Autophagy inhibitory polypeptide of targeted LIR region and application of autophagy inhibitory polypeptide
By developing an autophagy-inhibiting peptide targeting the LIR site of the LC3 protein, the problem of poor selectivity of existing autophagy inhibitors has been solved, enabling precise intervention in the autophagy process and improving safety, which has broad clinical application prospects.
Patent Information
- Application Number
- CN202511467524.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-14
- Publication Date
- 2026-03-03
AI Technical Summary
Existing autophagy inhibitors have poor selectivity, resulting in widespread effects on lysosomal function, severe off-target effects, and dose-limiting toxicity, which limits their effectiveness and safety in clinical applications.
Develop an autophagy-inhibiting peptide that specifically targets the LIR docking site of the LC3 protein. By competitively binding to the LIR site on the LC3 protein, it can block the formation of autophagic vesicles and achieve precise intervention in the autophagy process.
It achieves high specificity and precise targeting of the autophagy process, avoiding non-specific effects and widespread lysosomal dysfunction, with fewer potential toxic side effects, and has the potential to serve as a tool molecule for scientific research and for the treatment of cancer and neurodegenerative diseases.
Smart Images

Figure CN121591831A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of medicinal chemistry, molecular biology, and computational biology, specifically to autophagy-inhibiting peptides and their application in the treatment of autophagy-dependent pancreatic cancer. Background Technology
[0002] Autophagy is a highly conserved cellular process in which cells utilize lysosomes to degrade damaged organelles, misfolded proteins, and foreign pathogens. It plays a crucial role in maintaining cellular homeostasis and providing energy and metabolic processes. However, abnormal overactivation of autophagy is closely associated with the development and progression of cancer. Tumor cells upregulate autophagy to cope with internal deficiencies (such as hypoxia and nutrient deprivation) and external therapeutic stresses (such as chemotherapy and radiotherapy). This process not only recycles damaged intracellular components and provides tumor cells with energy and essential building blocks for anabolism, but also clears treatment-induced toxic protein aggregates and damaged organelles, inhibits tumor cell apoptosis, enhances tumor cell survival, and ultimately leads to treatment resistance and tumor recurrence. Therefore, precise regulation of autophagy is a vital therapeutic strategy.
[0003] Currently, several general autophagy inhibitors have been developed and applied in research and even clinical trials, such as chloroquine / hydroxychloroquine and bafilomycin A1. These compounds primarily block the final step of autophagy by inhibiting lysosomal acidification and function. However, these late-stage inhibitors suffer from broad mechanisms of action and poor selectivity. They not only inhibit autophagosome formation but also broadly affect lysosomal function, leading to severe off-target effects and dose-limiting toxicities, which greatly limits their effectiveness and safety in clinical application. Therefore, specifically targeting the autophagy pathway is a highly promising therapeutic strategy.
[0004] One of the core molecule executing the autophagy process is microtubule-associated protein 1A / 1B light chain 3 (LC3). During autophagy, the cytoplasmic LC3-I is lipid-modified to form the membrane-bound LC3-II, which is then localized on the autophagosome membrane. The LC3 protein specifically binds to numerous receptor proteins carrying LIR motifs (such as p62 / SQSTM1) through a region on its surface called the LIR docking site (LDS), thereby recruiting specific cargo to the autophagosome for degradation. Therefore, the LIR docking site of the LC3 protein is a crucial hub for protein-protein interactions during autophagy.
[0005] Based on the above, this study aims to develop a novel inhibitor that specifically targets the LIR docking site of the LC3 protein, competitively blocking the binding of LC3 to other autophagy receptor proteins. This inhibitor would suppress autophagosome formation in the early stages of autophagy, theoretically overcoming the shortcomings of existing autophagy inhibitors, such as poor selectivity and significant toxic side effects. This type of inhibitor holds promise as a highly selective tool molecule for autophagy research and could provide novel compounds for the development of treatments for diseases related to autophagy disorders, such as cancer and neurodegenerative diseases. Summary of the Invention
[0006] While this approach is theoretically feasible, there is currently a severe lack of competitive inhibitors on the market that can efficiently and specifically target the LIR sites of the LC3 protein. Traditional small molecule compounds struggle to efficiently mimic the broad interfaces of protein-protein interactions, while peptide drugs, due to their good affinity and specificity, are ideal for targeting such protein-protein interaction (PPI) interfaces.
