Stem cell exosome vesicles induced by traditional Chinese medicine functional components as well as preparation method and application of stem cell exosome vesicles

Abstract

The invention provides a stem cell exosome vesicle induced by traditional Chinese medicine functional components as well as a preparation method and application thereof, and belongs to the technical field of biological medicines. According to the preparation method of the stem cell exosome vesicle, traditional Chinese medicine functional components serve as an exosome inducer, stem cells can be induced to proliferate and secrete exosome with the enhanced function, the yield of the exosome can be increased, bioactive molecules can be loaded, and the bioavailability of the exosome in diabetes treatment is remarkably improved. The stem cell exosome vesicle disclosed by the invention can be applied to treatment of diabetes and complications thereof, not only can improve functions of islet cells, but also can treat chronic inflammation, microangiopathy and other metabolic diseases related to diabetes, and has a wide clinical application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a stem cell exosome vesicle induced by functional components of traditional Chinese medicine, and a preparation method and application thereof. Background Art

[0002] Diabetes is a highly prevalent metabolic disease worldwide, characterized by abnormal glucose metabolism, which seriously affects the health of patients and is closely related to aging, environmental factors and obesity. Diabetes itself not only affects the quality of life of patients, but the various complications it causes, such as diabetic foot, retinopathy, cardiovascular disease and chronic kidney disease, further increase the burden of the disease. Currently, the treatment of diabetes mainly relies on oral hypoglycemic drugs, insulin supplementation and lifestyle intervention, but these methods can only control blood sugar levels, it is difficult to reverse the decline of pancreatic function, and cannot fundamentally prevent the progression of the disease. Functional damage and reduction in the number of pancreatic beta cells are the core pathological mechanisms leading to diabetes. Therefore, repairing pancreatic function, improving the high-sugar environment, regulating inflammatory responses and enhancing cell regeneration capacity have become important directions for diabetes treatment.

[0003] Studies have shown that chronic inflammation is a key factor in the pathological progression of diabetes. Diabetic patients are in a state of high sugar and oxidative stress for a long time, which induces the excessive release of inflammatory factors such as TNF-α, IL-6, and IL-1β. These inflammatory mediators can aggravate pancreatic β-cell damage, inhibit insulin secretion, and reduce telomerase activity, accelerating cell aging, and ultimately leading to pancreatic islet failure. In addition, telomere shortening is an important mechanism of pancreatic β-cell aging and functional degeneration. Studies have found that telomere length is closely related to the disease progression of diabetic patients. Therefore, increasing telomerase activity, extending telomere length, and reducing inflammation levels have become new strategies to improve the pathological state of diabetes.

[0004] Mesenchymal stem cells (MSCs) have been widely used in tissue repair and immune regulation research in recent years. They not only secrete a variety of pro-regenerative factors but also promote the repair of damaged tissues through paracrine effects. However, traditional stem cell transplantation has problems such as low cell survival, short retention time, low transplantation efficiency, and safety risks, which limit its clinical application. Recent studies have shown that exosomes secreted by mesenchymal stem cells (MSC-Exos) can replace the biological functions of stem cells and become a new strategy for cell-free therapy. Summary of the Invention

[0005] The present invention provides a stem cell exosome vesicle induced by functional ingredients of traditional Chinese medicine, as well as a preparation method and application thereof. The stem cell exosome vesicle optimizes the method of loading functional ingredients of traditional Chinese medicine, thereby significantly improving its bioavailability in the treatment of diabetes and promoting the repair of pancreatic beta cells.

[0006] The present invention provides a method for preparing stem cell exosome vesicles, comprising the following steps: adding functional components of traditional Chinese medicine to a serum-free culture medium for culturing stem cells, culturing until the stem cell density reaches 70-80% fusion, continuing to culture for 40-48 hours, and collecting the culture supernatant, wherein the culture supernatant contains stem cell exosome vesicles.

[0007] In one embodiment of the present invention, the sources of the stem cells include any one of the following: bone marrow, umbilical cord, umbilical cord blood, placenta or endometrium.

[0008] In one embodiment of the present invention, the functional ingredients of traditional Chinese medicine include at least one of the following: curcumin, resveratrol and miRNA, and the working concentration of curcumin is 5 to 20 μM, and the working concentration of resveratrol is 10 to 50 μM.

[0009] In one embodiment of the present invention, the functional components of traditional Chinese medicine are extracted from turmeric and / or polygonum cuspidatum.

[0010] In one embodiment of the present invention, during the continued culture, growth factors and / or regulatory factors are further added;

[0011] The growth factors include at least one of the following: transforming growth factor, fibroblast growth factor, epidermal growth factor, insulin-like growth factor, vascular endothelial growth factor, hepatocyte growth factor, glutathione, interleukin-6, interleukin-10 and tumor necrosis factor receptor;

[0012] The regulatory factors include adenosine monophosphate-activated protein kinase agonist and / or peroxisome proliferator-activated receptor gamma coactivator 1α.

[0013] The present invention also provides stem cell exosome vesicles prepared using the above preparation method.

[0014] The present invention also provides a stem cell exosome vesicle freeze-dried powder prepared using the above-mentioned stem cell exosome vesicles as the main raw material.

[0015] In one embodiment of the present invention, the stem cell exosome vesicle freeze-dried powder further includes a protective agent, and the protective agent includes at least one of the following: trehalose, sucrose and mannose.

[0016] The present invention also provides the use of the above-mentioned stem cell exosome vesicles or the above-mentioned stem cell exosome vesicle freeze-dried powder in the preparation of a drug for treating diabetes and / or diabetic complications.

[0017] The present invention also provides a drug for treating diabetes and / or diabetic complications, which uses the above-mentioned stem cell exosome vesicles or the above-mentioned stem cell exosome vesicle freeze-dried powder as an active ingredient and also includes pharmaceutically acceptable excipients.

[0018] Beneficial Effects: The present invention provides a method for preparing stem cell exosome vesicles. Using functional components of traditional Chinese medicine as exosome inducers, the method can induce stem cells to proliferate and secrete exosomes with enhanced function. It can also increase exosome production and load bioactive molecules, significantly improving the bioavailability of exosomes in diabetes treatment. In one embodiment of the present invention, curcumin and / or resveratrol are used as inducers to induce the preparation of stem cell exosome vesicles, effectively promoting stem cell proliferation, increasing exosome secretion, and enhancing exosome functionality. At the same time, curcumin and / or resveratrol can be encapsulated into stem cell exosomes, ensuring the stability and targeting of exosomes in diabetes treatment, and improving their immunomodulatory and antioxidant capabilities.

