzer was used to characterize the particle size distribution of the RNA-LNP complex by the principle of dynamic light scattering. The results showed that the polydispersity index (PDI) of RBD saRNA-LNP was less than 0.112, demonstrating good dispersibility and homogeneity of the LNP particles; the particle size was 82.06 nm; the encapsulation efficiency of LNP was determined by the Ribogreen method. Ribogreen is a hypersensitive fluorescent nucleic acid dye used to quantitatively detect the RNA content in solution, and it cannot penetrate LNP. Therefore, the RNA content free outside the LNP particles in the RNA-LNP complex solution was first detected, and then Triton X-100 was used to disrupt the LNP structure, so that the RNA encapsulated inside the RNA-LNP complex was released into the external solution, thereby detecting all the RNA

[0204] content. The encapsulation efficiency could be calculated based on the difference between the two; the results showed that the encapsulation efficiency was 85.68%, indicating good saRNA loading ability of LNP.

[0205] Furthermore, the prepared SARS-CoV-2 RBD-saRNA-LNP was subjected to an in vivo immunization experiment in mice, and the specific antibody titers in the serum were detected. First, C57 / B6 mice were immunized with the SARS-CoV-2 RBD-saRNA-LNP complex by a single tail vein injection at a dose of 0.25 mg / kg, approximately 100 μl. At 10, 20, 30, 40, 50, 60, 70, 80, and 90 days after immunization, blood was collected to obtain serum, and the specific antibody titers of SARS-COV-2 S protein in the serum were detected by a mouse anti-SARS-CoV-2 antibody IgG titer serological detection kit (Acrobiosystems, RAS-T091). The results showed ( Figure 7) A single-dose SARS-CoV-2-RBD-saRNA immunization can induce high levels of specific antibody expression. Moreover, within 80 days after immunization, the serum specific antibody titer continued to rise and began to decline only at 90 days. Compared with the reported linear mRNA vaccines (the peak antibody titer is about 30 days), the self-replicating RNA vaccine of the present invention can induce antibody production more persistently.

[0206] The same SEQ ID NO may correspond to DNA and RNA, and the only difference is U and T.

[0207] SEQ ID NO:1 - T7 promoter

[0208] TAATACGACTCACTATA

[0209] SEQ ID NO:2 - Sequence encoding EGFP

[0210] GCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0211] SEQ ID NO:3 - 5’ UTR in linear RNA

[0212] AGGGCTAGCATTCTTCTGGTCCCCACAGACTCAGAGAGAACCC

[0213] SEQ ID NO:4 - 3’ UTR in linear RNA

[0214] GCTGGAGCCTCGGTGGCCatGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGA

[0215] Sequence of SEQ ID NO:9 - CVB3 - IRES

[0216] TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAA

[0217] Sequence of SEQ ID NO:10 - encoding E3L

[0218] ATGAGCAAGATCTACATCGACGAGCGGAGCAACGCCGAGATTGTGTGCGAGGCCATCAAGACCATCGGAATCGAAGGCGCCACAGCCGCTCAGCTGACCAGACAGCTGAACATGGAAAAGCGGGAAGTGAACAAGGCCCTGTACGACCTGCAGAGAAGCGCCATGGTGTACAGCAGCGACGACATCCCTCCTCGGTGGTTTATGACCACAGAGGCCGACAAGCCTGACGCCGATGCTATGGCCGACGTGATCATCGACGACGTGTCCCGCGAGAAGTCCATGAGAGAGGACCACAAGAGCTTCGACGATGTGATCCCCGCCAAGAAGATCATCGATTGGAAGGGCGCCAATCCTGTGACCGTGATCAACGAGTACTGCCAGATCACCAGAAGAGACTGGTCCTTCCGGATCGAGAGCGTGGGCCCTAGCAATAGCCCTACCTTCTACGCCTGCGTGGACATCGACGGCAGAGTGTTCGATAAGGCCGACGGCAAGAGCAAGCGGGACGCCAAAAACAATGCCGCCAAGCTGGCCGTGGATAAGCTGCTGGGCTATGTGATCATCCGGTTCTAA

