Application of VCPIP1 inhibitor in preparation of medicine for treating pancreatic cancer

Abstract

The invention relates to the technical field of medicines, in particular to application of a VCPIP1 inhibitor in preparation of a medicine for treating pancreatic cancer. Experiments prove that it is found for the first time that VCPIP1 stabilizes YAP protein through a deubiquitination effect, and the VCPIP1 and YAP form a positive feedback loop to promote the development of pancreatic cancer. The invention also provides a VCPIP1 inhibitor CAS-12290-201, which can be used for remarkably inhibiting the proliferation, migration and invasion of pancreatic cancer cells and enhancing the chemosensitivity of gemcitabine. In-vivo and in-vitro experiments show that the targeted VCPIP1 can effectively inhibit tumor growth, and a new strategy is provided for pancreatic cancer treatment.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to the use of a VCPIP1 inhibitor in preparing a drug for treating pancreatic cancer. Background Art

[0002] Pancreatic cancer is one of the most lethal human malignancies, with a median survival of approximately six months. Pancreatic adenocarcinoma (PAAD) accounts for 90% of all pancreatic cancer cases, and current chemotherapy or targeted therapies have limited efficacy in improving patient survival. Therefore, elucidating signaling networks and identifying new therapeutic targets for PAAD patients is crucial. Existing chemotherapy regimens, such as gemcitabine, have limited efficacy due to widespread resistance.

[0003] The Hippo signaling pathway is an evolutionarily conserved signaling pathway in mammals, originally discovered in Drosophila. The Hippo signaling pathway is a self-regulatory pathway that is crucial for controlling organ size, tissue regeneration, and maintaining homeostasis. The core of the Hippo signaling pathway consists of a series of phosphorylation kinases, including serine / threonine protein kinases 1 / 2 (MST1 / 2), large tumor suppressor 1 / 2 (LATS1 / 2), and the transcriptional cofactors YAP and TAZ. When the Hippo signaling pathway is activated, MST1 / 2 promotes the phosphorylation of LATS1 / 2, which in turn leads to the phosphorylation of YAP / TAZ. Phosphorylated YAP / TAZ are sequestered in the cytoplasm and degraded by a group of ubiquitin ligases. When the Hippo signaling pathway is shut down, unphosphorylated YAP / TAZ can enter the nucleus and co-activate transcription factors, such as transcription enhancer binding domain family members (TEADs), to initiate various transcriptional programs. Therefore, further exploration of the function of YAP and its regulatory mechanisms is of great significance for the development of new therapeutic strategies for pancreatic adenocarcinoma. Summary of the Invention

[0004] To solve the above problems, the present invention provides the use of a VCPIP1 inhibitor in the preparation of a drug for treating pancreatic cancer.

[0005] The present invention is achieved through the following technical solutions:

[0006] Use of VCPIP1 inhibitors in the preparation of drugs for treating pancreatic cancer.

[0007] Preferably, the VCPIP1 inhibitor includes a fluoroquinazolinone compound or a siRNA targeting the VCPIP1 gene.

[0008] Preferably, the fluoroquinazolinone compound is

[0009]

[0010] Preferably, the sequence of the siRNA targeting the VCPIP1 gene is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0011] Preferably, the drug contains a VCPIP1 inhibitor as the only active ingredient.

[0012] Preferably, the drug further comprises a pharmaceutically acceptable carrier.

[0013] Preferably, the pharmaceutically acceptable carrier is one or more of a diluent, a disintegrant, a precipitation inhibitor, a glidant, a binder, a dispersant, a suspending agent, an isotonic agent, a thickener, an emulsifier, a preservative and a stabilizer.

[0014] Preferably, the diluent is one or more of lactose, sucrose, mannitol, sorbitol, microcrystalline cellulose, pregelatinized starch, calcium hydrogen phosphate or sodium chloride.

[0015] Preferably, the disintegrant is one or more of cross-linked polyvinylpyrrolidone, cross-linked sodium carboxymethyl cellulose, sodium carboxymethyl starch, low-substituted hydroxypropyl cellulose or sodium starch glycolate.

[0016] A pharmaceutical composition comprises the VCPIP1 inhibitor, a chemotherapy drug and a pharmaceutically acceptable carrier.

[0017] Preferably, the chemotherapy drug is gemcitabine.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention provides the use of a VCPIP1 inhibitor in the preparation of a drug for treating pancreatic cancer. The present invention demonstrates through numerous experiments that VCPIP1 stabilizes the YAP protein by deubiquitinating it, forming a "VCPIP1-YAP" positive feedback loop, revealing for the first time the key role of the VCPIP1-YAP positive feedback loop in pancreatic cancer and filling a mechanistic gap in this field. A VCPIP1 inhibitor, CAS-12290-201, is provided, which can specifically target the catalytic activity of VCPIP1 and significantly inhibit tumor proliferation, migration, and invasion. In vitro and in vivo experiments have confirmed that inhibiting VCPIP1 can reverse YAP-mediated chemotherapy resistance, and its combination with gemcitabine synergizes and enhances the therapeutic effect. The interaction mechanism between the OTU / WW domains of VCPIP1 and YAP is clarified, providing a structural basis for precision drug design. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 This is a result diagram showing that VCPIP1 is a key regulatory factor of the Hippo signaling pathway in pancreatic adenocarcinoma; Figure 1 In the figure, A is the immunohistochemical results of VCPIP1 and YAP expression in normal pancreatic tissue and pancreatic cancer tissue; B is the corresponding statistical results of immunohistochemistry; C is the Kaplan-Meier survival curve; D is the experimental results of the correlation detection of VCPIP1 and YAP protein expression in pancreatic cancer patients; E is the statistical graph of D.