[0019] Experiments conducted in this invention have demonstrated that the stem cell exosomes can be used in the treatment of diabetes and its complications. They not only improve pancreatic islet cell function but also treat diabetes-related chronic inflammation, microangiopathy, and other metabolic diseases, demonstrating broad clinical application prospects. The stem cell exosomes described in this invention provide a cell-free therapeutic strategy for the treatment of diabetes and its related complications. Using exosomes as nanoscale delivery vehicles can effectively reduce immune rejection and improve the safety and feasibility of treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the result of the pancreatic β cell survival experiment;

[0021] Figure 2 This is the result diagram of insulin secretion;

[0022] Figure 3 This is the result of the telomere length measurement experiment;

[0023] Figure 4 This is the result of telomerase activity detection experiment;

[0024] Figure 5 The figure shows the pathological results of pancreatic tissue in diabetic mice. DETAILED DESCRIPTION

[0025] The present invention provides a method for preparing stem cell exosome vesicles, comprising the following steps: adding functional components of traditional Chinese medicine to a serum-free culture medium for culturing stem cells, culturing until the stem cell density reaches 70-80% fusion, continuing to culture for 40-48 hours, and collecting the culture supernatant, wherein the culture supernatant contains stem cell exosome vesicles.

[0026] The stem cells described in the present invention include mesenchymal stem cells, and the sources of the mesenchymal stem cells include any one of the following: bone marrow, umbilical cord, umbilical cord blood, placenta or endometrium. In one embodiment, umbilical cord-derived stem cells are used as an example for illustration, but this cannot be considered as the only one that constitutes the entire protection scope of the present invention.

[0027] The stem cells described in the present invention can be cultured stem cell lines or directly extracted from corresponding tissues. During the expansion and culture of the stem cells, a low-oxygen dynamic culture strategy is adopted to improve the cell growth environment. After the cell density reaches 70-80% fusion, functional ingredients of traditional Chinese medicine are added as exosome secretion inducers. In one embodiment of the present invention, dynamic culture is performed using a microcarrier rotating bioreactor to improve the efficiency of nutrient and gas exchange in the culture medium, optimize the cell metabolic environment, promote cell expansion, and significantly increase the secretion of exosomes. The dynamic culture temperature is 37°C, the humidity is 95%, and the CO2 content is 5%. The culture medium used in the present embodiment is Mesenchymal Stem Cell Basal Medium (Cat. No. A10490-01) provided by Gibco, supplemented with 10% fetal bovine serum. The fetal bovine serum is an exosome-clearing version, such as Exo-FBS from System Biosciences. TM (Product No. EXO-FBS-250A-1) to avoid interference from exogenous exosomes. Under the culture conditions, the selected stem cells are subcultured, and after the third to fourth generations, serum-free medium is used for further culture. The serum-free medium of the present invention can be any of the following: LeydenAOF serum-free medium provided by ROHTO (Rohto Pharmaceutical) of Japan; CTS TM StemPro TM MSC SFMXenoFree Medium (Cat. No. A10675-01) and MesenCult from Stemcell Technologies TM -ACF Plus Medium (Cat. No. 05449).

[0028] The present invention adds the functional components of traditional Chinese medicine to the serum-free culture medium as a chemical inducer for stem cell exosome secretion, and the functional components of traditional Chinese medicine include at least one of the following: curcumin, resveratrol and miRNA, wherein the working concentration of curcumin can be 5 to 20 μM, such as 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, 11 μM, 12 μM, 13 μM, 14 μM, 15 μM, 16 μM, 17 μM, 18 μM, 19 μM, 20 μM and any value within the interval composed of any two concentrations; the working concentration of resveratrol can be 10 to 50 μM, such as 10 μM, 20 μM, 30 μM, 40 μM, 50 μM and any value within the interval composed of any two concentrations. In one embodiment of the present invention, when adding the functional ingredients of traditional Chinese medicine, the functional ingredients of traditional Chinese medicine are first dissolved in a small amount of dimethyl sulfoxide (DMSO) or anhydrous ethanol to prepare a high concentration stock solution (such as 10mM curcumin, 50mM resveratrol), and then diluted to the target working concentration in proportion to ensure that the volume fraction of the organic solvent (DMSO or ethanol) in the final culture medium does not exceed 0.1% to avoid toxic effects on stem cells.

[0029] In one embodiment of the present invention, the curcumin is extracted from the traditional Chinese medicine Curcuma longa. The present invention does not specifically limit the extraction method, as long as the curcumin monomer can be extracted from the turmeric. For example, in one embodiment, the curcumin is extracted using high-speed countercurrent chromatography (HSCC). The steps include: grinding dried turmeric into an 80-100 mesh fine powder, extracting with 95% ethanol-water (volume ratio 85:15) at reflux at 60°C for 2 hours, and repeating twice; filtering the extract through a Buchner funnel, concentrating it, and dissolving it in an ethyl acetate-methanol-water system (volume ratio 5:4:3). Separation parameters are set at a flow rate of 2.5 mL / min, a rotation speed of 850 rpm, and a detection wavelength of 420 nm. The resulting target component is rotary evaporated and vacuum dried to obtain high-purity curcumin monomer.

[0030] In one embodiment of the present invention, resveratrol is extracted from the Chinese medicinal plant Polygonum cuspidatum. The present invention does not specifically limit the extraction method, as long as resveratrol monomer can be extracted from the Polygonum cuspidatum. For example, in one embodiment, supercritical CO2 extraction is used to extract resveratrol from the Polygonum cuspidatum. The specific steps include: crushing dried Polygonum cuspidatum to 100 mesh, placing it in a stainless steel extraction tank, and extracting it at 40-50°C and 250-300 bar for 1.5-2 hours. 5-10% ethanol can be added as a co-solvent to improve extraction efficiency. After recovery by decompression and condensation in a separator, crude resveratrol is obtained, which can be further purified by crystallization or column chromatography to obtain high-purity monomer.