[0219] Sequence of SEQ ID NO:11 - 5’UTR of MDPV

[0220] ATGGGCGGCGCATGAGAGATTAGCCCAATACCAAATCATACTACCCAAAT

[0221] Sequence of SEQ ID NO:12 - non - structural proteins nsP1 - 4 of MDPV

[0222]

[0223] SEQ ID NO:13 - MDPV Sub - genomic Promoter

[0224] CCTGAATGGATTGCGACGTAGTCCGATCCGCCAAC

[0225] SEQ ID NO:14 - Sequence of MDPV 3’UTR

[0226] AGTATGTAGCAATTGGCAAGCTACTTTGTAAAATTTTTATTTGATTTTCCGATTAATTGGATTTTGTTTTTAATATTTC

[0227] SEQ ID NO:15 - Sequence of PIXV 5’UTR

[0228] ATGGGCGGCGCATGAGAGAAGCCCATTTAATATCTACCCAAT

[0229] SEQ ID NO:16 - Sequence Encoding PIXV Non - structural Proteins nsP1 - 4

[0230]

[0231] SEQ ID NO:17 - PIXV Sub - genomic Promoter

[0232] CCTGAATGGACTGCAACATAGTTCAGTCCGCA

[0233] SEQ ID NO:18 - Sequence of PIXV 3’UTR

[0234] TCGCAGCATTGCTGCATCTAAATTTTTATAATTTTCTCTGCCAATATTAGATTGGATTTTGTTTTTAATATTTC

[0235] SEQ ID NO:19 - Sequence of TROV 5’UTR

[0236] ATCGAGGCCGTTTTACACACTTTAGCTCCGGCCTCGAAAACGATAGTCACCATC

[0237] SEQ ID NO:20 - Sequence Encoding TROV Non - structural Proteins nsP1 - 4

[0238]

[0239] SEQ ID NO:21 - TROV Sub - genomic Promoter

[0240] CCTTAATCGTCTGCGTAGTACACAATTGACCACGCAGACACGTTAATTGAGTGACAGCA

[0241] SEQ ID NO:22 - Sequence of TROV 3’UTR

[0242] TAGCCGTGTGCACCTAGTTTAATAATAAGATATATAGTTCAAAGGGAAGAACAACCCCTGAATAGTAACAAAACACAAAAATAATAAATATAGTTTTAAGGCTTTAGTATTATAATAATGATAGTATTAGGTATATTAGTAGTTTAGTAGTAAAATATGTAGTTCAAAGGGAAGAACAACCCCTGAATAGTAACAAAATACAAAAACAATAAACATAGTTTTAAGGCTTTAGTATCAAAATAATGATAGTGTTTAATGAATAGTAACAAAATGCATAATTGATATATACGAATGTAATTAGTGTTAGATATTTAGTTCAAAGGGAAGAACAACCCCTGAATAGTAACAAAATACAAAAACACCAAATATAGAGTTAAGTTTTTAGTATCAATTAAATTATGAAATTGATTTGTCAATCACCACCGGACGCCGGGATCGGCGTCCTACCATGTGTAGTTGAAAACCGTATAATTTTCTTAAAATTTTCTTATACCGAATTTGATACACAAATTAGACAATCTTTAATTTTTCTTTTTATTTTCTTTTTAATTTTCTTTATAAAATTTTAATTTTGTTTTTAATATTCC

[0243] SEQ ID NO:23 - Sequence of CABV 5’UTR

[0244] ATGGGCAATACGTAAGAGTAGCCCAAAAACTGAATACACCTACCCATC

[0245] SEQ ID NO:24 - Sequence Encoding CABV Non - structural Proteins nsP1 - 4

[0246]