[0007] To address the shortcomings of existing technologies and achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a polypeptide with autophagy inhibition function, wherein the autophagy-inhibiting polypeptide is a polypeptide that specifically binds to the LIR docking site of the LC3 protein, wherein the amino acid sequence of the polypeptide is any one of the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
[0008] In a further technical solution, the autophagy-inhibiting polypeptide can competitively bind to the LIR docking site on the LC3 protein.
[0009] In a further technical solution, the gene encoding an autophagy-inhibiting polypeptide targeting the LIR region has a nucleotide sequence of any one of the sequences shown in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.
[0010] A further technical solution also provides the application of autophagy-inhibiting peptides targeting the LIR region in inhibiting autophagy in tumor cells, wherein the tumor includes pancreatic cancer. Beneficial effects
[0011] Compared with the prior art, the present invention has the following significant advantages: With high specificity and precise targeting, the peptide provided by this invention directly targets the LIR docking site of the LC3 protein, a key hub in the autophagy process, and precisely intervenes in the autophagy process from upstream, avoiding the non-specific effects and widespread lysosomal dysfunction of existing late autophagy inhibitors (such as chloroquine), and having fewer potential toxic side effects.
[0012] The mechanism of action is clear: This polypeptide works through a competitive binding mechanism and can be directly used in scientific research as a valuable tool molecule to explore the molecular mechanism of autophagy and verify the interaction between LC3 and autophagy receptor proteins. It can also be used to screen new autophagy receptor proteins.
[0013] It has great therapeutic potential: It provides core candidate molecules for the development of new targeted drugs for major diseases such as cancer (overcoming drug resistance) and neurodegenerative diseases (protecting neurons), and has broad prospects for clinical application. Attached Figure Description
[0014] Figure 1 This represents the molecular docking and chemical synthesis of bioactive peptides targeting the LIR docking site of the LC3 protein. Among them, the LC3 protein with the number 2ZJD from the Protein Structure Database (PDB) and the peptide with the core sequence [W / F / Y]XX[L / I / V] from the StraPep data were molecularly docked using Autodock and visualized in 3D using PyMOL. Figures 2-5 This indicates the screening of autophagy-inhibiting peptides, among which, Figure 2 This indicates the LC3 expression level of pancreatic cancer cells PANC1 after treatment with a peptide (20 μM) for 16 h, as analyzed by Western blot. Figure 3 This indicates the LC3 expression level of pancreatic cancer cells after treatment with rapamycin (200 nM) for 2 h followed by treatment with a peptide (20 μM) for 16 h using Western blot analysis. Figure 4 This indicates the LC3 expression level of pancreatic cancer cells after treatment with hydroxychloroquine (20 μM) for 2 h followed by treatment with a peptide (20 μM) for 16 h using Western blot analysis. Figure 5 PANC1 cells were treated with peptides 3#, 4#, and 5# (20 μM) for 6 hours. After membrane rupture and fixation, they were co-incubated with anti-LC3 antibody, and LC3 protein expression was observed under a fluorescence microscope. Figures 6-10 This represents the interaction between the polypeptide and the LC3 protein, where, Figure 6PANC1 cells were first transfected with GFP-LC3, and then treated with Biotin-tagged peptides: Biotin-3#, Biotin-4#, and Biotin-5# (20 μM) for 6 h. After membrane perforation and fixation, the cells were stained with Fluor® 594-Streptavidin and observed under a fluorescence microscope to observe LC3 protein expression and co-localization of LC3 and peptides. Figure 7 This indicates that the co-located image has been processed by image j; Figure 8 The CETSA cell thermal displacement assay indirectly assesses the binding of drugs to proteins. PANC1 cells were treated with peptides 3#, 4#, and 5# (20 μM) for 16 h, with blank control groups set up. The culture medium was discarded, adherent cells were washed once with PBS, digested with trypsin, and the