Gene cluster cloning method and application thereof

Abstract

The invention discloses a gene cluster cloning method and application thereof. The gene cluster cloning method comprises the following steps: performing restriction enzyme digestion on a target microbial genome to obtain a DNA fragment containing a target biosynthetic gene cluster; by utilizing a Gibson assembly method, connecting the upstream of the DNA fragment containing the target biosynthetic gene cluster with a p15Aorii-loxP-AmpR element containing pBE44 and a fragment aiming at a homologous arm of the upstream, and connecting the downstream of the DNA fragment containing the target biosynthetic gene cluster with a fragment containing a lacZ alpha-loxP-phage # imgabs0 # attP-traJ-ApmR element aiming at a homologous arm of the downstream and pBE45, so as to obtain a linear recombinant fragment formed by connecting three fragments; and electrically transferring the linear recombinant fragment into an escherichia coli host strain containing a Cre recombinase expression system, and cyclizing a large-fragment gene cluster in vivo by virtue of a Cre-loxP system, so as to obtain the annular recombinant plasmid. The method has the remarkable advantages of being easy and convenient to operate, high in cloning efficiency, high in universality and the like, and complex natural product gene clusters can be efficiently obtained.

Description

Technical Field

[0001] The present invention belongs to the field of synthetic biology and genetic engineering technology, and specifically relates to a method based on the REGAIN strategy ( R estriction e nzyme digestion, G ibson a ssembly and in vivo Cre-loxrecombinatio n The invention also provides a highly efficient and simple gene cluster cloning method for a bpm gene cluster, and its application in cloning the bipentaromycin biosynthetic gene cluster (bpm). The invention also includes methods for heterologous expression of the bpm gene cluster, determination of its boundaries, construction of mutant strains, and preparation of its metabolites. Background Art

[0002] Bipentaromycins are a unique class of dimeric aromatic polyketides containing two dicyclopenta[a,i]anthracene units. Previous studies have shown that C-3'-acyl-modified bipentaromycins exhibit broad antibacterial activity against both Gram-positive and Gram-negative bacteria, but the enzymes involved in catalyzing this acylation process have not been elucidated.

[0003] In addition, current cloning methods for complex natural product biosynthetic gene clusters have problems such as cumbersome operations, long cycles, and low recombination efficiency, which limit the discovery of active ingredients in natural products and the study of the functions of biosynthetic enzymes.

[0004] Therefore, there is an urgent need to develop new strategies for gene cluster cloning that are simple, efficient, and versatile to assist in the analysis of the biosynthesis mechanism of natural products and the discovery of new derivatives. Summary of the Invention

[0005] The present invention aims to at least to some extent solve the technical problems existing in existing natural product biosynthetic gene cluster cloning methods, such as cumbersome operation, long cycle, and low cloning efficiency. To this end, the present invention proposes a gene cluster cloning method that integrates three technologies: restriction enzyme digestion, Gibson assembly, and in vivo Cre-lox recombination, to achieve efficient cloning of large biosynthetic gene clusters (BGCs). It is particularly suitable for the directional cloning and operation of gene clusters of about 50kb. Compared with the existing technology, the present invention has significant advantages such as simple operation, high cloning efficiency, and strong versatility. The gene cluster cloning method of the present invention can also be referred to as a gene cluster cloning method based on the REGAIN strategy.

[0006] In a first aspect of the present invention, a method for cloning a gene cluster is provided, comprising the following steps:

[0007] S1, restriction enzyme digestion of the target microbial genome to obtain DNA fragments containing the target biosynthetic gene cluster;

[0008] S2, using the Gibson assembly method, the upstream of the DNA fragment containing the target biosynthetic gene cluster was connected to a fragment containing the p15A ori-loxP-AmpR element of pBE44 and a homology arm for the upstream, and the downstream was connected to a fragment containing a homology arm for the downstream and lacZα-loxP-phage The fragments of the attP-traJ-ApmR element were connected to obtain a linear recombinant fragment connected by three fragments;

[0009] S3, electroporating the linear recombinant fragment into an Escherichia coli host strain containing a Cre recombinase expression system, and relying on the Cre-loxP system to achieve circularization of the large gene cluster in vivo to obtain a circular recombinant plasmid.