[0247] SEQ ID NO:25 - CABV Sub - genomic Promoter

[0248] CCTGAATGGACTGTGATATAGTACAGTCCGCAACC

[0249] SEQ ID NO:26 - Sequence of CABV 3’UTR

[0250] ACTAACACAGCAATTGGCAGGCTGTAAATTGAGTACCATTAATCAGATAATAGCAGCAATTGGCGAGCTGCATAAAATTTTTAATAACAACTATTATAACTATCGTAGCAGCAATTGGCTAGCTGCTTTTACCATTATTTTATTTTCTTTACCAACAATTGGATTTTGTTTTTAATATTTC

[0251] SEQ ID NO:27 - Sequence of TONV 5’UTR

[0252] ATGGGCGGCGTATGAGAGAAGCCCAAAACCTAGACTACCCATA

[0253] SEQ ID NO:28 - Sequence Encoding TONV Non - structural Proteins nsP1 - 4

[0254]

[0255] SEQ ID NO:29 - TONV Sub - genomic Promoter

[0256] CCTGAATGGACTGTGACGTAGTACAGTCCCCAAAATAGC

[0257] SEQ ID NO:30 - Sequence of TONV 3’UTR

[0258] ACCGCAGTAGCAATTGGCAAGCTATATAAAAGAATTATAAAGCGATAATTGGCAAATCGCATGTAAATCCCAGCAGCAATTGGCACGCTGCATATATAATTTACTTGGCGGCAATTGGCAAGCCGCCCATAACAAATTTTTATTTTCTTTTCCAATAATTGGATTTTGTTTTTAATATTTC

[0259] SEQ ID NO:31 - Sequence of BEBV 5’UTR

[0260] ATGGCGGCTGTGTGACACACGAGCCGTCGATTTCAACCTTCTTGCTCCCTCCAATTCTGAGAGGAATCATCAAGCCAAG

[0261] SEQ ID NO:32 - Sequence Encoding BEBV Non - structural Proteins nsP1 - 4

[0262]

[0263] SEQ ID NO:33 - BEBV Sub - genomic Promoter

[0264] ATGTGCAGTTACAGGAGTATACACATCGAATAACTATCCCGAGACC

[0265] SEQ ID NO:34 - Sequence of BEBV 3’UTR

[0266] ATAACATATAATAAAGCCTAAATCTAATAGAATCATGTTAATCATTCTAAGATAAGCACTAGTTAAATATTAGAGGTATCCTAAGTGTAAGCAGAAAACGGAAAATCAAGAAAAATTAAGGTAAGAAATAGGATCTAGGAATTTATGTTAATCATTTTAGGTTAGCATTATAGTAAGAATTAGGATCTAGGAATTTACATTAATCACTTTAGGTTAGTATCATGTTAAATATTAGAGGTATCCTAAGTGTAAGCAGAAAACAGAAAAATTAAGAAAAATTAAGGTAAGAATTAGGATCTAAGAATTTATATTAATCACTTTAGGTTAGTACCATGATTTAGAAATTATAGTGATCATTTTAAGCTAATTACTAGGTAAGTAACTGGTTAGTCTATCGGTAGCTTATGTATAAGTAGAAAAATGATAATAAAAGAAAAAATATAGAGTAGTATGTAGCTGTAAGTTGAAAATATTGGAAAAACTATTACGAGCATCTACCACCGACGCCTCATCGGCTTATAGGGCGTCATATAATTGAATTGATTATGCAATTGGAAAAACTTTAATCAGAAATATAATTGGACAACATTGGTTTTTAATATTTCC

[0267] SEQ ID NO:35 - Sequence of EVEV 5’UTR

[0268] ATGGGCGGCGCATGAGAGAAGCCCAAACACCTAACTGCCCAAA

[0269] SEQ ID NO:36 - Sequence Encoding EVEV Non - structural Proteins nsP1 - 4

[0270]

[0271] SEQ ID NO:37 - EVEV Sub - genomic Promoter

[0272] CCTGAATGGACTACGACTTAGTCTGGTCCGCCAAG

[0273] SEQ ID NO:38 - Sequence of EVEV 3’UTR

[0274] ATATAGCAGCAATTGGCGAGCTGCTTAGATAGAACTTGCGGCGATTGGCATGCCGCTTTAAAATTTTATTTTATTTTCTTTTCTTTTCCAAATTGGATTTTGTTTTTAATATTTC