[0022] Figure 2 This is a diagram showing the experimental results of the present invention demonstrating that VCPIP1 is necessary for the progression of PAAD; Figure 2 In the figure, A is the result of qRT-PCR detection of siVCPIP1 knockdown efficiency in AsPC-1 cells; B is the result of qRT-PCR detection of siVCPIP1 knockdown efficiency in PANC-1 cells; C is the result of qRT-PCR detection of CTGF and CYR61 mRNA expression levels in PAAD cells in AsPC-1 cells; D is the result of qRT-PCR detection of CTGF and CYR61 mRNA expression levels in PAAD cells in PANC-1 cells; E is the result of luciferase reporter gene detection of TEAD transcriptional activity in AsPC-1 cells; F is the result of luciferase reporter gene detection of TEAD transcriptional activity in PANC-1 cells; G is the result of Western blotting detection of VCPIP1 and YAP protein levels; H is the result of detection of cell malignant phenotype after knockdown of VCPIP1 in AsPC-1 cells; I is the result of detection of cell malignant phenotype after knockdown of VCPIP1 in PANC-1 cells.

[0023] Figure 3 This is a diagram showing the experimental results of the present invention showing that VCPIP1 is necessary for the progression of PAAD; Figure 3 In the figure, A shows the detection results of PANC-1 cells stably transfected with shControl or shVCPIP1 being subcutaneously inoculated into nude mice; B shows the evaluation of tumor weight; C shows the evaluation of tumor volume; D shows the expression results of proliferating cell nuclear antigen Ki-67, YAP, and VCPIP1 evaluated by IHC experiments; E shows the statistical graph corresponding to D, n = 6, scale bar, 200 μm.

[0024] Figure 4 This figure shows the results of the present invention demonstrating that hydrolysis activity is essential for VCPIP1 to regulate YAP function; Figure 4 A is the result of qRT-PCR detection of CTGF and CYR61 mRNA expression levels in AsPC-1 cells; B is the result of qRT-PCR detection of CTGF and CYR61 mRNA expression levels in PANC-1 cells; C is the result of luciferase reporter gene assay for the detection of TEAD transcriptional activity in AsPC-1 cells; D is the result of luciferase reporter gene assay for the detection of TEAD transcriptional activity in PANC-1 cells; E is the result of Western blotting detection of VCPIP1 and YAP protein levels; F is the result of AsPC-1 The graph showing the results of evaluating the cell proliferation rate in C-1 cells by the CCK-8 method; G is the graph showing the results of evaluating the cell proliferation rate in PANC-1 cells by the CCK-8 method; H is the graph showing the results of evaluating the cell proliferation rate in AsPC-1 cells by the EdU method; I is the statistical graph corresponding to H; M is the graph showing the results of evaluating the cell proliferation rate in PANC-1 cells by the EdU method; N is the statistical graph corresponding to M, with a scale of 200 μm; J is the graph showing the results of evaluating cell migration by the Transwell assay; K and L are the statistical graphs corresponding to J; O is the graph showing the results of evaluating the cell invasion ability by the Transwell assay; P and Q are the statistical graphs corresponding to O.

[0025] Figure 5 This figure shows the results of the present invention demonstrating that hydrolysis activity is essential for VCPIP1 to regulate YAP function; Figure 5 Figure A shows the results of the scratch wound healing assay to evaluate the migration ability of AsPC-1 cells; B shows the corresponding statistical graph for A; C shows the results of the scratch wound healing assay to evaluate the migration ability of PANC-1 cells; D shows the corresponding statistical graph for C. Figure E shows the results of the flow cytometry assessment of the apoptosis of AsPC-1 cells; F shows the corresponding statistical graph for E; G shows the results of the flow cytometry assessment of the apoptosis of PANC-1 cells; H shows the corresponding statistical graph for G.

[0026] Figure 6 This is a result diagram demonstrating that YAP can rescue the inhibitory effect of VCPIP1 knockdown on PAAD in the present invention; Figure 6In the figure, A shows the results of immunoblotting to detect the protein levels of VCPIP1 and YAP in cells; B shows the results of qRT-PCR to detect the mRNA expression levels of CTGF and CYR61 in cells; C shows the transcriptional activity of TEAD detected by luciferase reporter gene assay; D shows the cell proliferation rate assessed by CCK-8 assay, with a scale bar of 200 μm; E shows the tumor size after PANC-1 cells stably transfected with the specified lentivirus were subcutaneously inoculated into nude mice; F shows the expression results of Ki-67, YAP, and VCPIP1 assessed by IHC assay, with a scale bar of 200 μm; G shows the percentage of Ki-67-positive cells, n = 6.

[0027] Figure 7 This is a result diagram demonstrating that VCPIP1 interacts with YAP and regulates the stability of YAP protein; Figure 7 In the figure, A shows the Coomassie blue staining result; B shows the top five proteins with the highest enrichment by IPMS; C and D show the co-IP experiment results.

[0028] Figure 8 The figures show the results of the present invention demonstrating that VCPIP1 interacts with YAP and regulates the stability of YAP protein; A is a graph showing the protein levels of VCPIP1 and YAP in AsPC-1 cells transfected with siControl or siVCPIP1 and treated with 10 μM MG132 for 12 h by immunoblotting; B is a graph showing the protein levels of VCPIP1 and YAP in PANC-1 cells transfected with siControl or siVCPIP1 and treated with 10 μM MG132 for 12 h by immunoblotting; C is a graph showing the experimental results of YAP protein stability when VCPIP1 is knocked down in AsPC-1 cells; D is the statistical graph corresponding to C; E is a graph showing the experimental results of YAP protein stability when VCPIP1 is knocked down in PANC-1 cells; F is the statistical graph corresponding to E.