[0010] In some embodiments, in S1, the target microorganism may refer to any bacteria, examples of which include but are not limited to Streptomyces, such as Streptomyces sp. NRRL F-6131, Streptomyces noursei ATCC 11455.

[0011] In some embodiments, in S1, the target microbial genome can be extracted by a phenol-chloroform method.

[0012] In some embodiments, S1 includes the following steps: first, determine the specific name of the cloned Streptomyces, then search for the genome of the Streptomyces by the name on NCBI, download the genome file in Fasta format or gbff format, and then upload the downloaded genome file to the antiSMASH online analysis platform for analysis, determine the restriction endonuclease site of the specific gene cluster to be cloned, and then select the restriction endonuclease and its digestion conditions based on the selected restriction endonuclease site. Generally speaking, the determined restriction endonuclease sites meet the following requirements: (1) the restriction endonuclease sites should be located at both ends of the gene cluster to ensure that the entire gene cluster can be cut out; and (2) the recognition sites should avoid being located in the key functional segments within the gene to avoid disrupting the gene function.

[0013] In some embodiments, in S1, the target biosynthetic gene cluster may refer to a biosynthetic gene cluster with a size of less than 50 kb, for example, bases 23017-64167 of the nucleotide sequence of NCBI Reference Sequence: GCF_000719695.1.

[0014] In some embodiments, in S2, the Gibson assembly method may refer to a molecular cloning technique that achieves seamless splicing in a single reaction system based on overlapping homologous sequences between DNA molecules. This method can be achieved by mixing DNA fragments with 39 bp overlapping sequences with a 2×CE enzyme mixture in a certain ratio, reacting at 50°C for 15–30 minutes, and ultimately obtaining a recombinant product.

[0015] In some embodiments, in S2, in the fragment containing the p15A ori-loxP-AmpR element of pBE44 and the homology arm directed upstream, the p15A ori-loxP-AmpR element of pBE44 has the sequence shown in SEQ ID NO: 1, and the homology arm directed upstream is connected to the 3' end of the sequence shown in SEQ ID NO: 1.

[0016]

[0017] In some embodiments, in S2, the homology arm containing the downstream and lacZα-loxP-phage attP-traJ-ApmR element fragment, the lacZα-loxP-phage of pBE45 The attP-traJ-ApmR element has the sequence shown in SEQ ID NO: 2, and a homology arm directed toward the downstream is linked to the 5' end of the sequence shown in SEQ ID NO: 2.

[0018]

[0019] In some embodiments, in S2, the fragment containing the p15A ori-loxP-AmpR element of pBE44 and the homology arm for the upstream, the fragment containing the homology arm for the downstream and the lacZα-loxP-phage of pBE45 The fragment of the attP-traJ-ApmR element can be obtained by PCR amplification.

[0020] In the present invention, the homology arms directed upstream and the homology arms directed downstream match the upstream and downstream regions of the genomic cluster, respectively.

[0021] In some embodiments, in S3, the Cre recombinase expression system refers to a gene expression construction system for mediating DNA recombination between specific DNA sites (such as loxP sequences), which generally includes a gene sequence encoding the Cre recombinase and a controllable promoter element, which can drive the expression of the Cre recombinase under specific induction conditions, thereby achieving DNA recombination containing gene cluster fragments and ultimately forming a circularized plasmid. The circularization process is generally mediated by the directional arrangement of two loxP sites (such as isotropic arrangement), and the Cre recombinase recognizes and catalyzes the excision and closure of the DNA fragment between the two loxP sites, thereby generating a plasmid molecule with a circular structure. The Escherichia coli host bacteria refers to E. coli pBE14 Cre, an engineered Escherichia coli strain used to carry and express exogenous gene constructs, which should have high conversion efficiency and stable replication ability for the target plasmid.

[0022] In some embodiments, in S3, the E. coli host bacteria containing the Cre recombinase expression system may include, for example, E. coli pBE14 Cre (Addgene).