[0275] SEQ ID NO:39 - Sequence of FMV 5’UTR ATAGGGTATGGTTTAGAGGCGCCTACCCTACTTAACCGATCCAAAC

[0276] SEQ ID NO:40 - Sequence Encoding FMV Non - structural Proteins nsP1 - 4

[0277]

[0278] SEQ ID NO:41 - FMV Sub - genomic Promoter

[0279] CCTAAATAGGTGACGCAACATAGTATACTGTGTTACGTTGCCTGCTCTT

[0280] SEQ ID NO:42 - Sequence of FMV 3’UTR

[0281] TAGCCTAACCTAGCTTATAAACTATTATACTTATGCTTGCTTGTAGTTTAGATTAGTATTTACTTGTAGTAATTGTAATTAGTATTATATTATTAACTTAGTTTCAATTTATTTTTCTTACATTTAACTTTAAACCTTTTATTCTTTATCCTTATTTTATTTAGTCTACTAGATTAGTTTTGTTTTTAATATTTC

[0282] SEQ ID NO:43 - Sequence of GETV 5’UTR

[0283] ATGGCGGACGTGTGACATCACCGTTCGCTCTTTCTAGGATCCTTTGCTACTCCACATAGTGAGAGACAAACAACCCAA

[0284] SEQ ID NO:44 - Sequence Encoding GETV Non - structural Proteins nsP1 - 4

[0285]

[0286] SEQ ID NO:45 - GETV Sub - genomic Promoter

[0287] ATGCAGGATTACACTACATCTAAAGACCACGTATTACAGACACC

[0288] SEQ ID NO:46 - Sequence of GETV 3’UTR

[0289] CCGGGAGGCTTGACATAATGTATATATATAAGCATCATAGTTTTAATAAAGCCCCTGAATAGTAACAAAACATAAAAACCAAAAACAGTAGTTCAAAGGGCTATACAACCCCTGAATAGTAACAAAATACAGAAAAACCATAAAAATTATAAAATTAACTAATCAGATCATCTAAATTTGACTAATTGGAAATAGCCGAACTCTACGGAGATGTAGGCGTCCGAACTCCACGGAGACGTAGGACAAAATTCTGCCGAACCCCAGACCATCGGGGACGTAGGCGTCTAATTTGTTTTTTTAATATTTTAC

[0290] SEQ ID NO:47 - Sequence of NDUV 5’UTR

[0291] ATGGTGCGGAGTTGAGAGACGAAGCACCAAACAACTACGCGGCTCACC

[0292] SEQ ID NO:48 - Sequence Encoding NDUV Non - structural Proteins nsP1 - 4

[0293]

[0294] SEQ ID NO:49 - Promoter of the NDUV sub - genome

[0295] CAGCCACAGAGTGACGCTACTACACTGTGCCTGCTACGCC

[0296] SEQ ID NO:50 - Sequence of the 3’UTR of NDUV

[0297] CTTTGGTGTGGTCCCAGCATGCTGAGGTATTATAGATAACTTAGTTAGGTATTATAGGTAACTTAGGTGTAAGCAGAAAAATGGAAAACCGAATAAAAAGTTAGAGTAAGTAGTGTAAATTAGAAAATAAGTTTTGATAGTGGTAGTTAGGTGTAAGCAGAAAACAGAAAAACGAATAAAAAGCTAGAGTAAGTAGTTAGCTGCATATAGAGGTAGTATAGGTGTAAGCAGAAAATGGAAAACCAGTAAAAAGTTAGAGTAAGTAGTAGAGAATAAGTTTTGCTATGCATTAGATAGGTTGCTTTGATTTTATAGAAAATAGTAGATGCTTATAGAGGTAGTATAGGTTTAAGCAGAAAAATACAGAAAAATCTAAAGATATGCGACGAGCAGACCGTCGTGAGCGCCAATTGGATCGGCGCAACAGGGTTATTGGACTGCCCTGCATGAACCCTTATTGGACGATGGGTTCTTCGTCTGCAAAATTCATATTTAAAATTTTGTTTTTATTTTTTGATTCGATCAATTGGTTTTTAATATTTCCT