culture medium was stopped. The cell suspension was collected, centrifuged at 1000 rpm for 5 min, and the supernatant was removed. PMSF was added to freshly prepared PBS, and the cells were resuspended. Each group was divided into 5 tubes, each containing about 50 μL of cell suspension. Using a thermal cycler, the cells in each group were heated to the corresponding temperatures (37℃, 45℃, 53℃, 61℃, 69℃) for 3 min at each temperature. After heating, the samples were cooled to room temperature for 3 min, and then subjected to three freeze-thaw cycles in liquid nitrogen. After heating, the samples were collected at 13000 rpm, 4℃ for 10 min, and the supernatant was added. 5x loading buffer was added, and the samples were boiled at 95℃ for 10 min. Subsequently, Western blotting was used to observe the expression level of LC3 protein under different temperature gradients. Figure 9 HEK293 cells were first overexpressed with GFP-LC3, and then further overexpressed with peptide plasmids and empty vector plasmids tagged with mCherry: mCherry-3#, mCherry-4#, mCherry-5#, and mCherry-Vector. After lysis, protein samples were prepared, and immunoprecipitation was performed using anti-GFP affinity gel. Western blotting was used to detect whether the precipitated protein samples contained the expression of mCherry-3#, mCherry-4#, and mCherry-5# proteins. Figure 10The SPR (Surface Plasmon Resonance) experiment involves immobilizing the LC3 protein on the gold film surface of an SPR sensor chip, making it a solid-phase binding site. Different concentrations of analyte (78 nM, 156 nM, 312 nM, 625 nM, 1250 nM, 2500 nM, and 5000 nM) are sequentially injected into the chip surface, interacting with the immobilized LC3 protein ligand. The SPR instrument detects changes in reflected light intensity in real time (usually expressed as a response value) and records the change over time (time, the horizontal axis in the figure). By analyzing the binding curves of different analyte concentrations, the affinity constant of the intermolecular interaction can be calculated. Kd ; Figures 11-18 This indicates the effects of peptide drugs used alone or in combination with chemotherapy drugs on tumor cell growth and proliferation. Figure 11 This study describes the synthesis of peptide-coding sequences into plasmids using gene cloning and recombinant expression technology. PANC1 cells were then transfected with corresponding peptide plasmids containing mCherry and empty mCherry vectors: mCherry-3#, mCherry-4#, mCherry-5#, and mCherry-Vector. After 24-48 hours, the cells were trypsinized, centrifuged, and resuspended. Cells were seeded into 6-well plates, with 1000 cells per well. Control, peptide, gemcitabine, and gemcitabine-peptide combination groups were established. Gemcitabine (0.6 μM) was used for 48 hours. Afterward, the culture medium was discarded, and fresh culture medium was added until colony formation was visually observed. Once colonies formed, the culture medium was washed off, and each well was washed with 1 ml of PBS. Then, 1 ml of paraformaldehyde (4%) was added to each well for fixation for 15 minutes, followed by one wash with PBS. Each well was then stained with 1 ml of crystal violet (0.1%) for 10 minutes, followed by three washes with PBS. The wells were thoroughly cleaned, inverted, and air-dried before photographing. Figure 12 Indicates the same Figure 11 PANC1 cells were transfected with mCherry-3#, mCherry-4#, mCherry-5# and mCherry-Vector, respectively. A control group, a peptide group, a gemcitabine group and a gemcitabine peptide combination group were set up, with 3 replicates in each group. The changes in cell growth and proliferation were detected by CCK-8 method. Figure 13 Indicates the same Figure 11PANC1 cells were transfected with mCherry-peptide and mCherry-empty vector plasmid, respectively, and control, peptide group, gemcitabine group, and gemcitabine-peptide combination group were set up. Adherent cells were digested into single-cell suspension, washed twice with PBS, centrifuged at 1000 rpm for 3 min, the supernatant was discarded, and the cells were resuspended in DMEM complete medium. After counting the cells using a cell counter, the cell concentration was adjusted to 1.5 x 10⁻⁶ cells / cell. 5 / mL. Mix the thawed matrix gel and culture medium at a 1:1 ratio on ice to gently reconstitute the cell pellet. Take 20 μL of