[0023] In some embodiments, in S3, the recombinant bacteria obtained after electroporation are cultured at 37°C for 75 minutes, the supernatant is discarded after centrifugation, and the bacteria are spread on LB solid culture medium containing 50 μg / mL ampicillin (Apr), 40 μg / mL X-gal and 0.5 mM IPTG. After culturing for 16-20 hours, blue and white colonies can be observed. The white colonies are picked for culture and the plasmid is extracted. By designing primers, the PCR method is used to detect whether the connection interface between the pBE44 fragment and the target gene cluster in the recombinant vector is correct. For correct samples, enzyme digestion analysis is further performed, and appropriate restriction endonucleases are selected for digestion. The obtained band pattern is consistent with the enzyme digestion result simulated by SnapGene software, which is the correctly constructed circular recombinant plasmid.

[0024] In a second aspect, the present invention provides an application example of the method described in the first aspect of the present invention. By applying the method, the approximately 40 kb bipentaromycins biosynthetic gene cluster (bpm) from Streptomyces sp. NRRL F-6131 was successfully cloned, demonstrating the applicability and versatility of the method in cloning biosynthetic gene clusters of different natural products.

[0025] Therefore, the present invention provides a bipentaromycins biosynthetic gene cluster (bpm), which comprises bases 23017-64167 of the nucleotide sequence of NCBI Reference Sequence: GCF_000719695.1.

[0026] Furthermore, the present invention clarified the precise boundaries of the bpm gene cluster for the first time and identified a gene cluster containing 32 main genes.

[0027] Therefore, the present invention provides a bipentaromycins biosynthetic gene cluster (bpm) comprising the following elements:

[0028] Genes responsible for skeleton synthesis: bpmA, bpmB, bpmC;

[0029] Genes responsible for backbone aromatic ring cyclization and aromatization modification: bpmD, bpmE, bpmF, bpmQ;

[0030] Genes responsible for redox modification: bpmO1, bpmO2, bpmO3, bpmO4, bpmO5, bpmO6, bpmO7, bpmO8;

[0031] Gene responsible for methylation modification: bpmM;

[0032] Genes responsible for stereoselective hydrogenation: bpmG1, bpmG2;

[0033] Other functional genes: bpmR1, bpmR2, bpmR3, bpmT1, bpmT2, bpmT3, bpmH1, bpmH2, bpmH3, bpmV, bpmL, bpmP, bpmK1, bpmK2.

[0034] In a further embodiment, the bipentaromycins biosynthetic gene cluster (bpm) of the present invention comprises bases 30380-60894 of the nucleotide sequence of NCBI Reference Sequence: GCF_000719695.1.

[0035] In the fourth aspect of the present invention, therefore, the present invention provides a BpmP protein having an amino acid sequence as shown in SEQ ID NO:3.

[0036] SEQ ID NO: 3:

[0037] In addition, the present invention provides a nucleic acid molecule encoding the above-mentioned BpmP protein.

[0038] The present invention reveals the important role of bpmP, a key modification enzyme gene within the bpm gene cluster, in the biosynthesis of bipentaromycins. By constructing a bpmP gene knockout mutant strain, ΔbpmP, and detecting and analyzing the mutant's metabolites, it was found that the ΔbpmP mutant only produced bipentaromycin 1 and bipentaromycin 2 in its fermentation products, while the 3'-C acyl-modified compounds originally produced by the intact gene cluster disappeared. This result indicates that the BpmP protein encoded by the bpmP gene plays a key role in specifically mediating the regioselective acylation modification of the 3'-C hydroxyl group during the biosynthesis of bipentaromycins and is a key enzyme in achieving the structural diversification of bipentaromycins.

[0039] In a fifth aspect of the present invention, an engineered bacterium is provided, into which the above-mentioned gene cluster or the above-mentioned specific gene is introduced.

[0040]

[0041] In a sixth aspect of the present invention, a method for producing bipentaromycins is provided, comprising the step of culturing the engineered bacteria into which the specific gene cluster is introduced to obtain bipentaromycins.