[0298] SEQ ID NO:51 - Sequence of the 5’UTR of RNV

[0299] ATGGGCGGCGCATTAGAGAGTAGCCCAAAACTAAACTACCCAAC

[0300] SEQ ID NO:52 - Sequence encoding the non - structural proteins nsP1 - 4 of RNV

[0301]

[0302] SEQ ID NO:53 - RNV sub - genomic promoter

[0303] CCTGAATGGATTGCACGTTAGTTCGATCCGCTACA

[0304] SEQ ID NO:54 - Sequence of RNV 3’UTR

[0305] GAAGAAGCAGCAATTGGCAAGCTGCATGCAAAATATATGTAGAGCAAATTACGACAGCAATTGGCAGGCTGTATAGAGTTTTATTAGATTTTGTGTATAATTGTTTAGCAGCAATTGGCAAGCTGCTTTTAAAATTTTTATTAGATTTTTTTTTTTTTTTATATACCAATTGGATTTTGTTTTTAATATTTC

[0306] SEQ ID NO:55 - Sequence of MUCV 5’UTR

[0307] ATGGGCGGCGTATGAGAGTAGCCCAAATTAAAACTACCCATT

[0308] SEQ ID NO:56 - Sequence encoding MUCV non - structural proteins nsP1 - 4

[0309]

[0310] SEQ ID NO:57 - MUCV Sub - genomic Promoter

[0311] CCTGAATGGACTGTAACGTAGTTCAGTCCGCAACC

[0312] SEQ ID NO:58 - Sequence of MUCV 3’UTR

[0313] ACCACAGCAGCGATTGGAAAGCTGCCTATTAGAAACATGTAGCGGCAATTGGCAAGCCGCCTATAAATGTTTAGCAGCAATTGGCAAGCTGCATATATAAATTACCTAGCGGCAATTGGCACGCCGCTTATAAAATTTTTATTTTCTTTTACCAATAATTGGATTTTGTTTTTAATATTTC

[0314] SEQ ID NO:59 - Sequence of HJV 5’UTR ATAGGGCATGGTATAGAGGCACCTACCCTACAAACCGATCCAAAC

[0315] SEQ ID NO:60 - Sequence Encoding HJV Non - structural Proteins nsP1 - 4

[0316]

[0317] SEQ ID NO: 61 - HJV sub - genomic promoter

[0318] CCTTAATAGGTGACGTAGTAGATACGCACCTAACCGCGAAA

[0319] SEQ ID NO: 62 - Sequence of HJV 3’UTR

[0320] CCCGGCGTTCCCCTGACCACAGCGGCGAGCACTCGATGTACTTCCGAGGTAACGTGGTGCATAATGCCACGTGCCGCTAGACACCAAAACTCGATGTACTTCCGAGGAAGCACAGTGCATAATGCTGTGCAGTGTCGCATTTAACCAATTATTATTATCCATATATTATGTTATCACTACACATTATAACTCTAAACATGTAACACTACAGGAATTTTACTAGTATACGTTACCGTATCTAGTGGGTTCCACTATAATCAACACTACATGAATTTTATTCAAACACACTACACACTTATAACAACTTTTAAAATTTTGATTAGATTACTATATTTTTCTTTTCTTTATTTTTCTTTTATTTTGTTTTTAAAATTTC

[0321] SEQ ID NO: 63 - VEEV 5’UTR sequence

[0322] ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA

[0323] SEQ ID NO: 64 - Sequence encoding VEEV non - structural proteins nsP1 - 4

[0324]