the reconstituted single-cell suspension and vertically drop it into the center of each well of a pre-cooled 96-well plate, forming an arched cell droplet. Stabilize the plate in a cell culture incubator at 37°C and 5% CO2 saturated humidity for 30 min. Then add 80 μL of complete culture medium to each well and continue culturing. Observe and record the results daily. Figure 14 PANC1-1 cells expressing mCherry-3#, mCherry-4#, mCherry-5#, and mCherry-Vector were subcutaneously seeded into BALB / c nude mice. Control group, peptide group, gemcitabine group, and gemcitabine-peptide combination group were set up. After tumor formation in 1 week, the combination group was injected intraperitoneally with gemcitabine (50 mg / kg), and the peptide treatment group was injected intraperitoneally with PBS, once a week for a total of three weeks. Figure 15 This means that after 12 days, the volume of the mouse tumor will be recorded every three days to observe the size of the mouse's growth curve; Figure 16 This indicates the statistical analysis of differences in tumor weight and volume among the groups of mice; Figure 17 This represents a transmission electron microscopy experiment to analyze the differences in the number of autophagosomes formed in each group of mice. Figure 18 This indicates changes in the levels of Ki67 and LC3 proteins in mice as shown by immunohistochemical analysis. Example 1
[0015] Acquisition of peptides.
[0016] The LC3 protein structure was obtained from the PDB database, numbered 2ZJD. First, protonation was performed under neutral conditions (pH=7) using the H++3 online server. Then, UCSF Chimera software was used to remove heteroatoms and water molecules from the crystal structure, retaining only the protein structure, and Amber14SB charges were assigned.
[0017] The peptide data were obtained from the StraPep database. The peptide structure was processed using Maestro Academic Edition, including Pka protonation partitioning, hydrogenation, and the addition of missing backbone atoms and side chain groups, as well as the repair of incorrect bond angle parameters.
[0018] Molecular docking was performed using the Autodock peptide docking module. 3D mapping analysis was performed using PyMOL 2.04, and 2D interaction analysis and statistical analysis of interaction types, distances, and numbers were performed using the academic version of Maestro. Based on binding energy scores and the complementarity of interaction modes, candidate peptides 1#-19# that are similar to or homologous to the core sequence [W / F / Y]XX[L / I / V] of the natural LIR motif were selected. Furthermore, based on the net charge of the peptides, nine positively charged peptides were selected.
[0019] Specifically, after molecular docking, PyMOL visualization shows that purple represents the LC3 protein, green areas represent LIRdocking sites (LDS) on LC3, and orange represents the simulated peptide: HPFHLLVY. Figure 1 By targeting the LIR docking site of the LC3 protein with peptides containing LIR regions (peptides with the core sequence [W / F / Y]XX[L / I / V] from StraPep data), a total of 794 bioactive peptides with interactions were screened. Their docking scores were ranked from highest to lowest, and the Top 50 were selected (Table 1). Furthermore, due to electrostatic interactions and endocytosis: the outer surface of the cell membrane is rich in negatively charged phospholipids and glycoproteins. Positively charged peptides are adsorbed onto the cell membrane surface through strong electrostatic attraction, triggering endocytosis, thus encapsulating the peptides in vesicles and allowing them to enter the cell. Based on the positive or negative charge of the peptides, the top 9 positively charged peptides were selected as preferred peptides: 1#, 3#, 4#, 5#, 6#, 7#, 12#, 13#, and 17# (Table 2).
[0020] Table 1 sorts the docking scores from highest to lowest.
[0021]
[0022] Table 2 shows the optimal peptides selected based on Docking Score and Net Charge.
[0023]
[0024] Example 2 Nine top candidate peptides were chemically synthesized and their binding was verified in vitro through functional screening and surface plasmon resonance (SPR) and immunofluorescence experiments. Three peptide sequences with autophagy inhibitory activity were identified: 3#: VCCGYKLCHPC (SEQ ID NO: 1), 4#: CYKTCT (SEQ ID NO: 2), and 5#: CYFQNCPRG (SEQ ID NO: 3).