[0029] Figure 9 This is a result diagram demonstrating that VCPIP1 stabilizes YAP by reducing K48-linked polyubiquitination of YAP; Figure 9 In the figure, A shows the results of detecting K48- and K63-linked ubiquitination in AsPC-1 cells under knockdown conditions; B shows the results of detecting K48- and K63-linked ubiquitination in PANC-1 cells under knockdown conditions. C and D show the results of detecting K48- and K63-linked ubiquitination in overexpression conditions; E shows that VCPIP1 removes YAP protein polyubiquitination at K252, K280, and K315 sites.

[0030] Figure 10This is a result diagram showing that YAP regulates the expression of VCPIP1 in a transcriptional manner in PAAD; Figure 10 In the figure, A is the specific peak of TEAD displayed by IGV at the transcription start site of VCPIP1; B is the specific peak of YAP displayed by IGV at the transcription start site of VCPIP1; C is the result of ChIP experiment verifying the binding of YAP to the promoter region of VCPIP1; D is the result of ChIP-qPCR experiment in AsPC-1 cells verifying that the enrichment level of VCPIP1 promoter is reduced after knocking down YAP; E is the result of ChIP-qPCR experiment in PANC-1 cells verifying that the enrichment level of VCPIP1 promoter is reduced after knocking down YAP; F is the result of immunoblotting to detect the protein levels of VCPIP1 and YAP1; G is the result of immunoblotting to detect the protein level of VCPIP1 in cells after verteporfin treatment; H is the result of immunoblotting to detect the protein level of VCPIP1 in cells after XMU-MP-1 treatment for 48 hours.

[0031] Figure 11 This is a graph showing the results of the VCPIP1 inhibitor CAS-12290-201 of the present invention inhibiting the progression of PAAD. Figure 11 In the figure, A is the result of immunoblotting to detect the protein levels of VCPIP1 and YAP1 in PANC-1 cells after treatment with different concentrations of CAS-12290-201 for 48 hours; B is the result of qRT-PCR to detect the mRNA expression levels of CTGF and CYR61 in cells; C is the result of luciferase reporter gene assay to detect the transcriptional activity of TEAD in cells; D is the result of CCK-8 method to evaluate the proliferation rate of cells; E is the result of VCPIP1 and YAP protein levels after MG132 treatment; F is the result of YAP protein stability experiment; G is the statistical graph corresponding to F.

[0032] Figure 12 This is a graph showing the results of the VCPIP1 inhibitor CAS-12290-201 of the present invention making PAAD cells more sensitive to gemcitabine treatment; Figure 12 In the figure, A is the statistical graph corresponding to the cell drug sensitivity experiment after CAS treatment in AsPC-1 cells; B is the result graph of the cell drug sensitivity experiment after CAS treatment in AsPC-1 cells; C is the statistical graph corresponding to the cell drug sensitivity experiment after CAS treatment in PANC-1 cells; D is the result graph of the cell drug sensitivity experiment after CAS treatment in PANC-1 cells; E is the result graph of cell proliferation after CAS treatment; F is the result graph of tumor weight measurement; G is the result graph of tumor volume measurement; H is the result graph of evaluating the expression of Ki-67 and YAP using IHC experiment, scale bar is 200 μm; I is the result graph of calculating the percentage of Ki-67 positive cells, n=6. DETAILED DESCRIPTION

[0033] To facilitate understanding of the present invention, the present invention will be described more fully below, along with preferred embodiments of the present invention. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the disclosure of the present invention.

[0034] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0035] The present invention is further described in detail below with reference to specific embodiments. However, this should not be construed as limiting the scope of the present invention to the following embodiments, as all technologies implemented based on the present invention fall within the scope of the present invention.

[0036] Example 1

[0037] Unless otherwise specified, all reagents and materials used in the present invention are commercially available.

[0038] 1. Materials and methods

[0039] 1. Reagents.

[0040] VCPIP1 inhibitors CAS-12290-201 (HY-159000), XMU-MP-1 (HY-100526), verteporfin (HY-B0146), cycloheximide (CHX, HY-12320), and MG132 (HY-13259) were purchased from MedChemExpress (MCE).

[0041] 2. Cell culture.

[0042] AsPC-1, HEK-293T, and PANC-1 cells were purchased from the American Type Culture Collection (ATCC). AsPC-1 cells were cultured in RPMI-1640 medium (Pnose, catalog number PM150110B). HEK-293T and PANC-1 cells were cultured in DMEM medium (Pnose, catalog number PM150210B). Culture conditions were set at 37°C in an incubator containing 5% CO2.

[0043] 3. Screening of deubiquitinating enzymes (DUBs).

[0044] The TCGA-PAAD dataset was obtained from the genomic data sharing repository. Gene set enrichment analysis was performed using Gene Set Enrichment Analysis software, version 4.3.3, and normalized enrichment scores were recorded. DUBs with a NES greater than 1.5 were further screened for siRNAs. The mRNA expression level of connective tissue growth factor (CTGF) was measured, and the DUBs were ranked according to CTGF expression levels.

[0045] 4. Mouse xenograft tumor model.

[0046] Mice were purchased from Beijing Sibeifu Biotechnology Co., Ltd. 6-week-old female nude mice were randomly divided into groups of 6. In the in vivo experiments, 3×10 6 PANC-1 cells were subcutaneously injected into mice. Tumor-bearing mice were observed for 6 weeks, and tumor volume was recorded weekly. Tumor volume was calculated using the formula: volume = length × width.