[0042] The beneficial effects of the present invention are:

[0043] 1. The present invention provides an efficient and simple method for cloning large-fragment natural product biosynthetic gene clusters based on the REGAIN strategy, which has significant advantages such as simple operation, high cloning efficiency, and strong versatility. It overcomes the problems of cumbersome operation and long cycle in existing methods, realizes the efficient cloning of large-fragment biosynthetic gene clusters (BGCs), and is particularly suitable for the directional cloning and operation of gene clusters of about 50kb, with wide application value.

[0044] 2. The method of the present invention has been successfully applied to the approximately 40 kb bipentaromycin biosynthetic gene cluster from Streptomyces sp. NRRL F-6131, verifying the applicability and versatility of this method in cloning different types of natural product gene clusters.

[0045] 3. Through systematic gene knockout and heterologous expression product analysis, this study clarified for the first time the boundaries of the bipentaromycin biosynthetic gene cluster, identifying the 32 coding genes bounded by bpmG1 to bpmR3 as essential for product biosynthesis, providing an important foundation for subsequent gene function studies.

[0046] 4. By constructing a bpmP gene knockout mutant strain, ΔbpmP, and analyzing its fermentation products, this study confirmed for the first time the key role of the bpmP gene-encoded modification enzyme in the biosynthesis of bipentaromycins, specifically mediating the selective regio-acylation of the 3'-C hydroxyl group. This discovery clarifies the crucial catalytic role of the bpmP gene in the structural diversification of bipentaromycins and provides a new molecular target for structural modification by acylation.

[0047] In summary, the present invention has constructed a set of efficient, simple, and universal methods for cloning and functional analysis of large-fragment natural product biosynthetic gene clusters. This not only achieves the rapid cloning and heterologous expression of the target compound bipentaromycins biosynthetic gene cluster, but also clarifies the gene cluster boundaries and key functional genes, providing reliable technical support and application foundation for the regulation of natural product structural diversity, the discovery of new drug lead compounds, and the research of microbial synthetic biology. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 HPLC analysis (A) and MS spectra (B) of the eight compounds obtained from the engineered bacterium S. avermitilis SUKA17::bpm in Example 2.

[0049] Figure 2 HPLC profile of metabolites of mutant strains to clarify the boundaries of the bpm gene cluster.

[0050] Figure 3 This is the HPLC analysis chart of the ΔbpmP mutant.

[0051] Figure 4 This is the enzyme digestion verification image of the approximately 40 kb bpm gene cluster cloned using the REGAIN method.

[0052] Figure 5 Flowchart of the REGAIN method (A) and bpm gene cluster diagram (B). DETAILED DESCRIPTION

[0053] The present invention is described in detail below through specific implementation cases and drawings. It should be noted that these implementation cases are only used to explain the technical solution of the present invention and do not constitute a limitation on the scope of protection of the present invention. During implementation, unless otherwise specified, the experimental conditions adopted are conventional conditions in the field or standard operations recommended by the reagent manufacturer; the methods used are conventional technical methods well known in the field; the experimental materials and reagents involved, unless otherwise specified, can be purchased through commercial channels. The scientific and technological terms and professional technical terms used in this specification have the meanings commonly understood by those skilled in the art. It should be pointed out that any equivalent replacement or simple modification based on the technology of the present invention should be included in the scope of protection of the present invention.

[0054] Culture medium and antibiotic formulations:

[0055] MYG medium: 10 g malt extract, 4 g yeast extract, 4 g glucose, add water to 1 L, pH 7.2-7.4.

[0056] MYM medium: 10 g malt extract, 4 g yeast extract, 4 g maltose monohydrate, add water to 1 L, pH 7.2-7.4.

[0057] LB medium: 10 g tryptone, 10 g sodium chloride, 5 g yeast extract, add water to 1 L, pH 7.2-7.4.

[0058] ISP4 medium: 10 g soluble starch, 1 g potassium dihydrogen phosphate, 1.5 g sodium chloride, 2 g ammonium sulfate, 2 g calcium sulfate, 0.001 g ferrous sulfate, 0.001 g manganese chloride, 0.001 g zinc sulfate, add water to 1 L, pH 7.2-7.4.

[0059] 2×YT medium: 16 g tryptone, 10 g yeast extract powder, 5 g sodium chloride, add water to 1 L, pH 7.2-7.4.