[0025] Using gene cloning and recombinant expression technology, expression plasmids were constructed from the above-mentioned peptides according to the 3x peptide coding sequence to improve their expression level and stability in cells. The sequences encoding the peptide nucleotides are: 3#: GGATCCGTGTGCTGCGGCTACAAGCTGTGCCACCCCTGCGTGTGCTGCGGCTACAAGTTGTGCCATCCTTGCGTGTGCTGCGGGTACAAGCTGTGCCACCCTTGCTAACTCGAG (SEQ ID NO: 4), 4#: GGATCCTGCTACAAGACCTGCACCTGCTACAAGACCTGCACATGCTACAAGACCTGCACCTAACTCGAG (SEQ ID NO: 5), 5#: GGATCCTGCTACTTCCAGAACTGCCCCAGGGGCTGCTACTTCCAGAACTGTCCCAGGGGCTGCTACTACTTTCAGAACTGCCCTAGGGGCTAACTCGAG (SEQ ID NO: 6).
[0026] Specifically, Western blot analysis of pancreatic cancer cells PANC1 treated with peptides 1#, 3#, 4#, 5#, 6#, 7#, 12#, 13#, and 17# (20 μM) for 6 h revealed that LC3-II expression levels were significantly reduced after treatment with peptides 3#, 4#, and 5#. Figure 2 Rapamycin induces autophagy, leading to the formation of numerous autophagosomes. Sequential treatment with rapamycin and peptides revealed that LC3-II expression levels decreased in cells treated with peptides #3, #4, and #5. Figure 3 Using hydroxychloroquine to inhibit the fusion of autophagosomes and lysosomes, and treating cells sequentially with hydroxychloroquine and peptides, it was found that the expression level of LC3-II was also reduced in cells treated with hydroxychloroquine, 4, and 5. Figure 4 By comparing the effects of the drugs in combination with autophagy inhibitors and activators, further screening based on the mechanism revealed that peptides 3#, 4#, and 5# truly exerted the inhibitory effect on autophagy. Further verification through immunofluorescence experiments showed that the LC3 fluorescence intensity was significantly reduced after treatment with peptides 3#, 4#, and 5#. Figure 5 ). Example 3
[0027] First, dual immunofluorescence staining revealed protein GFP-LC3 (green, left), Avidin-647-stained biotin-tagged peptides: Biotin-3#, Biotin-4#, and Biotin-5# (red, middle), and a merged image (right). Colocalization signals (yellow) are clearly visible in the merged image, indicating overlap in the intracellular spatial distribution of the two proteins. Figure 6 Image J analysis showed a correlation between the trends in red and green fluorescence intensity, indicating co-localization. Figure 7 In the CETASA experiment, PANC-1 cells treated with peptides #3, #4, and #5 followed by temperature gradient heating showed a significant change in the thermostability of protein LC3 compared to the control group, with its expression level becoming more stable. Figure 8 Immunoprecipitation experiments showed that GFP-LC3 interacted with mCherry-3#, mCherry-4#, and mCherry-5#, respectively. Furthermore, in the Input group, peptide treatment reduced GFP-LC3 protein expression. Meanwhile, in the control group, no interaction was observed between GFP-LC3 and mCherry-Vector. Figure 9 Finally, the SPR experiment results showed that peptides #3, #4, and #5 all increased the response value (vertical axis, reflecting molecular binding) at different concentrations (78 nM, 156 nM, 312 nM, 625 nM, 1250 nM, 2500 nM, and 5000 nM), indicating that the peptides can bind to LC3 immobilized on the chip, i.e., there is an interaction between the two. Furthermore, within a certain concentration range, the higher the peptide concentration, the greater the amount of LC3 bound, and the interaction between the two exhibits a concentration-dependent relationship. Figure 10 ). Example 4