[0047] 5. Plasmids and siRNA.

[0048] The VCPIP1 siRNA sequence used was siVCPIP1#1 or siVCPIP1#2.

[0049] The sequence of siVCPIP1#1 is shown in SEQ ID NO. 1: CAGGCAGCUUGAUCCUG AUUUGGUU.

[0050] The sequence of siVCPIP1#2 is shown in SEQ ID NO. 2: GAGGUGACAGAAGUUU GCAAGAUAA.

[0051] The sequence of the negative control siRNA (siControl) is shown in SEQ ID NO. 3: UUCUCCGAACGUGUCACGU.

[0052] The sequence of siYAP#1 is shown in SEQ ID NO. 4: GUCUCAGGAAUUGAGAACA.

[0053] The sequence of siYAP#2 is shown in SEQ ID NO. 5: GUCAGAGAUACUUCUUAAA.

[0054] 6. Luciferase reporter gene assay.

[0055] Using a luciferase reporter plasmid containing a TEAD-responsive element, cells transfected with siVCPIP1 or siControl, a reporter plasmid, and a Renilla luciferase plasmid were cultured for 24 hours, then harvested and luciferase activity was measured using a dual-luciferase reporter gene assay system.

[0056] 7.RNA extraction and real-time fluorescence quantitative PCR.

[0057] Total RNA was extracted using RNA extraction reagent. RNA was then reverse transcribed into cDNA. Then, the designated primers and SYBR GREEN were used to Amplification was performed on 480. 36B4 was used as an internal reference gene. The primer sequences used are as follows:

[0058] 36B4:

[0059] The sequence of the forward primer is shown in SEQ ID NO.6: AGACCTTCTTCCAGGCTTTG.

[0060] The sequence of the reverse primer is shown in SEQ ID NO.7: GCTCCCACCTTGTCTCCAGTC.

[0061] VCPIP1:

[0062] The sequence of the forward primer is shown in SEQ ID NO.8: GCGCCTTCCTCATAGAACCA.

[0063] The sequence of the reverse primer is shown in SEQ ID NO.9: ATTGGCCCGCTTAATGTCCT.

[0064] CYR61:

[0065] The sequence of the forward primer is shown in SEQ ID NO. 10: GGTCAAAGTTACCGGGCA GT.

[0066] The sequence of the reverse primer is shown in SEQ ID NO. 11: GGAGGCATCGAATCCCAGC.

[0067] CTGF:

[0068] The sequence of the forward primer is shown in SEQ ID NO. 12: CAGCATGGACGTTCGTCTG.

[0069] The sequence of the reverse primer is shown in SEQ ID NO. 13: AACCACGGTTTGGTCCTT GG.

[0070] 8. Protein immunoblotting.

[0071] Western blotting reagents were as follows: RIPA lysis buffer (SW104-01, purchased from Thermo Fisher Scientific); protease inhibitor cocktail (P1045, purchased from Beyotime); enhanced chemiluminescence (ECL) reagent (MA0186, purchased from Meilun Biotechnology); and PVDF membrane (IPVH00010, purchased from Merck Millipore). Antibodies used were as follows: anti-VCPIP1 antibody (88153S, purchased from Santa Cruz Biotechnology); sc-515291, anti-Flag antibody (20543-1-AP, purchased from Proteintech); anti-β-actin antibody (4967S, purchased from Cell Signaling Technology); anti-Myc antibody (16286-1-AP, purchased from Proteintech); anti-YAP antibody (14074S, purchased from Cell Signaling Technology); and anti-HA antibody (90513, purchased from Biolegend). The secondary antibodies used were goat anti-rabbit IgG, purchased from Beyotime, A0208, or goat anti-mouse IgG, purchased from Beyotime, A0216.

[0072] Protein samples were extracted using RIPA lysis buffer containing a protease inhibitor cocktail, followed by electrophoresis and transfer to a PVDF membrane. The membrane was then blocked with 5% skim milk and incubated sequentially with primary and secondary antibodies. Luminescence signals were detected using an enhanced chemiluminescence system.

[0073] 9.CCK8 cell proliferation assay.

[0074] After the designated transfection or treatment, cells were seeded in 96-well plates at a density of 2000 cells per well. After the cells adhered, 10 μL of CCK8 reagent was added to each well at designated time points for 5 consecutive days. The cells were incubated at 37°C and 5% CO2 for 2 hours, and the absorbance (OD 450 The first time point was set as 0 h, and the cell proliferation rate at each time point was calculated.

[0075] 10. Half maximal inhibitory concentration (IC 50 ) determination and calculation of synergistic effect scores.

[0076] 10.1.IC determination.

[0077] AsPC-1 or PANC-1 cells were pretreated with 4 μM CAS-12290-201 for 48 h and then treated with the indicated concentrations of gemcitabine. After 24 h of gemcitabine treatment, cell viability was assessed using CCK8 assay.

[0078] 10.2. Calculation of Synergy Score.

[0079] Cells pretreated with CAS-12290-201 were then treated with the indicated concentrations of gemcitabine, and cell viability was measured using the CCK8 assay. The experiment was repeated three times, and the average cell viability at each concentration gradient was uploaded to the SynergyFinder website (synergyfinder.org) to calculate the synergy score.

[0080] 11. Transwell experiment.

[0081] After the indicated transfection or treatment, cells were collected and resuspended in serum-free medium. Cells were diluted to 5 × 10 5 / mL, 100 μL of cells were plated into each well of a Transwell insert. 500 μL of culture medium containing 20% fetal bovine serum (FBS) was added to the lower chamber. For invasion assays, 100 μL of Matrigel was added to each chamber before seeding the cells. After incubation for 12 hours, the cells were fixed with 4% paraformaldehyde and stained with crystal violet.