[0060] Apramycin (Apr), Ampicillin (Amp): Purchase powder and prepare it yourself. Apr powder is purchased from Jizhi Reagent, and the trade name is Apramycin Sulfate. Amp powder is purchased from McLean, and the trade name is Ampicillin Sodium.

[0061] Apramycin (Apr) was prepared in ddH2O, 50 mg / ml, and added at 1 / 1000.

[0062] Ampicillin (Amp) was prepared in ddH2O, 100 mg / ml, and added at 1 / 1000.

[0063] Example 1: The bpm biosynthetic gene cluster from Streptomyces sp. NRRL F-6131 was cloned using the REGAIN method.

[0064] (1) Extraction of genomic DNA (gDNA) from Streptomyces sp. NRRL F-6131.

[0065] 50 mL of MYG medium was inoculated with 1‰ spores of Streptomyces sp. NRRL F-6131 (purchased from ARS Culture Collection) (named Streptomyces sp. SLDD H-2512 in our laboratory) and shaken at 28°C and 250 rpm until turbidity. The cells were collected by centrifugation at 4000 rpm for 15 min. Add 12 mL of gDNA resuspension buffer (20 mM Tris-HCl pH 8.0, 50 mM EDTA) to the bacteria, vortex until thoroughly mixed and free of lumps, then add 20-30 mg of lysozyme powder (McLean) and 0.5 mg of RNAse A (Biyuntian) to the resuspension in sequence, incubate at 37 ° C for 2 h, then add 5-10 mg of proteinase K (McLean) to the sample, incubate at 37 ° C for 2 h, then add 1.2 mL of 10% SDS (sodium dodecyl sulfate) solution, incubate at 50 ° C for 2 h, then add 4.8 mL of 5M NaCl and let it stand at room temperature for 30 min. Finally, gDNA was recovered using phenol-chloroform extraction and stored at 4 ° C.

[0066] (2) Amplification of pBE44 and pBE45 backbone DNA (receivers).

[0067] The pBE44 and pBE45 receivers were amplified using Phanta Max Super-Fidelity DNA Polymerase (Vazyme) using pBE44 (Plasmid #174654) and pBE45 (Plasmid #174655) plasmids (https: / / www.addgene.org / ) as templates, respectively. The reaction system and PCR amplification procedure were performed according to the product instructions. The amplification primer sequences are shown in Table 1.

[0068] Table 1

[0069]

[0070] (3) Enzymatic digestion of the bpm biosynthetic gene cluster

[0071] Prepare the enzyme digestion reaction system according to Table 2 and incubate at 37°C for 6 h. After completion, incubate the reaction mixture at 65°C for 20 min to inactivate the enzyme. Transfer the reaction mixture to a phase-lock gel tube and extract the digested fragment containing the bpm gene cluster using phenol-chloroform extraction.

[0072] Table 2

[0073]

[0074] (4) In vitro assembly and transformation of the bpm gene cluster with pBE44 and pBE45 receivers

[0075] Prepare the homologous recombination reaction system as listed in Table 3 and incubate at 50°C for 15–30 minutes. After the reaction, cool the product at 4°C or on ice. Transient electroporation was then performed using a Bio-Rad Gene Pulser XCell electroporator (1 mm cuvette, set to 1250 V, 100 Ω, and 25 μF). Subsequently, add 1 mL of LB liquid medium containing 5 mM MgCl2 to the electroporated cells and incubate at 37°C on a shaker for 75 minutes. Finally, the bacterial suspension was collected by centrifugation, resuspended, and evenly plated on LB solid medium containing 50 μg / mL apramycin (Apr), 0.2 mM IPTG, and 40 mg / L X-Gal for subsequent screening.

[0076] Table 3

[0077]

[0078] (5) Verification of positive clones

[0079] Pick multiple single clones from the plate and transfer them to 5 mL LB liquid medium (containing 50 μg / mL Apr) and shake at 37°C and 250 rpm for 16 hours. Then perform PCR on the bacterial solution to identify the junction points between the vector and the DNA fragment. Extract the plasmid pSHG1001 from the correct bacterial solution and select the restriction endonucleases BsrGI and ScaI for double enzyme digestion identification. The results are as follows: Figure 4 shown.