[0028] Peptides modified using gene cloning and recombinant expression technology, when combined with the chemotherapy drug gemcitabine, exhibit synergistic anti-tumor effects. Firstly, clonogenic assays revealed that without gemcitabine, the number of clones in peptide treatment groups 3#, 4#, and 5# was reduced compared to the blank control group, indicating that these treatments themselves inhibited cell clonogenicity. After the addition of gemcitabine, the number of clones in peptide treatment groups 3#, 4#, and 5# was further reduced compared to the gemcitabine-only group, demonstrating a synergistic inhibitory effect on clonogenicity with gemcitabine. Figure 11According to the CCK-8 experimental statistical chart, treatment with peptides #3, #4, and #5 can inhibit cell proliferation on their own, and they also have a synergistic inhibitory effect with gemcitabine (whether 0.3 μM or 1.8 μM). The inhibitory effect of 1.8 μM gemcitabine is more significant than that of 0.3 μM. At the same time, the synergistic effect of #3, #4, and #5 with high concentrations of gemcitabine is also more prominent. Figure 12 The 3D tumor spheroid experiment also showed that treatment with peptides #3, #4, and #5 could inhibit the formation or growth of tumor cell spheroids, and the inhibitory effect on the formation or growth of pancreatic cancer tumor cell spheroids was more significant when used in combination with gemcitabine. Figure 13 In summary, in in vitro experiments, peptides 3#, 4#, and 5# not only inhibited cell proliferation, colony formation, and the formation or growth of 3D tumor spheres on their own, but also synergistically enhanced these inhibitory effects with gemcitabine, demonstrating potential application value in the field of anti-tumor research and potentially improving the therapeutic efficacy of gemcitabine. In in vivo experiments, firstly, animal experiments revealed that compared to the control group and the gemcitabine monotherapy group, peptides 3#, 4#, and 5#, when combined with gemcitabine, exhibited a stronger inhibitory effect on tumor growth, with differences in inhibitory effects among different combination groups. Peptides 3#, 4#, and 5# themselves can inhibit tumor growth in vivo (manifested as reducing tumor volume and weight), and when used in combination with gemcitabine, they synergistically enhance the inhibitory effect on tumor growth. The synergistic effect of peptide 5# with gemcitabine may be more significant, indicating potential application value in anti-tumor treatment. Figure 14-16 Meanwhile, transmission electron microscopy experiments revealed that peptide treatment reduced autophagosome formation, and the effect of reducing autophagosome formation was even stronger when used in combination with gemcitabine chemotherapy. Figure 17 HE staining of mouse tumor tissues showed that the blue-stained tumor cells were enlarged, varied in size, had an increased nucleus-to-cytoplasmic ratio, increased mitotic figures, and visible nucleoli. Immunohistochemical results showed that the positive staining area of Ki67 and LC3 proteins was the largest and deepest in the control group. In the groups treated with peptides #3, #4, and #5, the positive staining area of Ki67 and LC3 proteins was significantly reduced compared to the control group. After gemcitabine treatment alone, Ki67 staining became lighter and the area smaller, but LC3 protein levels increased, indicating that the chemotherapy drugs inhibited cell growth and promoted autophagy. In the groups treated with both gemcitabine and peptides, the expression level of Ki67 was lower than that of the group treated with gemcitabine alone, and the expression level of LC3 protein was also relatively reduced. This further proves that peptides #3, #4, and #5 can inhibit tumor growth in vivo, and when used in combination with gemcitabine, they can synergistically enhance the inhibitory effect on tumor growth. Figure 18 ).
Claims
1. An autophagy-inhibiting polypeptide targeting the LIR region, characterized in that, The amino acid sequence of the polypeptide is any one of the sequences shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:
3.
2. The autophagy-inhibiting polypeptide according to claim 1, characterized in that, The autophagy-inhibiting peptide competitively binds to the LIR docking site on the LC3 protein.
3. A gene encoding the autophagy-inhibiting polypeptide of claim 1, wherein the nucleotide sequence is any one of the sequences shown in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO:
6.
4. The application of the autophagy inhibition targeting the LIR region as described in claim 1 in inhibiting autophagy in tumor cells, wherein the tumor includes pancreatic cancer.