[0082] 12. Scratch healing experiment.

[0083] After the indicated transfection or treatment, cells were plated at 5 × 10 5 Cells were seeded at a density of 100 cells / well in a 6-well plate. Once confluent, the cell monolayer was scratched using a sterile pipette tip. Immediately after the scratch and 24 hours after the scratch, images of the gap between the two edges of the scratch were captured using an EVOS microscope. The images were then processed using ImageJ software to calculate the migration gap area. Migration gap area = (0 hour gap area - 24 hour gap area) / 0 hour gap area.

[0084] 13. Cell apoptosis analysis.

[0085] After the indicated transfections or treatments, cells were harvested and incubated with apoptosis detection reagent for 15 minutes in the dark, followed by flow cytometry analysis. Caspase-3 / 7 activity was measured using a Caspase-3 Detection Kit. After the indicated treatments, cells were incubated with caspase-3 / 7 substrate for 1 hour, and images were captured using an EVOS microscope.

[0086] 14. Immunofluorescence experiment.

[0087] Cells were fixed with 4% paraformaldehyde and permeabilized with 0.2% Triton X-100. Cells were then blocked with 5% bovine serum albumin for 1 hour. Subsequently, cells were incubated with anti-VCPIP1 and anti-YAP antibodies at 4°C overnight. Subsequently, cells were incubated with secondary antibodies and stained with DAPI.

[0088] 15. Co-immunoprecipitation experiment.

[0089] The cells were lysed with lysis buffer, and the supernatant was collected after centrifugation. The supernatant was divided into an immunoprecipitation (IP) group and an IgG control group, and incubated with the designated antibodies or IgG and protein A / G at 4°C overnight. The next day, the protein A / G magnetic beads were collected by centrifugation and washed five times with lysis buffer. 2× SDS-PAGE loading buffer was then added, and the mixture was denatured at 99°C for 10 minutes before immunoblotting analysis.

[0090] 16. Ubiquitination assay.

[0091] Cells were treated with 20 μM MG132 for 6 hours. The cells were then harvested and pre-washed with protein A / G agarose for 2 hours to prevent nonspecific binding. The extracts were then incubated with anti-YAP or anti-Myc antibodies overnight at 4°C. Finally, the precipitates were washed and denatured as described above, and YAP ubiquitination was assessed by immunoblotting with anti-HA antibodies.

[0092] 17. Mass spectrometry analysis.

[0093] SDS-PAGE gels were stained with Coomassie Brilliant Blue, and protein bands close to the target bands were excised. The proteins in the gel were then digested overnight at 37°C with 2 μg of trypsin in 50 mM ammonium bicarbonate. After digestion, peptides were extracted from the gel using a solution containing 50% acetonitrile and 0.1% formic acid. The peptides were dried using a vacuum centrifugal concentrator and resuspended in 0.1% formic acid for liquid chromatography-tandem mass spectrometry (LC-MS / MS) analysis using an EASY nLC-1200 system.

[0094] 18.Molecular docking analysis.

[0095] Molecular simulations were performed using Amber 22. The force field parameters for the system were calculated using the ff19SB force field. The TIP3P water model was used for solvation, and counterions were added to maintain electroneutrality. Molecular docking simulation results were visualized using PyMOL software.

[0096] 19. Chromatin immunoprecipitation experiment.

[0097] Experiments were performed according to the instructions of the chromatin immunoprecipitation (ChIP) kit. The antibody used in the ChIP experiment was anti-YAP. Enriched DNA was purified using a DNA extraction kit. The primer sequences for VCPIP1 in ChIP-qPCR are as follows: the forward primer sequence is shown in SEQ ID NO. 14: ATAGCTCCTGGCTCTCGTGT; the reverse primer sequence is shown in SEQ ID NO. 15: AAAGGAAAGTGCTTCGCCCT.

[0098] 20. Immunohistochemistry (IHC) experiments.

[0099] Tissues were fixed with 4% paraformaldehyde and then embedded in paraffin. Tissues were then sectioned using an S700 paraffin microtome and stained using an immunohistochemistry kit. Primary antibodies were incubated overnight at 4°C, followed by secondary antibodies at room temperature for 2 hours. Immune complexes were visualized using DAB developer, and cell nuclei were counterstained with hematoxylin. Images were acquired using a digital pathology scanner. The following antibodies were used in the IHC experiments: anti-YAP, anti-VCPIP1, and anti-Ki-67.

[0100] 21.Clinical samples.

[0101] Paraffin-embedded tissue blocks were obtained from the Department of Pathology at Shengjing Hospital, China Medical University. A total of 52 normal pancreatic tissues and 57 pancreatic cancer tissues were collected for testing for VCPIP1 and YAP expression. Clinical data from 57 pancreatic cancer patients were subsequently retrieved for clinical correlation analysis. Patients' personal information was properly stored, without causing any additional trouble for the patients.

[0102] 22. Analysis of public clinical data.

[0103] Gene expression data from the Gene Expression Interactive Analysis (GETx) database and The Cancer Genome Atlas Pancreatic Adenocarcinoma (TCGA-PAAD) database were accessed through the University of California, Santa Cruz Xena browser (xena.ucsc.edu). VCPIP1 expression levels were determined and visualized using GraphPad Prism 9 software. Kaplan-Meier survival analysis was performed based on the TCGA-PAAD data using the GEPIA database.

[0104] 23. Transcriptome sequencing and data analysis.