[0080] Example 2: Heterologous expression of the bpm gene cluster and determination of the main genes of the gene cluster.

[0081] (1) The recombinant plasmid pSHG1001 was transferred into WM6026 (Enghiad, B.; Huang, C.; Guo, F.; Jiang, G.; Wang, B.; Tabatabaei, SK; Martin, TA; Zhao, H. Cas12a-assisted precise targeted cloning using in vivo Cre-lox recombination. Nat. Commun. 2021, 12, 1171.) competent cells and used as the donor bacteria for conjugation transfer. The recipient bacteria was Streptomyces avermitilis SUKA17 (Enghiad, B.; Huang, C.; Guo, F.; Jiang, G.; Wang, B.; Tabatabaei, SK; Martin, TA; Zhao, H. Cas12a-assisted precise targeted cloning using in vivo Cre-loxrecombination. Nat. Commun. 2021, 12, 1171.), mix the recipient bacteria, donor bacteria and 100 μL 2MM MgCl2 (final concentration 10 mM) evenly, spread on the solid culture medium ISP4, blow dry and place in a 28°C constant temperature incubator for 18-20 hours, then directly cover the plate with sterile water with a final concentration of 50 μg / mL Apr and 25 mg / mL NA, and then place in a 28°C incubator for 3-5 days. Multiple single clones were picked for colony PCR identification, and successful conjugates were subcultured and spores were collected to obtain the engineered bacteria S.avermitilis SUKA17::bpm. The spores were then inoculated into 50 mL of MYM medium at 1‰ and cultured at 28°C and 220 rpm for 5-7 days. The fermentation broth was centrifuged and the supernatant was taken. 2M HCl was added to adjust the pH to 3.0-4.0, and then an equal volume of ethyl acetate was added for extraction. After extraction, the ethyl acetate was spin-dried to obtain a crude sample of secondary metabolites of the engineered bacteria S.avermitilisSUKA17::bpm. After dissolution with methanol, the crude sample was analyzed using high-performance liquid chromatography (HPLC) and LC-MS and compared with the control group S.avermitilis SUKA17. Eight bipentaromycins compound absorption peaks were successfully generated. The specific HPLC analysis procedure is: acetonitrile is reduced from 95% to 50% in 0-15 minutes, increased to 80% in 15-20 minutes, rapidly increased to 100% in 20-21 minutes and maintained until 24 minutes, then suddenly reduced to 5% in 24-25 minutes and balanced until 30 minutes. The experimental results are as follows Figure 1 The structures of compounds 1-8 are shown below:

[0082]

[0083] (2) The plasmid pSHG1001 was transformed into Escherichia coli GB05 (GB05 literature: Wang, H.; Li, Z.; Jia, R.; Hou, Y.; Yin, J.; Bian, X.; Li, A.; Müller, R.; Stewart, AF; Fu, J.; Zhang, Y. RecET direct cloning and Redαβ recombination of biosynthetic gene clusters, large operonsor single genes for heterologous expression. Nat. Protoc. 2016, 11, 1175-1190.) and cultured at OD 600 When the cell density reaches 0.2-0.3, 1M L-arabinose is added for induction and culture is continued for 45 minutes. After washing the cells with 10% glycerol, 300-400ng of the inserted gene bla fragment (as shown in SEQ ID NO: 8) is added, mixed and then electroporated. The specific parameters are as follows: Example 1. Then 1mL LB medium is added and cultured at 37°C for 1 hour. After centrifugation, the cells are spread on LB plates containing Apr and ampicillin (Amp) and cultured overnight. PCR is used to verify whether the Amp gene is inserted into the original gene, destroying the original gene so that it does not play a role in subsequent heterologous expression. The successfully verified plasmid is transferred into the conjugation transfer donor bacteria WM6026. The subsequent conjugation transfer and heterologous expression steps refer to the above step (1). This method was used to jointly inactivate the upstream genes orf-7 to orf-1, the downstream genes orf1-orf3, and the bpmR3 gene. HPLC analysis showed that the mutants Δorf-7--1 and Δorf1-3 could still produce bipentaromycins, while the inactivation of bpmR3 affected the synthesis of bipentaromycins. This determined the boundaries of the bpm gene cluster, which contains 32 main genes. Table 4 lists the nucleotide sequences obtained from the NCBI database, which is the NCBI Reference Sequence: GCF _ The specific coding gene contained in bases 23017-64167 of the nucleotide sequence of 000719695.1.