[0325] SEQ ID NO:65 - VEEV Sub - genomic Promoter

[0326] CCTGAATGGACTACGACATAGTCTAGTCCGCCAAG

[0327] SEQ ID NO:66 - Sequence of VEEV 3’UTR

[0328] TAAGCGGCCGCTATGTTACGTGCAAAGGTGATTGTCACCCCCCGAAAGACCATATTGTGACACACCCTCAGTATCACGCCCAAACATTTACAGCCGCGGTGTCAAAAACCGCGTGGACGTGGTTAACATCCCTGCTGGGAGGATCAGCCGTAATTATTATAATTGGCTTGGTGCTGGCTACTATTGTGGCCATGTACGTGCTGACCAACCAGAAACATAATTGAATACAGCAGCAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTATTTTATTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTC

[0329] SEQ ID NO:67 - Sequence Encoding SARS - COV2 RBD(delta)

[0330] ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAGCCAGGAAATCCATGCCCGATTCAGAAGACGCGTCCAGCCAACCGAGAGCATCGTCAGATTTCCCAACATTACAAATCTGTGTCCCTTCGGCGAGGTGTTCAACGCCACACGCTTCGCTTCAGTGTACGCATGGAACCGCAAGCGCATATCTAACTGCGTCGCGGATTATTCTGTCCTCTACAACTCCGCCTCTTTCTCCACCTTCAAGTGCTACGGAGTGTCACCGACTAAGCTGAACGATCTCTGCTTTACCAACGTCTACGCGGACTCCTTCGTGATAAGAGGTGATGAAGTGAGACAAATAGCCCCAGGTCAGACTGGTAAGATCGCAGATTACAACTACAAATTGCCTGATGATTTCACTGGTTGCGTTATCGCGTGGAACTCTAATAACCTCGATTCTAAGGTCGGTGGTAACTACAATTACaGGTACCGCTTGTTTAGGAAGTCAAACCTGAAGCCTTTCGAGAGGGATATTTCAACCGAAATCTATCAAGCGGGTTCAAagCCGTGTAACGGTGTGgAAGGATTTAACTGCTACTTCCCCCTGCAGTCTTACGGATTCCAGCCAACCAATGGCGTGGGTTACCAACCTTATCGCGTGGTGGTTCTGAGTTTCGAACTGTTGCACGCTCCCGCCACGGTATGCGGTCCCAAGAAAAGTACTAACTTGGTGAAGAATAAGTGCGTGAATTTCGGCGGAGGAGGCAGCGGCGGAGGAGGCAGCGGAAGCGGCTACATCCCAGAAGCCCCTAGAGACGGACAGGCTTACGTGCGAAAAGACGGCGAGTGGGTGCTGCTGAGCACATTCCTGGGAAGGAGCTGA

[0331] Cited references

[0332] [1]Paessler S.,Weaver S.C.(2009)Vaccines for Venezuelan equine encephalitis.Vaccine.27(Suppl 4):D80–D85.

[0333] [2]Samsa MM,Dupuy LC,Beard CW,Six CM,Schmaljohn CS,Mason PW,Geall AJ,Ulmer JB,Yu D.(2019)Self-Amplifying RNA Vaccines for Venezuelan Equine Encephalitis Virus Induce Robust Protective Immunogenicity in Mice.Mol Ther.27(4):850-865.

[0334] [3]Erasmus JH,Khandhar AP,O'Connor MA,Walls AC,Hemann EA,Murapa P,Archer J,Leventhal S,Fuller JT,Lewis TB,Draves KE,Randall S,Guerriero KA,Duthie MS,Carter D,Reed SG,Hawman DW,Feldmann H,Gale M Jr,Veesler D,Berglund P,Fuller DH.(2020)An Alphavirus-derived replicon RNA vaccine induces SARS-CoV-2 neutralizing antibody and T cell responses in mice and nonhuman primates.Sci TranslMed.12(555):eabc9396.

[0335] [4]Maruggi G, Mallett CP, Westerbeck JW, Chen T, Lofano G, Friedrich K, Qu L, Sun JT, McAuliffe J, Kanitkar A, Arrildt KT, Wang KF, McBee I, McCoy D, Terry R, Rowles A, Abrahim MA, Ringenberg MA, Gains MJ, Spickler C, Xie X, Zou J, Shi PY, Dutt T, Henao-Tamayo M, Ragan I, Bowen RA, Johnson R, Nuti S, Luisi K, Ulmer JB, Steff AM, Jalah R, Bertholet S, Stokes AH, Yu D. (2022) A self-amplifying mRNA SARS-CoV-2 vaccine candidate induces safe and robust protective immunity in preclinical models. Mol Ther. 30(5):1897-1912.

