Mutant plasmid capable of resisting cucumber mosaic virus, tobacco vein banding mosaic virus and pepper vein mottle mosaic virus and application of mutant plasmid

Abstract

The invention discloses a mutant plasmid capable of resisting cucumber mosaic virus, tobacco vein banding mosaic virus and pepper vein mottle mosaic virus and application of the mutant plasmid, and belongs to the technical field of plant virology and molecular biology. The mutant plasmid contains a mutant RNA2 of a CMVFny isolate, and the nucleotide sequence of the mutant RNA2 is as shown in SEQ ID NO. 1. According to the invention, a plasmid vector pCCFR2-2bPT II with early termination of CMV 2b protein is used as a basic vector, and 100 bp fragments of tobacco vein banding mosaic virus and capsicum vein mottle mosaic virus are inserted into the basic vector to construct a mutant plasmid capable of resisting cucumber mosaic virus, tobacco vein banding mosaic virus and capsicum vein mottle mosaic virus. And a foundation is laid for prevention and treatment of composite infection of the three viruses.

Description

Technical Field

[0001] The invention relates to the technical field of plant virology and molecular biology, and in particular to a mutant plasmid resistant to cucumber mosaic virus, tobacco vein band mosaic virus and pepper vein mottle mosaic virus and application thereof. Background Art

[0002] Plant viral diseases are the second most common plant disease in agricultural production, second only to fungi (Zhao et al., 2016). They infect a wide range of crops and cause annual losses of up to 30 billion yuan in my country (Xie Kunlun et al., 2020). Cucumber mosaic virus (CMV) can infect over 1,200 plant species across more than 100 families, making it one of the most widely distributed, economically damaging plant viruses known. CMV causes leaves to shrink and curl, developing a yellow-green mosaic. In the later stages of the disease, it causes fruit deformity, necrosis, and overall plant dwarfing, severely impacting yield and quality (Palukaitis et al., 1982). Tobacco vein banding mosaic virus (TVBMV) can infect Solanaceae crops. Infection causes mosaicism, with green bands along the veins that gradually spread into dark green patches, resulting in reduced tobacco quality (Liu et al., 2013). The damage caused by pepper vein mottle mosaic virus (ChiVMV) to tobacco in the tobacco-growing areas of Yunnan, Guizhou and Sichuan is becoming increasingly serious, causing leaves to turn green and yellow, manifesting as circular bright spots and continuous browning and necrosis of lesions, resulting in serious yield reduction of plants (Leng Dongwei et al., 2023; Shen Guangcai et al., 2024).

[0003] In nature, many viruses exhibit co-infection. The synergistic effects of co-infection can expand the host range, accelerate recombination and mutation, and increase the risk of harm. In agricultural production, cucumber mosaic virus, tobacco vein band mosaic virus, and pepper vein mottle mosaic virus often co-infect tobacco, exacerbating the damage. Therefore, finding methods that can simultaneously protect against multiple viruses is particularly important.

[0004] Cross-protection against attenuation is one of the effective measures to prevent and control plant viral diseases. However, for the complex infection of multiple viruses, it is necessary to insert fragments of different heterologous viruses into the artificially prepared attenuated mutants. The size of the exogenous fragments that the attenuated mutants can accommodate is limited. Therefore, how to select appropriate heterologous virus fragments under the limited fragment length limit so that the constructed attenuated mutants have weak toxicity and genetic stability is the main technical difficulty currently faced in preventing and controlling the complex infection of multiple viruses through cross-protection against attenuation. Summary of the Invention

[0005] In view of the above-mentioned prior art, the present invention aims to provide a mutant plasmid resistant to cucumber mosaic virus, tobacco vein mosaic virus and pepper vein mottle mosaic virus and its application. F R2-2bPTⅡ was used as the basic vector, and 100bp fragments of tobacco vein mosaic virus and pepper vein mottle mosaic virus were inserted into the basic vector to construct a mutant plasmid that is resistant to cucumber mosaic virus, tobacco vein mosaic virus and pepper vein mottle mosaic virus, laying the foundation for the prevention and control of the combined infection of these three viruses.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention provides a mutant plasmid resistant to cucumber mosaic virus, tobacco vein band mosaic virus and pepper vein mottle mosaic virus, which is named pCC F R2-TVB-ChiV; the mutant plasmid contains CMV Fny The mutant RNA2 of the isolate, the nucleotide sequence of the mutant RNA2 is shown as SEQ ID NO.1.

[0008] The second aspect of the present invention provides a method for constructing the mutant plasmid, comprising the following steps:

[0009] PCC F R2-2bPTⅡ was used as the basic vector, and the TVBMV gene fragment shown in SEQ ID NO.2 and the ChiVMV gene fragment shown in SEQ ID NO.3 were inserted into the basic vector to construct a mutant plasmid.

[0010] Preferably, the TVBMV gene fragment and the ChiVMV gene fragment are inserted into the basic vector using overlapping PCR, enzyme digestion and ligation.