[0105] Three biological replicates of AsPC-1 cells transfected with negative control siRNA (siControl) or siRNA targeting VCPIP1 (siVCPIP1) were collected, and RNA was extracted. Samples were sent to BGI-Shenzhen, China, for RNA sequencing analysis. Differentially expressed genes were identified using DESeq2 software, and significant differences were defined as log2 fold change (log2FC) > 1 and p < 0.05. Volcano and dot plots were created using the online platform SRplot. The data are available in the Gene Expression Omnibus (GEO) database, with serial number GSE284347.

[0106] 24.Data statistical analysis.

[0107] SPSS 25.0 software was used for data analysis. All data were expressed as mean ± standard deviation of at least three biological replicates, and the animal experiments were repeated at least six times. The Student's t test was used to evaluate the differences between the two groups. Two-way ANOVA was used to evaluate the differences between the two groups at different time intervals. The variable Hill slope model of nonlinear regression was used to estimate the half-maximal inhibitory concentration (IC 50 ). p < 0.05 was considered statistically significant.

[0108] 2. Experimental results.

[0109] 1. VCPIP1 is a key regulator of the Hippo pathway in pancreatic adenocarcinoma.

[0110] To identify key deubiquitinating enzymes (DUBs) involved in the Hippo pathway in pancreatic adenocarcinoma (PAAD), we performed bioinformatics screening using the TCGA database. Gene signature enrichment analysis (GSEA) of the Hippo signaling pathway was performed, and the expression levels of individual DUBs in PAAD samples were measured. The correlation scores of PAAD samples were ranked by normalized enrichment score (NES). Further screening identified candidate DUBs significantly associated with Hippo signaling activity in PAAD (NES > 1.5; P < 0.05). Expression of these candidate DUBs was knocked down in PAAD cells using siRNA, and CTGF expression was used as a marker of Hippo signaling activity. The results revealed that VCPIP1 may be a key regulator of Hippo signaling in PAAD. GSEA analysis revealed that VCPIP1 expression was positively correlated with Hippo / YAP function, suggesting that it may promote YAP function in PAAD. GETx and TCGA database analyses revealed that VCPIP1 expression levels were significantly higher in PAAD tissues than in normal pancreatic tissue. Survival analysis showed that high VCPIP1 expression in the TCGA database was significantly associated with shortened overall survival in patients. Furthermore, a heat map of VCPIP1 grouping based on PAAD samples showed a significant positive correlation between VCPIP1 and YAP target gene expression.

[0111] RNA sequencing analysis was performed by knocking down VCPIP1 in PAAD cells. Heat map analysis showed that the expression of some YAP target genes was downregulated after VCPIP1 knockdown. The volcano plot showed that the classic YAP target genes CTGF and CYR61 were significantly downregulated. GSEA analysis showed that the expression of YAP characteristic genes was generally reduced under the condition of VCPIP1 deficiency. Gene enrichment analysis showed that VCPIP1 deficiency affected the Hippo signaling pathway. Tissue sample immunohistochemistry verification found that the expression level of VCPIP1 in PAAD tissue was significantly higher than that in normal pancreatic tissue, such as Figure 1 As shown in A and B in Figure 3, VCPIP1 expression was positively correlated with YAP expression, P = 0.003; Figure 1 As shown in D and E. Survival analysis of 57 PAAD patients confirmed that high VCPIP1 expression was associated with poor prognosis, as shown in Figure 1 As shown in Figure C. Analysis of the correlation between VCPIP1 expression and clinical characteristics of PAAD showed that VCPIP1 expression was positively correlated with clinical stage and lymph node metastasis, as shown in Table 1.

[0112] Table 1 Correlation between VCPIP1 expression and clinicopathological parameters in pancreatic cancer

[0113]

[0114] Note: Statistically significant results (P<0.05) are shown in bold; **P<0.01; “ / ” indicates no such result.

[0115] 2. VCPIP1 is required for the progression of PAAD.

[0116] AsPC-1 and PANC-1 cells were used to investigate the effect of VCPIP1 on the progression of PAAD. First, the knockdown efficiency of VCPIP1 was tested in AsPC-1 and PANC-1 cells. Figure 2 As shown in A and B in Figure 2, qRT-PCR results showed that VCPIP1 silencing significantly inhibited the expression of classic YAP target genes CTGF and CYR61 in both cells. Figure 2 As shown in Figures C and D. Luciferase reporter gene experiments targeting TEAD response elements showed that VCPIP1 deficiency significantly inhibited YAP activity in AsPC-1 and PANC-1 cells, as shown in Figures Figure 2 As shown in Figures E and F. Western blot results showed that knockdown of VCPIP1 led to a decrease in YAP protein levels in both cells, as shown in Figures Figure 2 As shown in G. CCK8 experiments showed that VCPIP1 deficiency significantly inhibited the growth of PAAD cells, as shown in Figure 2 As shown in H and I in Figure 3. EdU and other experiments showed that the number of proliferating cells was significantly reduced after VCPIP1 knockdown, and the migration and invasion abilities of cells were weakened. Apoptosis detection results showed that knockdown of VCPIP1 increased the apoptotic rate of cells. The in vivo function of VCPIP1 was evaluated by a nude mouse xenograft model, and the results showed that tumor growth was significantly inhibited after VCPIP1 knockdown, as shown in Figure 3. Figure 3 As shown in A to C in Figure 2. Ki67 staining of transplanted tumor tissues showed that the proportion of Ki67-positive cells decreased after VCPIP1 deletion, as shown in Figure 2. Figure 3 As shown in D and E.

[0117] 3. The hydrolysis activity of VCPIP1 is not essential for its ability to regulate YAP function.