[0084] SEQ ID NO:8:cgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaat gcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaa

[0085] Table 4

[0086]

[0087]

[0088] This study defines the precise boundaries of the bpm gene cluster for the first time and identifies 32 main genes, including:

[0089] Genes responsible for skeleton synthesis: bpmA, bpmB, bpmC;

[0090] Genes responsible for backbone aromatic ring cyclization and aromatization modification: bpmD, bpmE, bpmF, bpmQ;

[0091] Genes responsible for redox modification: bpmO1, bpmO2, bpmO3, bpmO4, bpmO5, bpmO6, bpmO7, bpmO8;

[0092] Gene responsible for methylation modification: bpmM;

[0093] Genes responsible for stereoselective hydrogenation: bpmG1, bpmG2;

[0094] Other functional genes: bpmR1, bpmR2, bpmR3, bpmT1, bpmT2, bpmT3, bpmH1, bpmH2, bpmH3, bpmV, bpmL, bpmP, bpmK1, bpmK2.

[0095] The sequence of the gene cluster containing 32 main genes is the nucleotide sequence of NCBI Reference Sequence: GCF_000719695.1, bases 30380-60894. Figure 5 Middle B is the bpm gene cluster map. Figure 2 HPLC profile of metabolites of mutant strains to clarify the boundaries of the bpm gene cluster.

[0096] Example 3: Preliminary verification of the in vivo function of BpmP in the acylation reaction

[0097] (1) Construction of mutant strains and detection of metabolites: Plasmid pSHG1001 was transformed into Escherichia coli GB05 and cultured to OD 600When the pH reached 0.2-0.3, 1M L-arabinose was added for induction and the culture was continued for 45 minutes. After washing the cells with 10% glycerol, 300-400ng of the inserted gene bla fragment (as shown in SEQ ID NO: 108) was added, mixed and then electroporated. The specific parameters were referred to Example 1. Then 1mL LB medium was added and cultured at 37°C for 1 hour. After centrifugation, the cells were spread on LB plates containing Apr and ampicillin (Amp) and cultured overnight. PCR verification was used to verify that the successful plasmid was heterologously expressed to obtain the mutant strain ΔbpmP, which was inoculated into MYM liquid medium and cultured at 28°C for 5-7 days. After fermentation, its metabolites were analyzed and identified using high performance liquid chromatography (HPLC) and mass spectrometry (MS). The results showed that compared with the metabolites of the strain with the complete gene cluster, only compounds 1 and 2 were detected in the mutant strain, and all compounds with side chain acylation modifications disappeared, indicating that the bpmP gene was involved in the acylation process.

[0098]

[0099] (2) To further confirm that the bpmP gene is involved in the acylation process, NCBI blastp was used to perform homology analysis on the amino acid sequence of the BpmP protein. The results showed that the BpmP protein had a high homology with the GNAT family acyltransferase, indicating that the protein may belong to this family. The Pfam database was then used to analyze the functional domain of the BpmP protein, and the results confirmed that the protein contained a GNAT family acyltransferase domain (142-282). Combined with the in vivo metabolism of the mutant strain, it further supported that the BpmP protein was involved in the acylation modification reaction. The structure of the BpmP protein is shown in SEQ ID NO: 3. Figure 3 This is the HPLC analysis chart of the ΔbpmP mutant.