[0336] [5]Li Y, Teague B, Zhang Y, Su Z, Porter E, Dobosh B, Wagner T, Irvine DJ, Weiss R. (2019) In vitro evolution of enhanced RNA replicons for immunotherapy. SciRep. 9(1):6932

[0337] [6]Blakney AK, McKay PF, Bouton CR, Hu K, Samnuan K, Shattock RJ. (2021) Innate Inhibiting Proteins Enhance Expression and Immunogenicity of Self-Amplifying RNA. Mol Ther. 29(3):1174-1185

[0338] [7]Minnaert AK, Vanluchene H, Verbeke R, Lentacker I, De Smedt SC, Raemdonck K, Sanders NN, Remaut K. (2021) Strategies for controlling the innate immune activity of conventional and self-amplifying mRNA therapeutics: Getting the message across. Adv Drug Deliv Rev. 176:113900

Claims

1. A replicable RNA molecule that, from the 5'-end to the 3'-end, comprises a 5' cap, a 5' UTR, an open reading frame encoding an RNA replicase, a promoter, a target sequence, a 3' UTR, and a poly(A) tail, wherein the RNA replicase is capable of amplifying the replicable RNA molecule and is capable of amplifying an RNA molecule containing the target sequence and the 3' UTR, and wherein the RNA replicase is a non-structural protein or a functional variant thereof derived from Mossuril virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV).

2. The replicable RNA molecule according to claim 1, wherein the open reading frame encoding the RNA replicase comprises a nucleotide sequence having 85% sequence identity with SEQ ID NO: 12, 36, 52, 56, 60, 16, 20, 24, 28, 32, 40, 44, or 48.

3. The replicable RNA molecule according to claim 1, wherein the 5' UTR, the promoter, and / or the 3' UTR are derived from the same virus as the RNA replicase, and wherein the promoter is a subgenomic promoter of the virus.

4. The replicable RNA molecule according to claim 3, wherein the 5' UTR, the open reading frame encoding the RNA replicase, the promoter, and the 3' UTR respectively comprise the nucleotide sequences shown in (1) SEQ ID NO: 11, 12, 13, and 14; (2) SEQ ID NO: 35, 36, 37, and 38; (3) SEQ ID NO: 51, 52, 53, and 54; (4) SEQ ID NO: 55, 56, 57, and 58; (5) SEQ ID NO: 59, 60, 61, and 62; (6) SEQ ID NO: 15, 16, 17, and 18; (7) SEQ ID NO: 19, 20, 21, and 22; (8) SEQ ID NO: 23, 24, 25, and 26; (9) SEQ ID NO: 27, 28, 29, and 30; (10) SEQ ID NO: 31, 32, 33, and 34; (11) SEQ ID NO: 39, 40, 41, and 42; (12) SEQ ID NO: 43, 44, 45, and 46; or (13) SEQ ID NO: 47, 48, 49, and 50.

5. The replicable RNA molecule according to claim 1, wherein the target sequence is an open reading frame encoding a target peptide or protein.

6. A replicable RNA molecule that, from the 5'-end to the 3'-end, comprises a 5'-cap, a 5'-UTR, an open reading frame encoding an RNA replicase, a promoter, a second 5'-UTR, a target sequence, a 3'-UTR, and a poly(A) tail, wherein the RNA replicase is capable of amplifying the replicable RNA molecule and is capable of amplifying an RNA molecule containing the second 5'-UTR, the target sequence, and the 3'-UTR, and wherein the RNA replicase is a non-structural protein of a self-replicating virus or a functional variant thereof.

7. The replicable RNA molecule according to claim 6, wherein the 5'-UTR, the open reading frame encoding the RNA replicase, the promoter, and / or the 3'-UTR are derived from the same self-replicating virus, and wherein the promoter is a subgenomic promoter of the virus.