[0031] The present invention can also extract plant-derived miRNA while extracting curcumin and resveratrol. The obtained miRNA can participate in the induction process of exosome secretion as a functional regulatory factor. The present invention uses plant residues or reserved sample powder to extract plant miRNA. In one embodiment, the plant tissue is fully ground with liquid nitrogen, lysed using TRIzol reagent, centrifuged and layered to extract the supernatant, isopropanol precipitated total RNA, and selectively separated by a small RNA special enrichment kit (such as miRNeasyMini Kit or 10kDa ultrafiltration centrifuge tube) 21-25nt small molecule miRNA. In order to improve its cellular uptake efficiency during stem cell culture, the miRNA is preferably pre-compounded with a cationic transfection reagent (LipofectamineRNAiMAX) to form a stable complex and then added to the cell culture system, and combined with curcumin and resveratrol to induce stem cells to secrete functionally enhanced exosomes, thereby enhancing their anti-inflammatory, antioxidant and tissue repair activities.

[0032] The present invention extracts three types of functional ingredients from traditional Chinese medicine: curcumin, resveratrol and plant miRNA. These can be used separately or in combination to regulate and induce the secretion of stem cell exosomes, effectively improving the anti-inflammatory, antioxidant and tissue repair capabilities of the prepared exosomes, and enhancing their functional activity and application potential in the fields of diabetes treatment and tissue regeneration.

[0033] The present invention still adopts a low-oxygen dynamic culture strategy on the serum-free medium. When the cell density reaches 70-80% confluence, the culture is continued for 40-48 hours to further promote the secretion of exosomes. The present invention optimizes the bioburden characteristics of exosomes, enabling curcumin, resveratrol, and miRNA to be efficiently encapsulated within the exosomes, thereby improving their stability and bioavailability. The present invention adopts a low-oxygen dynamic culture scheme. The low-oxygen dynamic environment can activate the cell secretion mechanism and improve the vesicle encapsulation capacity. At the same time, the functional components of traditional Chinese medicine and miRNA are added simultaneously when the cell density reaches 70-80% confluence, and are packaged into exosomes through cellular uptake and MVB (multivesicular body) processing pathways. In particular, under the condition of using a transfection reagent to promote miRNA endocytosis, the above-mentioned induction mechanism works synergistically, allowing curcumin, resveratrol, and miRNA to be efficiently encapsulated within the exosomes, thereby significantly improving their stability and bioavailability.

[0034] During the continued culture period, growth factors and regulatory factors may be added to the serum-free culture medium to enhance the production of exosomes and their biological functions. The growth factors of the present invention include at least one of the following: transforming growth factor, fibroblast growth factor, epidermal growth factor, insulin-like growth factor, vascular endothelial growth factor, hepatocyte growth factor, glutathione, interleukin-6, interleukin-10, and tumor necrosis factor receptor; for example, at least one of transforming growth factor (TGF-β1), fibroblast growth factor (bFGF), epidermal growth factor (EGF), insulin-like growth factor (IGF-1), vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), glutathione (GSH), and interleukin-6 (IL-6) may be added to increase the secretion of exosomes, reduce oxidative stress, and enhance their role in cell repair and tissue regeneration. In one embodiment of the present invention, the growth factors added are at least one of the following final concentrations: TGF-β 11-10 ng / mL, bFGF 10-50 ng / mL, EGF 5-20 ng / mL, IGF-1 10-50 ng / mL, VEGF 10-50 ng / mL, HGF 10-50 ng / mL, GSH 5 mM and IL-6 5-20 ng / mL.

[0035] In the present invention, at least one of fibroblast growth factor-21 (FGF-21), interleukin-10 (IL-10), and tumor necrosis factor receptor (sTNFR) can also be added to enhance the immunomodulatory ability of exosomes and reduce inflammation levels, thereby enhancing their potential application in inflammatory-related diseases. In one embodiment of the present invention, the amount added can be 20-100 ng / mL of FGF-21, 5-20 ng / mL of IL-10, and 10-50 ng / mL of sTNFR.

[0036] The regulatory factors of the present invention include adenosine monophosphate-activated protein kinase (AMPK) agonist (AICAR) and / or peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α) to further improve insulin sensitivity, optimize glucose metabolism regulation function, and make exosomes more suitable for intervention in diabetes and its related complications. In one embodiment of the present invention, the added regulatory factors are AICAR and / or PGC-1α, and the amount of AICAR added can be 10 to 100 μM, and the amount of PGC-1α added can be 5 to 50 ng / mL. The present invention significantly improves the biological activity of exosomes through the optimized combination of specific factors, thereby having a broader application prospect in the field of diabetes treatment and regenerative medicine.

[0037] After the continued culture, the culture supernatant is collected and centrifuged to remove residual intact cells. The centrifugation is performed at 4°C, with a centrifugal force of 300g for 10 minutes. Cell debris is then removed by centrifugation at 4°C, with a centrifugal force of 2000g for 20 minutes. Exosomes are extracted from the purified supernatant using methods such as ultrafiltration, tangential flow filtration (TFF), polymer precipitation, size exclusion chromatography, or ultracentrifugation. In one embodiment of the present invention, the exosome vesicles are extracted using an ultrafiltration method, specifically comprising the following steps: first filtering the supernatant using a cell filtration membrane with a pore size of 4 μm, then further filtering through a 0.22 μm filter membrane, then enriching the exosomes using a tangential flow filtration (TFF) system, and centrifuging at 3000 g for 1-2 hours using an Amicon Ultra-15 centrifugal filter (molecular weight cutoff of 100 kDa) to concentrate the exosomes. The exosomes are then washed and resuspended in a buffer such as PBS or lactated Ringer's solution, and the process is repeated twice to obtain an exosome solution with an osmotic pressure of 250-310 mOsmol / L and a pH range of 6.0-8.0. The obtained mesenchymal stem cell exosomes were observed by transmission electron microscopy (TEM) and showed typical cup-shaped structures with diameters ranging from 40 to 150 nm.

[0038] The present invention also provides stem cell exosome vesicles prepared using the above preparation method.

[0039] The present invention also provides a stem cell exosome vesicle freeze-dried powder prepared using the above-mentioned stem cell exosome vesicles as the main raw material.