[0011] More preferably, the primer sequences used for overlapping PCR amplification are shown as SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 and SEQ ID NO. 7, respectively.

[0012] The conditions for overlapping PCR amplification were as follows: first-round PCR: pre-denaturation at 95°C for 3 min; 30 cycles of denaturation at 95°C for 15 s, annealing at 52°C for 15 s, and extension at 72°C for 4 s; complete extension at 72°C for 5 min; and storage at 4°C. Second-round PCR: pre-denaturation at 95°C for 3 min; 8 cycles of denaturation at 95°C for 15 s, annealing at 38°C for 15 s, and extension at 72°C for 8 s; 27 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 8 s; complete extension at 72°C for 5 min; and storage at 4°C.

[0013] The above construction method uses the basic vector pCC F R2-2bPTⅡ is described in patent CN 112961839 B, and the basic vector pCC F R2-2bPTⅡ contains CMV Fny The full-length sequence of RNA2 of the isolate was obtained, and TAATAG was inserted at position 2661, causing premature termination of CMV 2b protein. F R2-2bPTⅡ was used as the basic vector, and 100bp TVBMV conservative sequence and 100bp ChiVMV conservative sequence were inserted into the basic vector to construct the mutant plasmid pCC F R2-TVB-ChiV.

[0014] The third aspect of the present invention provides the use of the mutant plasmid described above in the following (1) or (2):

[0015] (1) Preparation of attenuated vaccines for preventing and treating plant diseases;

[0016] (2) Prevent and control the combined infection of cucumber mosaic virus, tobacco vein band mosaic virus and pepper vein mottle mosaic virus.

[0017] In the above application, the plant disease is caused by a combined infection of cucumber mosaic virus, tobacco vein band mosaic virus and pepper vein mottle mosaic virus.

[0018] A fourth aspect of the present invention provides a plant attenuated vaccine, wherein the attenuated vaccine comprises the mutant plasmid as an active ingredient.

[0019] Furthermore, the plant attenuated vaccine also includes: CMV Fny RNA1 plasmid and CMV Fny Plasmid for RNA3.

[0020] Preferably, in the attenuated plant vaccine, the mutant plasmid, containing CMV Fny RNA1 plasmid and CMV Fny The volume ratio of RNA3 plasmid is 1:1:1.

[0021] The fifth aspect of the present invention provides the use of the above-mentioned attenuated plant vaccine in preventing and treating plant diseases caused by combined infection of cucumber mosaic virus, tobacco vein band mosaic virus and pepper vein mottle mosaic virus.

[0022] Beneficial effects of the present invention:

[0023] (1) For the obtained cucumber mosaic virus RNA2 2b protein premature termination mutant pCC FR2-2bPTⅡ, the present invention further inserts TVBMV conservative fragment and ChiVMV conservative fragment after the new termination codon, obtains the 2b protein premature termination mutant of cucumber mosaic virus RNA2 containing TVBMV fragment and ChiVMV fragment, and the plasmid is combined with the CMV Fny Mixed inoculation of the plasmids of RNA1 and RNA3 of the isolates can prevent infection by virulent strains of CMV, TVBMV and ChiVMV, and can be used as a trivalent attenuated vaccine against cucumber mosaic virus, tobacco vein band mosaic virus and pepper vein mottle mosaic virus.

[0024] (2) The TVBMV genome fragment and ChiVMV genome fragment inserted into the mutant plasmid provided by the present invention are 100 bp of TVBMV genome conserved sequence and 100 bp of ChiVMV genome conserved sequence, respectively, which have the potential to prevent and treat a variety of TVBMV and ChiVMV isolates. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 : Mutant plasmid ppCC F Schematic diagram of electrophoresis results of enzyme digestion identification of R2-TVB-ChiV; the marker is Generay's 250bp-III DNA Ladder molecular weight standard. After enzyme digestion, a linear intermediate vector and 200bp inserted TVBMV and ChiVMV fragments were obtained. After enzyme digestion, the intermediate vector fragment is approximately 7.7kb in length.

[0026] Figure 2 :pCC F R2-TVB-ChiV pathogenicity test on Nicotiana benthamiana; mock, empty Agrobacterium culture; R1, CMV Fny RNA1; R2, CMV Fny RNA2; R3, CMV Fny RNA3;R2-TVB-ChiV, pCC F Transcripts of R2-TVB-ChiV; dpi, days post-inoculation.

[0027] Figure 3 : Genetic stability test of pCCFR2-TVB-ChiV in Nicotiana benthamiana; the marker was DL2000 DNA Marker molecular weight standard from GenStar.

[0028] Figure 4 :Test of cross-protection effect of pCCFR2-TVB-ChiV on Nicotiana benthamiana; mock, empty Agrobacterium culture; R1, CMV Fny RNA1; R2, CMV FnyRNA2; R3, CMV Fny RNA3; R2-TVB-ChiV, transcription product of pCCFR2-TVB-ChiV; dpi, days post inoculation.