Claims

1. A gene cluster cloning method, comprising the following steps: S1, restriction enzyme digestion of the target microbial genome to obtain DNA fragments containing the target biosynthetic gene cluster; S2, using the Gibson assembly method, the upstream of the DNA fragment containing the target biosynthetic gene cluster was connected to a fragment containing the p15A ori-loxP-AmpR element of pBE44 and a homology arm for the upstream, and the downstream was connected to a fragment containing a homology arm for the downstream and lacZα-loxP-phage The fragments of the attP-traJ-ApmR element were connected to obtain a linear recombinant fragment connected by three fragments; S3, electroporating the linear recombinant fragment into an Escherichia coli host strain containing a Cre recombinase expression system, and relying on the Cre-loxP system to achieve circularization of the large gene cluster in vivo to obtain a circular recombinant plasmid.

2. The gene cluster cloning method according to claim 1, wherein: In S1, the target microorganism is a bacterium, preferably a Streptomyces, such as Streptomyces sp. NRRL F-6131, Streptomyces noursei ATCC 11455; and / or In S1, the target biosynthetic gene cluster is a biosynthetic gene cluster with a size of less than 50 kb, for example, bases 23017-64167 of the nucleotide sequence of NCBI Reference Sequence: GCF_000719695.1; and / or In S1, the target microbial genome is extracted by the phenol-chloroform method; and / or S1 includes the following steps: First, determine the specific name of the Streptomyces to be cloned. Then, search for the genome of the Streptomyces by the name on NCBI, download the genome file in Fasta or gbff format, and then upload the downloaded genome file to the antiSMASH online analysis platform for analysis. Determine the restriction enzyme cutting site of the specific gene cluster to be cloned, and then select the restriction endonuclease and its digestion conditions based on the selected restriction enzyme cutting site.

3. The gene cluster cloning method according to claim 1, wherein: In S2, in the fragment containing the p15A ori-loxP-AmpR element of pBE44 and the homology arm directed upstream, the p15A ori-loxP-AmpR element of pBE44 has the sequence shown in SEQ ID NO: 1, and the homology arm directed upstream is linked to the 3' end of the sequence shown in SEQ ID NO: 1; and / or In S2, the homology arm containing the downstream and lacZα-loxP-phage attP-traJ-ApmR element fragment, the lacZα-loxP-phage of pBE45 The attP-traJ-ApmR element has the sequence shown in SEQ ID NO: 2, and a homology arm directed toward the downstream is linked to the 5' end of the sequence shown in SEQ ID NO:

2.

4. The gene cluster cloning method according to claim 1, wherein: In S3, the E. coli host bacteria containing the Cre recombinase expression system include, for example, E. coli pBE14Cre.

5. A bipentaromycins biosynthetic gene cluster (bpm), comprising bases 23017-64167 of the nucleotide sequence of NCBI Reference Sequence: GCF_000719695.

1.

6. A bipentaromycins biosynthetic gene cluster (bpm) comprising the following elements: Genes responsible for skeleton synthesis: bpmA, bpmB, bpmC; Genes responsible for backbone aromatic ring cyclization and aromatization modification: bpmD, bpmE, bpmF, bpmQ; Genes responsible for redox modification: bpmO1, bpmO2, bpmO3, bpmO4, bpmO5, bpmO6, bpmO7, bpmO8; Gene responsible for methylation modification: bpmM; Genes responsible for stereoselective hydrogenation: bpmG1, bpmG2; Other functional genes: bpmR1, bpmR2, bpmR3, bpmT1, bpmT2, bpmT3, bpmH1, bpmH2, bpmH3, bpmV, bpmL, bpmP, bpmK1, bpmK2, Particularly, the bipentaromycins biosynthetic gene cluster (bpm) comprises bases 30380-60894 of the nucleotide sequence of NCBI Reference Sequence: GCF_000719695.

1.

7. A BpmP protein having the amino acid sequence shown in SEQ ID NO:

3. A nucleic acid molecule encoding the BpmP protein according to claim 7 .

9. An engineered bacterium, into which the bipentaromycins biosynthetic gene cluster according to claim 5 or 6 or the nucleic acid molecule according to claim 8 is introduced.

10. A method for producing bipentaromycins, comprising the step of culturing the engineered bacteria as claimed in claim 9 into which the bipentaromycins biosynthetic gene cluster as claimed in claim 5 or 6 is introduced to obtain bipentaromycins.

Images