[0040] The present invention also freeze-dries the stem cell exosome vesicles to improve storage stability. Before freeze-drying, a protective agent is also added, and the protective agent includes at least one of the following: trehalose, sucrose and mannose. In one embodiment of the present invention, the obtained exosomes are freeze-dried. Before freeze-drying, trehalose, sucrose or mannose is added as a protective agent, and the exosome sample is pre-frozen to -80°C for 2 to 4 hours, and then sublimated at a condensation temperature of -40°C to -50°C and a vacuum pressure of 10 to 100 Pa for 2 to 6 hours using a freeze dryer, and then resolved at a temperature of 25°C to 35°C for 4 to 8 hours to ensure the stability of the exosome structure. After freeze-drying, the exosomes are sealed and packaged, stored at 2 to 8°C for a short period of time, and stored at -20°C to -80°C for a long period of time. The amount of the protective agent added can be 2-10% w / v, such as 2% w / v, 3% w / v, 4% w / v, 5% w / v, 6% w / v, 7% w / v, 8% w / v, 9% w / v or 10% w / v. In one embodiment, the amount of trehalose added is 5% w / v and the amount of mannose added is 2% w / v, but this cannot be considered as the entire protection scope of the present invention.

[0041] The present invention also provides the use of the above-mentioned stem cell exosome vesicles or the above-mentioned stem cell exosome vesicle freeze-dried powder in the preparation of a drug for treating diabetes and / or diabetic complications.

[0042] In one embodiment of the present invention, curcumin and resveratrol are added to the stem cell culture process to induce stem cell proliferation and secretion of exosomes with enhanced function. Curcumin and resveratrol are both natural active ingredients with multiple effects, including anti-inflammatory, antioxidant, anti-fibrotic, and telomere-protective properties. Curcumin reduces inflammation by inhibiting the NF-κB signaling pathway and enhances antioxidant capacity by regulating the Nrf2 signaling pathway, thereby reducing pancreatic beta cell damage. Resveratrol, on the other hand, activates the SIRT1 pathway, increasing telomerase activity, delaying beta cell aging, and enhancing the repair capacity of stem cell exosomes. This invention optimizes the method for loading curcumin and resveratrol into exosomes, significantly improving their bioavailability in diabetes treatment and promoting pancreatic beta cell repair by regulating miRNAs such as miR-29a, miR-146a, miR-21, and miR-126. The exosome vesicles described in the present invention can not only lower blood sugar, reduce inflammatory damage, and delay cell aging, but also improve the regeneration capacity of β cells in diabetic patients, and have broader application prospects in the treatment of diabetic complications (such as diabetic foot and diabetic retinopathy).

[0043] The present invention also provides a drug for treating diabetes and / or diabetic complications, which uses the above-mentioned stem cell exosome vesicles or the above-mentioned stem cell exosome vesicle freeze-dried powder as an active ingredient and also includes pharmaceutically acceptable excipients.

[0044] The present invention does not particularly limit the dosage form of the drug, and it can be prepared using corresponding excipients to obtain a dosage form that can be absorbed by the body.

[0045] To further illustrate the present invention, the following detailed description of the stem cell exosome vesicles induced by a functional component of traditional Chinese medicine, the preparation method, and the application thereof is provided by the present invention in conjunction with the examples. However, these examples should not be construed as limiting the scope of protection of the present invention.

[0046] Example 1

[0047] Under sterile conditions, human umbilical cord mesenchymal stem cells (hUC-MSCs) were selected and cultured using the tissue block method. Specifically, the fresh umbilical cord was cut into 1-2 mm 3 Tissue explants were cultured in DMEM / F12 medium supplemented with 20% fetal bovine serum until cells adhered and were subsequently expanded to passage 3 (P3). Subsequently, cells were transferred to a microcarrier bioreactor system for large-scale expansion at 37°C in hypoxic conditions of 5% CO₂ and 5% O₂. The culture medium was replaced after 24 hours.

[0048] When the cells reached 70-80% confluence, the medium was replaced with serum-free AOF medium (ROHTO Pharmaceutical, Japan). The following exosome secretion inducer combination was added: curcumin (15 μM), resveratrol (40 μM), IGF-1 (50 ng / mL), FGF-21 (100 ng / mL), TGF-β1 (10 ng / mL), VEGF (50 ng / mL), HGF (50 ng / mL), IFN-γ (10 ng / mL), IL-6 (20 ng / mL), IL-10 (20 ng / mL), sTNFR (50 ng / mL), AICAR (100 μM), PGC-1α (50 ng / mL), BMP-7 (20 ng / mL), and GSH (5 mM).

[0049] Simultaneously, plant-derived miRNAs (21-25 nt in length) were extracted from turmeric and knotweed plant tissue residues using the TRIzol lysis method combined with a small RNA enrichment kit. The extracted miRNAs were concentrated and then complexed with a cationic transfection reagent (Lipofectamine RNAiMAX) to form nanoparticles. These nanoparticles were then added to the culture system, where they synergistically induced stem cells to secrete function-enhancing exosomes, along with curcumin and resveratrol.

[0050] After the cells were cultured for an additional 48 hours, the culture supernatant was collected and centrifuged at 300g for 10 minutes to remove intact cells and then at 2000g for 20 minutes to remove cellular debris. The supernatant was filtered through a 0.22μm membrane and then enriched and concentrated using a TFF system coupled with a 100kDa cutoff ultrafilter, ultimately yielding structurally intact stem cell exosomes with a particle size range of 40 to 150nm.

[0051] The concentrate was preservative-added with 5% (w / v) trehalose and 2% (w / v) mannose. After precooling at -80°C for 3 hours, the concentrate was placed in a freeze dryer and sublimed at -50°C under a vacuum pressure of 30 Pa for 6 hours, followed by desorption at 28°C for 6 hours. The resulting freeze-dried exosome powder was immediately sealed and packaged for short-term storage at 2-8°C and long-term storage at -20°C to -80°C.

[0052] Example 2

[0053] The cell culture, expansion, and exosome purification and storage methods of this embodiment are consistent with those of Example 1, except that the concentration of the inducer is adjusted. After the cell density reaches 70-80% confluence, the serum-free medium is replaced, and curcumin (15 μM), resveratrol (30 μM), and IGF-1 (20 ng / mL), FGF-21 (80 ng / mL), TGF-β1 (10 ng / mL), VEGF (30 ng / mL), HGF (30 ng / mL), IFN-γ (8 ng / mL), IL-6 (20 ng / mL), IL-10 (20 ng / mL), sTNFR (40 ng / mL), AICAR (80 μM), PGC-1α (50 ng / mL), BMP-7 (10 ng / mL), and GSH (5 mM) are added as exosome secretion inducers.