[0118] Because VCPIP1 belongs to the deubiquitinase family, it has been hypothesized that it may regulate YAP function through its deubiquitinase activity. Previous studies have shown that cysteine 219 (C219) is the catalytic residue of VCPIP1. To elucidate its molecular mechanism, a catalytically inactive VCPIP1 mutant (C219A) was constructed and its function was validated in PAAD cells. The results showed that overexpression of wild-type VCPIP1 significantly upregulated the expression of the canonical YAP target genes CTGF and CYR61 in AsPC-1 and PANC-1 cells, while the C219A mutant had no such effect. A TEAD-responsive element luciferase reporter assay demonstrated that overexpression of wild-type VCPIP1 enhanced YAP activity, while the mutant had no such effect.

[0119] Western blot results showed that overexpression of wild-type VCPIP1 increased YAP protein levels, while the mutant had no such effect. Phenotypic experiments showed that overexpression of wild-type VCPIP1 promoted the malignant phenotype of PAAD cells, while the mutant had no promoting effect. Figure 4 and Figure 5 shown.

[0120] 4. YAP rescued the inhibitory effect of VCPIP1 knockdown on PAAD.

[0121] To verify whether the inhibitory effect of VCPIP1 knockdown depends on its regulation of YAP protein, rescue experiments were performed. After knocking down VCPIP1 in PANC-1 cells, YAP was further overexpressed. Western blot analysis showed that YAP overexpression could restore the YAP protein level under VCPIP1 deficiency conditions, such as Figure 6 As shown in Figure A. qRT-PCR results showed that VCPIP1 knockdown inhibited the expression of YAP target genes, while YAP overexpression reversed this effect, as shown in Figure 3. Figure 6 As shown in Figure B. Luciferase reporter gene experiments showed that VCPIP1 deficiency reduced YAP activity, while overexpression of YAP restored YAP activity, as shown in Figure 3. Figure 6 As shown in Figure C. Phenotypic experiments showed that the malignant phenotype of PAAD cells suppressed by VCPIP1 knockdown could be rescued by YAP overexpression, as shown in Figure 3 Figure 6 As shown in Figure D. The in vivo effects were evaluated using a nude mouse xenograft model, and the results showed that YAP overexpression could effectively rescue the inhibitory effect of VCPIP1 deficiency on tumor growth, as shown in Figure 4. Figure 6 As shown in E. Ki67 staining showed that the proliferation activity inhibited by VCPIP1 deficiency could be restored by YAP overexpression, as shown in Figure 6 As shown in F and G.

[0122] 5. VCPIP1 interacts with YAP and regulates YAP protein stability.

[0123] After overexpression of Flag-tagged VCPIP1 in PANC-1 cells, YAP was found to be one of the top interacting proteins by immunoprecipitation with anti-Flag antibody combined with mass spectrometry analysis. Figure 7 As shown in A and B in Figure 1. Immunofluorescence staining showed that YAP protein was distributed in both the cytoplasm and the nucleus, while VCPIP1 was mainly localized in the cytoplasm. Immunoprecipitation experiments confirmed that VCPIP1 and YAP had endogenous interactions in PAAD cells. Truncated versions of VCPIP1 and YAP were constructed to analyze the interaction between their domains. The results showed that the OTU domain of VCPIP1 and the WW domain of YAP were key regions mediating the interaction, as shown in Figure 1. Figure 7 This result is consistent with the molecular docking analysis, and the predicted model shows that the OTU domain of VCPIP1 directly binds to the WW domain of YAP. After treatment with the proteasome inhibitor MG132, it was found that the decrease in YAP protein level caused by VCPIP1 deficiency could be significantly reversed, as shown in Figure 3. Figure 8 As shown in A and B. Cycloheximide chase experiments showed that VCPIP1 knockdown significantly reduced the stability of YAP protein in AsPC-1 and PANC-1 cells, as shown in Figure 8 As shown in Figures C to F. Further functional comparison of the wild type and the catalytically inactive mutant (C219A) revealed that overexpression of wild-type VCPIP1 stabilized YAP protein, while the mutant had no such effect.

[0124] 6. VCPIP1 stabilizes YAP protein by reducing YAP's K48-linked polyubiquitination.

[0125] Since VCPIP1 is a deubiquitinating enzyme containing an OTU domain, we examined whether it affects the ubiquitination modification of YAP protein. Immunoprecipitation experiments showed that VCPIP1 knockdown significantly increased the total ubiquitination level and K48-linked polyubiquitination of YAP protein, but had no significant effect on K63-linked ubiquitination. Figure 9 As shown in Figure A. Validation by dominant negative ubiquitin mutants K48R and K63R revealed that VCPIP1 deficiency mainly reduced YAP ubiquitination mediated by the K48R mutant, while the effect of the K63R mutant was negligible, as shown in Figure 4. Figure 9 As shown in Figure B. Further ubiquitination experiments showed that VCPIP1's regulation of YAP polyubiquitination depends on its catalytic activity, and the catalytically inactive mutant (C219A) cannot affect the YAP ubiquitination level, as shown in Figure 3. Figure 9 As shown in C to D. After constructing mutants targeting 14 potential lysine ubiquitination sites of YAP protein, it was found that VCPIP1 mainly inhibited the polyubiquitination of YAP at K252, K280 and K315 sites, as shown in Figure 9 As shown in E.

[0126] 7.YAP transcriptionally regulates VCPIP1 expression in PAAD.