8. The replicable RNA molecule according to claim 7, wherein the self-replicating virus is an alphavirus, a flavivirus, a measles virus, or a rhabdovirus.

9. The replicable RNA molecule according to claim 8, wherein the alphavirus is Mosquito-borne virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukumbu virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV).

10. The replicable RNA molecule according to claim 6, wherein the second 5'-UTR comprises the nucleotide sequence shown in SEQ ID NO: 5, 6, 7, or 8.

11. A replicable RNA molecule that, from the 5'-end to the 3'-end, comprises a 5'-cap, a 5'-UTR, an open reading frame encoding an RNA replicase, a promoter, a first target sequence, an internal ribosome entry site (IRES), a second target sequence, a 3'-UTR, and a poly(A) tail, wherein the RNA replicase is capable of amplifying the replicable RNA molecule and is capable of amplifying an RNA molecule containing the first target sequence, the internal ribosome entry site, the second target sequence, and the 3'-UTR, and wherein the RNA replicase is a non-structural protein of a self-replicating virus or a functional variant thereof, and wherein one of the first target sequence and the second target sequence is an open reading frame encoding an immunosuppressive protein.

12. The replicable RNA molecule according to claim 11, wherein the immunosuppressive protein is a poxvirus E3L protein, a poxvirus K3 protein, a poxvirus B18 / B18R protein, a non-structural protein 1 of an influenza virus, a parainfluenza virus PIV5 protein, or a MERS ORF4a protein.

13. The replicable RNA molecule according to claim 11, wherein the first target sequence is an open reading frame encoding a target peptide or protein and the second target sequence is an open reading frame encoding an immunosuppressive protein; or the first target sequence is an open reading frame encoding an immunosuppressive protein and the second target sequence is an open reading frame encoding a target peptide or protein.

14. The replicable RNA molecule according to claim 11, wherein the 5' UTR, the open reading frame encoding an RNA replicase, the promoter, and / or the 3' UTR are derived from the same self-replicating virus, and the promoter is a subgenomic promoter of the virus.

15. The replicable RNA molecule according to claim 14, wherein the self-replicating virus is an alphavirus, a flavivirus, a measles virus, or a rhabdovirus.

16. The replicable RNA molecule according to claim 15, wherein the alphavirus is Mosquito Das Pedras virus (MDPV), Everglades virus (EVEV), Rio Negro virus (RNV), Mukamba virus (MUCV), High J virus (HJV), Pixuna virus (PIXV), Trocara virus (TROV), Cabassou virus (CABV), Tonate virus (TONV), Bebaru virus (BEBV), Fort Morgan virus (FMV), Getah virus (GETV), or Ndumu virus (NDUV).

17. The replicable RNA molecule according to claim 11, further comprising a second 5' UTR between the promoter and the first target sequence, wherein the RNA replicase is capable of amplifying an RNA molecule containing the second 5' UTR, the first target sequence, an internal ribosome entry site, the second target sequence, and the 3' UTR.

18. The replicable RNA molecule according to claim 17, wherein the second 5' UTR comprises the nucleotide sequence shown in SEQ ID NO: 5, 6, 7, or 8.

19. A DNA molecule encoding the replicable RNA molecule according to any one of claims 1-18.

20. A vector comprising the DNA molecule according to claim 19.

21. A cell comprising the DNA molecule according to claim 19 or the vector according to claim 20.

22. A method for preparing a target peptide or protein, comprising: i) providing the replicable RNA molecule according to any one of claims 1-18, wherein the target sequence in the replicable RNA molecule is an open reading frame encoding the target peptide or protein, and ii) introducing the replicable RNA molecule into a cell.

23. A method for treating or preventing a disease in a subject in need thereof, wherein the replicable RNA molecule according to any one of claims 1-18 is administered to the subject, and the target sequence in the replicable RNA molecule is an open reading frame encoding a disease-related antigen or a peptide therapeutic agent.

Images