[0054] Example 3

[0055] The cell culture, expansion, and exosome purification and storage methods of this embodiment are consistent with those of Example 1, except that the concentration of the inducer is adjusted. After the cell density reaches 70-80% confluence, the serum-free medium is replaced, and curcumin (5 μM), resveratrol (10 μM), and IGF-1 (10 ng / mL), FGF-21 (20 ng / mL), TGF-β1 (1 ng / mL), VEGF (10 ng / mL), HGF (10 ng / mL), IFN-γ (5 ng / mL), IL-6 (5 ng / mL), IL-10 (5 ng / mL), sTNFR (10 ng / mL), AICAR (10 μM), PGC-1α (5 ng / mL), BMP-7 (7 ng / mL), and GSH (5 mM) are added as exosome secretion inducers.

[0056] Comparative Example 1: No curcumin and resveratrol added

[0057] This comparative example is consistent with the cell culture, expansion and exosome extraction methods of Example 1, except that curcumin and resveratrol were not added, and the other growth factors and culture conditions remained unchanged. After the cell density reached 70-80% confluence, the serum-free medium was replaced and only IGF-1 (50 ng / mL), FGF-21 (100 ng / mL), TGF-β1 (10 ng / mL), VEGF (50 ng / mL), HGF (50 ng / mL), IFN-γ (10 ng / mL), IL-6 (20 ng / mL), IL-10 (20 ng / mL), sTNFR (50 ng / mL), AICAR (100 μM), PGC-1α (50 ng / mL), BMP-7 (20 ng / mL) and GSH (5 mM) were added. After the cells were cultured for 48 hours, the culture supernatant was collected and exosomes were extracted using the same centrifugation, ultrafiltration and TFF system as in Example 1.

[0058] Comparative Example 2: Using Curcumin Only

[0059] This comparative example is consistent with the cell culture, expansion, and exosome extraction methods of Example 1, except that curcumin is used alone, while the other growth factors and culture conditions remain the same. The exosome extraction method is the same as in Example 1.

[0060] Comparative Example 3: Using only resveratrol

[0061] This comparative example is consistent with the cell culture, expansion, and exosome extraction methods of Example 1, except that resveratrol is used alone, and the other growth factors and culture conditions remain the same. The exosome extraction method is the same as in Example 1.

[0062] Comparative Example 4: No induction factor added

[0063] This comparative example was consistent with the cell culture, expansion, and exosome extraction methods of Example 1, except that only curcumin (15 μM) and resveratrol (40 μM) were added to the culture medium, without the addition of active inducing factors such as IGF-1, FGF-21, TGF-β1, VEGF, HGF, IFN-γ, IL-6, IL-10, sTNFR, AICAR, PGC-1α, BMP-7, and GSH. After the cells were cultured for an additional 48 hours, exosomes were extracted using the same method as in Example 1.

[0064] Comparative Example 5: Using ordinary high-sugar culture medium

[0065] This comparative example follows the same cell culture, expansion, and exosome extraction methods as in Example 1, except that high-glucose DMEM (containing 25 mM glucose) + 10% FBS was used for culture, serum-free medium was omitted, and curcumin, resveratrol, and growth factors were omitted. After the cells reached a density of 70-80% confluency, the cells were cultured for 48 hours. The culture supernatant was collected and exosomes were extracted using the same method as in Example 1.

[0066] Comparative Example 6: No Hypoxia Culture and Dynamic Culture

[0067] This comparative example is consistent with the cell culture, expansion, and exosome extraction methods of Example 1, except that the culture environment does not use hypoxia (5% O2) culture, nor does it use a rotating bioreactor for dynamic culture. Instead, a conventional T75 cell culture flask is used. The cells are statically cultured in a constant temperature and humidity CO2 cell incubator (Thermo Forma 3111) under normoxic conditions (21% O2), 5% CO2, 37°C temperature, and 95% air humidity, while the other conditions remain unchanged. After the cells are cultured for 48 hours, exosomes are extracted according to the same method as in Example 1.

[0068] Comparative Example 7: Unoptimized Lyophilization Protectant

[0069] The cell culture, expansion and exosome extraction methods of this comparative example are consistent with those of Example 1, except that only 5% w / v trehalose is added as a protective agent before lyophilization, and the other steps remain the same.

[0070] Experimental Example 1

[0071] The exosome secretion levels of Examples 1 to 3 and Comparative Examples 1 to 7 after culture and purification by ultrafiltration combined with tangential flow filtration (TFF) were compared. The obtained exosomes were used for nanoparticle tracking analysis (NTA) to determine the concentration (particles / mL) and BCA method to determine the protein concentration (μg / mL) to evaluate the secretion levels of exosomes in different experimental groups. The NTA test results are shown in Table 1. The exosome concentrations of Examples 1 to 3 were higher, among which the exosome concentration of Example 1 was the highest (1.0×10 11 In the control groups, the use of curcumin and resveratrol (control group 1) and the use of unoptimized culture conditions (control groups 4, 5, and 6) all resulted in a significant decrease in exosome concentrations, with control group 4 producing the lowest exosome secretion (5.5×10 10 The results of BCA assay for exosome protein concentration are shown in Table 1. Consistent with the trend of NTA, the exosome protein concentration in Example 1 was the highest (150±6 μg / mL), and the control group was lower than the example group overall, indicating that optimizing the culture strategy is helpful to improve exosome yield and protein enrichment level.

[0072] Table 1 Exosome concentration and protein concentration after purification in each group

[0073] Group Exosome concentration (particles / mL) Protein concentration (μg / mL) Example 1 <![CDATA[1.0×10 11 ]]> 150±6 Example 2 <![CDATA[9.8×10 10 ]]> 145±4 Example 3 <![CDATA[9.5×10 10 ]]> 140±3 Comparative Example 1 <![CDATA[6.5×10 10 ]]> 100±6 Comparative Example 2 <![CDATA[7.2×10 10 ]]> 110±5 Comparative Example 3 <![CDATA[6.8×10 10 ]]> 105±4 Comparative Example 4 <![CDATA[5.5×10 10 ]]> 90±7 Comparative Example 5 <![CDATA[7.8×10 10 ]]> 115±5 Comparative Example 6 <![CDATA[8.0×10 10 ]]> 120±4 Comparative Example 7 <![CDATA[6.2×10 10 ]]> 98±4

[0074] Experimental Example 2

[0075] Exosomes from each group were analyzed using transmission electron microscopy (TEM) and dynamic light scattering (DLS). The extracted exosomes were negatively stained with 2% phosphotungstic acid. The typical cup-shaped structure of the exosomes was observed under TEM, and their size distribution was measured. DLS was also used to measure the particle size of the exosomes to assess their homogeneity and stability.