[0127] Based on the important role of YAP in the progression of PAAD, the ChIP sequence data of the Gene Expression Omnibus (GEO) database were analyzed and it was found that YAP and TEADs had a significant binding peak in the VCPIP1 promoter region, such as Figure 10 As shown in A and B. Chromatin immunoprecipitation experiments verified the direct binding of YAP to the VCPIP1 promoter region, as shown in Figure 10 As shown in Figure C. After siRNA knockdown of YAP in PAAD cells, ChIP experiments showed that the binding of YAP to the VCPIP1 promoter region was significantly reduced, as shown in Figure 4. Figure 10 As shown in Figures D to E. At the same time, YAP deficiency leads to downregulation of VCPIP1 mRNA and protein levels in PAAD cells, as shown in Figures Figure 10 As shown in Figure F. After AsPC-1 and PANC-1 cells were treated with the YAP inhibitor verteporfin (VP), the mRNA and protein expressions of VCPIP1 were significantly reduced, as shown in Figure 4. Figure 10 In contrast, activation of YAP by XMU-MP-1 upregulated the expression of VCPIP1, as shown in G. Figure 10 As shown in H.

[0128] 8. VCPIP1 inhibitor CAS-12290-201 inhibits PAAD progression.

[0129] VCPIP1 inhibitor CAS-12290-201 is a fluoroquinazolinone compound with CAS number 12290-201 and structural formula The catalytic cysteine of VCPIP1 can be selectively targeted to inhibit its deubiquitinase activity. To evaluate the potential of VCPIP1 as a therapeutic target for PAAD, PAAD cells were treated with CAS. Western blot showed that CAS treatment significantly reduced YAP protein levels, as shown in Figure 2. Figure 11 As shown in Figure A. q-PCR results showed that CAS inhibited the expression of YAP target genes CTGF and CYR61, as shown in Figure 4. Figure 11 As shown in Figure B. Luciferase reporter gene experiments showed that CAS treatment reduced YAP activity in PAAD cells. Figure 11 As shown in C. Functional experiments showed that Cas significantly inhibited the malignant phenotype of PAAD cells, as shown in Figure 11 As shown in D. Mechanistic studies have shown that CAS acts by promoting the proteasomal degradation of YAP protein: MG132 treatment can reverse the decrease in YAP protein levels caused by CAS, as shown in Figure 11As shown in E, CHX tracking experiments showed that CAS accelerated YAP protein degradation, as shown in Figure 11 As shown in Figures F to G, ubiquitination experiments confirmed that CAS increased the K48-linked polyubiquitination of YAP.

[0130] 9. VCPIP1 inhibitor CAS-12290-201 enhances the sensitivity of PAAD cells to gemcitabine.

[0131] The chemotherapy drug gemcitabine (GEM) is widely used in the treatment of PAAD, but patients generally have drug resistance. Recent studies have shown that YAP is closely related to drug resistance. Given that VCPIP1 plays a key role in YAP stabilization, further investigation was conducted to explore whether the VCPIP1 inhibitor CAS can enhance the sensitivity of PAAD cells to GEM. CCK8 experiments showed that compared with the use of GEM alone, the combination of CAS and GEM significantly improved the cell killing effect, such as Figure 12 As shown in A to D in Figure 3. Synergistic effect analysis showed that the combination of CAS and GEM can enhance the proliferation inhibition of PAAD cells and increase the apoptosis rate of cells, as shown in Figure 3. Figure 12 As shown in E. The combined effect was evaluated in a nude mouse xenograft model, and the results showed that the GEM+CAS group significantly inhibited tumor growth compared with the GEM monotherapy group. Figure 12 As shown in Figures F to G. The Ki67 staining results of transplanted tumor tissue further confirmed this conclusion, as shown in Figures Figure 12 As shown in H and I.

[0132] In summary, the present invention reveals a positive feedback loop between VCPIP1 and the Hippo signaling pathway in pancreatic cancer. It is the first to discover that VCPIP1 activation can deubiquitinate and stabilize YAP, thereby enhancing YAP transcriptomic activity and tumorigenesis. Furthermore, YAP can directly bind to the promoter region of VCPIP1, promoting its transcription. The present invention's studies have shown that inhibiting VCPIP1 can suppress the progression of PAAD both in vitro and in vivo, suggesting that targeting VCPIP1 may provide a way to overcome the progression of PAAD.

[0133] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0134] The above-described embodiments merely represent several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the patent. A person skilled in the art would be able to make various modifications and improvements without departing from the spirit of the present invention, and these modifications and improvements fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be based on the appended claims.

Claims

1. Application of VCPIP1 inhibitors in the preparation of drugs for the treatment of pancreatic cancer.

2. The use according to claim 1, characterized in that The VCPIP1 inhibitor includes a fluoroquinazolinone compound or a siRNA targeting the VCPIP1 gene.

3. The use according to claim 2, characterized in that The fluoroquinazolinone compound is 4. The use according to claim 2, characterized in that The sequence of the siRNA targeting the VCPIP1 gene is shown as SEQ ID NO.1 or SEQ ID NO.

2.

5. The use according to claim 1, characterized in that The drug contains a VCPIP1 inhibitor as the only active ingredient.

6. The use according to claim 5, characterized in that The drug further includes a pharmaceutically acceptable carrier.

7. The use according to claim 6, characterized in that The pharmaceutically acceptable carrier is one or more of a diluent, a disintegrant, a precipitation inhibitor, a glidant, a binder, a dispersant, a suspending agent, an isotonic agent, a thickener, an emulsifier, a preservative and a stabilizer.

8. A pharmaceutical composition, characterized in that The invention comprises the VCPIP1 inhibitor according to claim 1, a chemotherapeutic drug and a pharmaceutically acceptable carrier.

9. The pharmaceutical composition according to claim 8, characterized in that The chemotherapy drug is gemcitabine.

Images