[0076] The TEM observation results are shown in Table 2. The exosomes of Examples 1 to 3 were complete in morphology, all exhibiting a typical cup-shaped structure, while the exosomes of the comparative example group were partially incomplete, especially in comparative example 4, which had a relatively fragmented morphology. The DLS results are shown in Table 2. The exosomes of the example group had a smaller particle size distribution and better uniformity (100-108 nm), while the exosomes of the comparative example group had a larger particle size, especially in comparative example 4, which had the highest particle size (130 nm), indicating that the culture conditions without the use of growth factors may lead to exosome aggregation or heterogeneity.

[0077] Table 2 Exosome morphology of each group

[0078] Group Average particle size (nm) TEM morphological integrity Example 1 100 +++ Example 2 105 ++ Example 3 108 ++ Comparative Example 1 120 + Comparative Example 2 118 + Comparative Example 3 115 + Comparative Example 4 130 + Comparative Example 5 112 ++ Comparative Example 6 110 ++ Comparative Example 7 125 +

[0079] Experimental Example 3 Encapsulation efficiency and drug loading efficiency of nanocellular vesicles loaded with curcumin and resveratrol

[0080] First, stem cells were cultured according to the methods of Examples 1-3 and Comparative Examples 1-7, and exosomes were extracted by ultrafiltration combined with tangential flow filtration (TFF). Subsequently, curcumin (15 μM) and resveratrol (40 μM) were loaded using the co-incubation method of Examples 1 to 3 and Comparative Examples 1 to 7, and the exosomes were suspended in the drug solution and incubated at 37 ° C for 2 hours. The loaded exosome solution was subjected to ultracentrifugation (100000 g, 2 h, 4 ° C) to remove unencapsulated free drugs, and the supernatant was taken to determine the free drug concentration to calculate the encapsulation efficiency (EE%) and drug loading rate (DL%).

[0081] The contents of curcumin and resveratrol in exosomes were analyzed by high-performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS). After the exosome samples were extracted, acetonitrile-water gradient elution was performed, and the drug concentrations (μg / mL) in exosomes were calculated using a standard curve.

[0082] The method for calculating the encapsulation efficiency (EE%) is:

[0083] EE% = (total amount of drug in exosomes / total amount of drug initially added) × 100%;

[0084] The method for calculating drug loading rate (DL%) is:

[0085] DL% = (total amount of drug in exosomes / total mass of exosomes) × 100%.

[0086] All samples were replicated three times. GraphPad Prism 9 was used for data analysis. Encapsulation efficiency and drug loading capacity were compared across experimental groups, with a significance level of *p* < 0.05. Ultimately, the encapsulation efficiency and drug loading rate data were used to evaluate and optimize the drug loading capacity of exosomes, providing experimental evidence for their application in diabetes and related diseases.

[0087] The HPLC / LC-MS results are shown in Table 3. The exosomes from Examples 1 to 3 exhibited the highest encapsulation and drug loading efficiencies for curcumin and resveratrol. In Example 1, the curcumin encapsulation efficiency was 85.2±2.1%, the resveratrol encapsulation efficiency was 82.5±1.8%, and the drug loading efficiencies were 6.8±0.5% and 7.2±0.4%, respectively. This indicates that optimized culture conditions significantly enhance the exosome drug loading capacity (p<0.05). The encapsulation and drug loading efficiencies of the control groups were generally lower, particularly in Control 1, which lacked curcumin or resveratrol. Comparative Examples 2 and 3 exhibited no detectable drug encapsulation, respectively. Furthermore, unoptimized culture conditions (Comparative Examples 4, 5, and 6) also resulted in decreased encapsulation efficiencies, demonstrating that hypoxic culture, dynamic culture, and optimized growth factor conditions are crucial for drug loading.

[0088] Table 3 Comparison of encapsulation efficiency and drug loading efficiency of each group

[0089]

[0090]

[0091] Experimental Example 4 Pancreatic β cell survival rate experiment

[0092] The survival rate of INS-1 cells was determined by CCK-8 assay. INS-1 cells were seeded into 96-well plates (5×10 4 / well), cultured with high glucose (33 mM glucose) for 48 hours to simulate the diabetic microenvironment, and then exosomes (100 μg / mL) of each group were added. After 48 hours of culture, 10 μL of CCK-8 reagent was added, the absorbance was measured at a wavelength of 450 nm, and the relative cell survival rate was calculated.

[0093] CCK-8 test results Figure 1 As shown, the example groups significantly improved the survival rate of pancreatic β cells, with Example 1 having the highest cell survival rate (85±3%), significantly higher than the control group (p<0.05). In comparison, control groups 1, 4, and 7 showed the lowest survival rates (40-50%), suggesting that optimizing exosome culture strategies and drug loading can effectively improve pancreatic β cell survival.

[0094] Experimental Example 5 Insulin secretion experiment

[0095] Insulin levels secreted by INS-1 cells were measured by ELISA. Similar to the CCK-8 assay, the culture medium was collected after cell culture and insulin concentration was measured using an ELISA kit to assess the promoting effect of exosomes on pancreatic β-cell function.

[0096] ELISA test results Figure 2 As shown, Examples 1 to 3 significantly promoted insulin secretion in INS-1 pancreatic β cells, with Example 1 producing the highest insulin secretion (10.0±0.5 ng / mL), significantly higher than the control group without optimized exosomes (p<0.05). Comparative Examples 1 and 4 had the lowest insulin secretion (4.0-5.0 ng / mL), indicating that exosomes without curcumin and resveratrol loading and growth factors had a weaker promoting effect on pancreatic β cells.

[0097] Experimental Example 6 Treatment experiment of diabetic mice

[0098] The effects of exosomes on blood glucose levels and pancreatic beta cell repair were evaluated in a STZ-induced diabetic mouse model. C57BL / 6 mice were induced with an intraperitoneal injection of STZ (50 mg / kg) to induce diabetes. The mice were randomly divided into two groups and received weekly tail vein injections of exosomes at 100 μg / mouse for four weeks. Fasting blood glucose levels were measured weekly, and an intraperitoneal glucose tolerance test (IPGTT) was performed at the end of the study.

[0099] The experimental results of the STZ-induced diabetic mouse model are shown in Table 6. The Example group significantly reduced the endpoint blood glucose level of diabetic mice and promoted the repair of pancreatic β cells. Among them, the endpoint blood glucose level of Example 1 group was the lowest (7.5±0.5mmol / L), the pancreatic β cell area was the largest (70±4%), and the insulin level was the highest (10.5±0.5ng / mL), which were significantly better than the control group (p<0.05). The blood glucose level of the control group 1 and 4 was the highest (>14.0mmol / L) and the pancreatic β cell area was the smallest (<35%), indicating that optimizing exosome therapy can significantly improve the pathological state of diabetes.

[0100] Table 6 Experimental results of STZ-induced diabetic mouse model

[0101] Group End point blood glucose (mmol / L) Pancreatic β cell area (%) Insulin level (ng / mL) Blank group 6.0±0.4 80±3 11.0±0.4 Model Group 18.0±0.6 15±5 4.0±0.6 Example 1 7.5±0.5 70±4 10.5±0.5 Example 2 8.0±0.6 65±5 9.8±0.4 Example 3 8.5±0.5 60±4 9.0±0.3 Comparative Example 1 15.0±0.8 30±6 5.5±0.6 Comparative Example 2 13.0±0.7 40±5 6.5±0.5 Comparative Example 3 14.0±0.6 35±5 6.0±0.4 Comparative Example 4 16.0±0.9 20±7 4.5±0.7 Comparative Example 5 12.0±0.6 50±4 7.5±0.5 Comparative Example 6 10.5±0.5 55±4 8.0±0.4 Comparative Example 7 14.5±0.7 32±6 5.8±0.6

[0102] Experimental Example 7 miRNA expression level (qPCR)

[0103] This study aimed to examine the effects of different exosome treatments on the expression levels of miRNAs (miR-29a, miR-146a, miR-21, and miR-126) in pancreatic β cells, in order to evaluate the role of curcumin and resveratrol-loaded exosomes in regulating pancreatic islet function. First, INS-1 cells (1×10 6 / well) were inoculated into 6-well plates and cultured at 37°C and 5% CO2 for 24 hours, followed by replacement with high-glucose (33mM glucose) culture medium to simulate the diabetic microenvironment. Subsequently, the exosomes purified in Examples 1 to 3 and Comparative Examples 1 to 7 were added respectively, and the culture was continued for 48 hours. After the culture was completed, total RNA was extracted using TRIzol reagent. After RNA extraction, cDNA was synthesized using a miRNA reverse transcription kit, and the cDNA product was used for subsequent SYBR Green qPCR detection. The qPCR reaction conditions were set to 95°C for 10 min pre-denaturation, 95°C for 15s, 60°C for 60s, and 40 cycles. U6 was used as the internal reference gene, and the relative expression level of miRNA was calculated using the ΔΔCt method.

[0104] The qPCR test results are shown in Table 8. Examples 1 to 3 significantly upregulated the expression of miR-29a, miR-146a, miR-21, and miR-126, with Example 1 showing the highest miRNA expression level. In contrast, Comparative Examples 1, 4, and 7 showed the lowest miRNA expression levels (all <1.5), indicating that the optimized exosomes can enhance β-cell function and anti-inflammatory effects by regulating the miRNA pathway.

[0105] Table 7 miRNA primer sequences used for qPCR detection (5′→3′)

[0106]

[0107]

[0108] Table 8 miRNA expression levels

[0109] Group miR-29a miR-146a miR-21 miR-126 Example 1 4.2±0.3 3.8±0.2 5.1±0.4 4.5±0.3 Example 2 3.9±0.2 3.5±0.2 4.7±0.3 4.2±0.3 Example 3 3.5±0.3 3.2±0.2 4.3±0.3 3.9±0.2 Comparative Example 1 1.2±0.1 1.0±0.1 1.5±0.1 1.3±0.1 Comparative Example 2 2.0±0.2 1.8±0.2 2.3±0.2 2.0±0.2 Comparative Example 3 1.8±0.2 1.6±0.1 2.0±0.2 1.9±0.2 Comparative Example 4 1.5±0.2 1.3±0.1 1.7±0.1 1.6±0.1 Comparative Example 5 2.5±0.2 2.2±0.2 3.0±0.2 2.7±0.2 Comparative Example 6 3.0±0.2 2.8±0.2 3.5±0.3 3.2±0.2 Comparative Example 7 1.7±0.2 1.4±0.1 1.9±0.2 1.8±0.1

[0110] Experimental Example 8 Telomere Length Measurement Experiment (qPCR)

[0111] This study aimed to examine the effects of different exosomes on telomere length in pancreatic β cells to evaluate their telomere protection ability. First, INS-1 cells (1×10 6 / well) were inoculated in 6-well plates and cultured in high-glucose (33 mM) medium. Different exosomes (100 μg / mL) were added and cultured for 7 days. Subsequently, genomic DNA was extracted using the QIAGEN DNA extraction kit, and its concentration and purity (OD 260 / 280 =1.8-2.0). Telomere length was measured using SYBR Green fluorescent quantitative PCR (qPCR). The telomere (T)-specific gene and the single-copy gene (S) were amplified separately. The qPCR system consisted of SYBR Green PCR Master Mix, specific primers, and DNA template. The total reaction volume was 20 μL. PCR cycling conditions were 95°C for 10 min, 95°C for 15 s, and 60°C for 60 s, for 35 cycles. The T / S ratio was calculated to assess relative telomere length. Three technical replicates were performed for each group.

[0112] TF (SEQ ID No. 11): GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGT GAGGGT;

[0113] TR (SEQ ID No. 12):TCCCGACTATCCCTATCCCTATCCCTATCCCTAT CCCTA;

[0114] SF (SEQ ID No. 13): CAGCAAGTGGGAAGGTGTAATCC;

[0115] SR (SEQ ID No. 14): CCATTCTATCATCAACGGGTACAA.

[0116] qPCR test results are as follows Figure 3 As shown, the Example groups significantly prolonged the telomere length of INS-1 cells, with Example 1 having the highest telomere T / S ratio (1.50±0.05), significantly higher than all the control groups (p<0.05). In contrast, Control Examples 1, 4, and 7 had the lowest T / S ratios (0.80-0.90), suggesting that optimizing exosomes can improve β-cell aging by extending telomere length.

[0117] Experimental Example 9 Telomerase Activity Detection Experiment (TRAP Experiment)

[0118] This study aimed to examine the effects of different exosomes on telomerase activity in pancreatic β cells, in order to evaluate their role in telomere function maintenance and cell senescence regulation. First, INS-1 cells (1×10 6The cells were seeded with 100 μg / mL of exosomes (100 μg / mL) in 6-well plates and cultured in high-glucose (33 mM) medium. The cells were then cultured for 7 days under the same conditions as the telomere length measurement experiment. After culture, total cellular protein was extracted using the TRAPeze Telomerase Detection Kit, and the protein concentration was measured to ensure consistent protein input across all groups. Telomerase activity was then detected using the telomerase amplification reaction (TRAP). After PCR amplification, the products were subjected to agarose gel electrophoresis to visualize the amplified bands. Telomerase activity was then detected using fluorescent quantitative PCR, with activity levels expressed as relative fluorescence units (RFU).

[0119] TRAP test results are as follows Figure 4 As shown, the telomerase activity of Examples 1 to 3 was significantly enhanced, among which the telomerase activity of Example 1 was the highest (2.10±0.05RFU), which was significantly higher than that of all the control groups (p<0.05). The telomerase activity of Control Examples 1 and 4 was the lowest (1.00-1.10RFU), indicating that the telomerase activity of pancreatic β cells treated with unoptimized exosomes was weak, which may affect cell proliferation and repair ability.

[0120] In summary, Examples 1-3 outperformed the control group in terms of increasing exosome secretion, stabilizing exosome morphology, enhancing drug loading capacity, promoting β-cell survival, increasing insulin secretion, lowering blood glucose levels, extending telomere length, and enhancing telomerase activity. The exosomes from Example 1 performed particularly well, demonstrating that their optimized culture environment and drug loading strategy effectively enhance the therapeutic potential of exosomes, providing important support for their clinical application in diabetes and related diseases.

[0121] Experimental Example 10 Pathological changes in pancreatic tissue of mice

[0122] To further evaluate the repair effect of exosome therapy on the pancreatic tissue structure of diabetic mice, mice were sacrificed at the end of the experiment in Example 6, and fresh pancreatic tissue was obtained and fixed in 4% paraformaldehyde for 24 hours. The tissue was then dehydrated, paraffin-embedded, and sectioned (5 μm thick). The tissue was then stained with hematoxylin-eosin (H&E), dehydrated, and mounted. Finally, the tissue pathological characteristics were observed under a microscope and photographed.

[0123] The experimental results are as follows Figure 5The results showed that the pancreatic tissue in the blank group was normal, the pancreatic cell structure was normal, and the cell membrane was clear. The pancreatic tissue in the model group was abnormal, and the acinar cells in the pancreatic tissue were loosely arranged, falling off, and fragmented; the islets were irregular in shape, with nuclear condensation; cracks appeared in the islets, and the cytoplasm was vacuolated; and a small amount of capillary congestion and dilation were seen. The pancreatic tissue structure of the Example 1 group was significantly improved, the acinar cells were arranged more tightly, the islet morphology tended to be complete, the cells were arranged more regularly, and the islet borders were restored in some areas. Nuclear condensation and vacuolation were significantly reduced, and the degree of lesions was significantly alleviated compared with the model group. The above results suggest that the optimized exosomes (Example 1) described in the present invention have obvious tissue protection and structural improvement effects in the repair of diabetic pancreatic damage, showing good effects of promoting the recovery of islet structure and reducing cell damage.

[0124] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A method for preparing stem cell exosome vesicles, characterized in that: The following steps are involved: The functional components of traditional Chinese medicine are added to the serum-free culture medium for culturing stem cells, and the cells are cultured until the density of the stem cells reaches 70-80% fusion, and then cultured for 40-48 hours. The culture supernatant containing the stem cell exosome vesicles is collected.

2. The preparation method according to claim 1, characterized in that The sources of the stem cells include any one of the following: bone marrow, umbilical cord, umbilical cord blood, placenta or endometrium.

3. The preparation method according to claim 1, characterized in that The functional components of traditional Chinese medicine include at least one of the following: curcumin, resveratrol and miRNA, and the working concentration of the curcumin is 5 to 20 μM, and the working concentration of the resveratrol is 10 to 50 μM.

4. The preparation method according to claim 3, characterized in that The traditional Chinese medicine functional ingredients are extracted from turmeric and / or knotweed.

5. The preparation method according to claim 1, characterized in that: During the continued culture period, growth factors and / or regulatory factors are also added; The growth factors include at least one of the following: transforming growth factor, fibroblast growth factor, epidermal growth factor, insulin-like growth factor, vascular endothelial growth factor, hepatocyte growth factor, glutathione, interleukin-6, interleukin-10 and tumor necrosis factor receptor; The regulatory factors include adenosine monophosphate-activated protein kinase agonist and / or peroxisome proliferator-activated receptor gamma coactivator 1α.

6. Stem cell exosome vesicles prepared by the preparation method according to any one of claims 1 to 5.

7. A stem cell exosome vesicle freeze-dried powder prepared using the stem cell exosome vesicle according to claim 6 as the main raw material.

8. The stem cell exosome vesicle freeze-dried powder according to claim 7, characterized in that: The stem cell exosome vesicle freeze-dried powder also includes a protective agent, which includes at least one of the following: trehalose, sucrose and mannose.

9. Use of the stem cell exosome vesicles according to claim 6 or the stem cell exosome vesicle lyophilized powder according to claim 7 or 8 in the preparation of a medicament for treating diabetes and / or diabetic complications.

10. A drug for treating diabetes and / or diabetic complications, characterized in that: The stem cell exosome vesicles according to claim 6 or the stem cell exosome vesicle freeze-dried powder according to claim 7 or 8 is used as an active ingredient, and further includes pharmaceutically acceptable excipients.

Images