[0029] Figure 5 : Determination of the genetic stability of pCCFR2-TVB-ChiV after virulent up-virulence in Nicotiana benthamiana; the marker was the DL2000 DNA Marker molecular weight standard from GenStar. DETAILED DESCRIPTION

[0030] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0031] As mentioned above, cucumber mosaic virus, tobacco vein band mosaic virus, and pepper vein mottle mosaic virus often co-infect tobacco, exacerbating its damage. Leaves shrink and curl, become chlorotic and yellow, and develop yellow-green mosaic symptoms. Green bands and circular bright spots appear along the veins. In the late stages of the disease, the spots turn brown and necrotic, and the entire plant becomes dwarfed, seriously affecting yield and quality. Therefore, it is particularly important to find attenuated mutants that are simultaneously resistant to cucumber mosaic virus, tobacco vein band mosaic virus, and pepper vein mottle mosaic virus.

[0032] The inventor has long been committed to the research on the prevention and treatment of plant viral diseases. In the early stage, he developed a plasmid vector pCC with premature termination of CMV 2b protein. F R2-2bPTⅡ can accommodate 200bp of exogenous fragments. In order to develop a trivalent attenuated vaccine that can resist cucumber mosaic virus, tobacco vein mosaic virus and pepper vein mottle mosaic virus, the present invention uses pCC F R2-2bPTⅡ is the basic vector. F The length of the exogenous fragment that R2-2bPTⅡ can accommodate is only 200bp, while the tobacco vein mosaic virus and pepper vein mottle mosaic virus that need to be inserted are both more than 9,000 bp in length. How to select a suitable fragment from such a long gene sequence and insert it into the basic vector so that it has both infectious properties and attenuated toxicity, so that plants can gain resistance to plant viruses through cross-protection, while also ensuring that the inserted fragment can exist stably in the plant body, which makes the selection of the inserted fragment extremely difficult.

[0033] In order to screen suitable insertion fragments of tobacco vein mosaic virus and pepper vein mottle mosaic virus, the present invention used DNAMAN software to perform sequence alignment based on the full-length sequences of five different strains of TVBMV published in GenBank (accession numbers: EU734432, HQ396793, HQ396792, HQ396791, and JF928460), screened different conserved regions for verification, and finally selected the 100 bp sequence of tobacco vein mosaic virus for insertion as shown in SEQ ID NO. 2, which is specifically as follows:

[0034] CAGCACCTCTGGATACTCTACTAGCCGGAAAAGTGTGTGTTGACGATTTCAACA ATTTCTTTTATTCATTCAATCTGAAAGGACCATGGAGTGTCGGGAT

[0035] Based on the full-length sequences of five different strains of ChiVMV published in GenBank (accession numbers: JX088636, ON838425, OR590618, PP871400, PQ466185), sequence alignment was performed using DNAMAN software. Different conserved regions were screened for verification, and the 100 bp sequence of pepper vein mottle mosaic virus was finally selected for insertion as shown in SEQ ID NO. 3, which is as follows:

[0036] TATGAAATGACATCGAAAACTCCCGTCCGAGCTCGTGAGGCACACATTCAAAT GAAGGCAGCTGCGTTACGTGGCGCAAGCAACAGGATGTTCGGTCTGG

[0037] The present invention inserts the conservative 100bp genome fragments of tobacco vein mosaic virus and pepper vein mottle mosaic virus into the mutant CMV Fny RNA2 plasmid vector pCC F In R2-2bPTⅡ, a mutant plasmid pCCFR2-TVB-ChiV containing the 2b protein of cucumber mosaic virus RNA2 containing TVBMV and ChiVMV segments was obtained. Fny The nucleotide sequence of RNA2 is shown in SEQ ID NO.1, and is as follows:

[0038] GGATCC CAGCACCTCTGGATACTCTACTAGCCGGAAAAGTGTGTGTTGACGATTTCAACAATTTCTTTTATTCATTCAATCTGAAAGGACCATGGAGTGTCGGGATTATGAAATGACATCGAAAACTCCCGTCCGAGCTCGTGAGGCACACATTCAAATGAAGGCAGCTGCGTTACGTGGCGCAAGCAACAGGATGTTCGGTCTGG CCCGGG gcctctcgtttagagttatcggcggaagaccatgattttgacgatacagattggttcgccggtaacgaatgggcggaaggtgctttctgaaacctcc ccttccgcatctccctccggttttctgtggcgggagctgagttggcagtattgctataaactgtctgaagtcactaaacacattgtggtgaacgggt tgtccatccagcttacggctaaaatggtcagtcgtagaggaatctacgccagcagacttacaagtctctgaggcacctttgaaaccatctcctaggt ttcttcggaaggacttcggtccgtgtacttctagcacaacgtgctagtttcagggtacgggtgccccccacttttgtggggcctccaaaaggagacca

[0039] In the above sequence, lowercase letters represent CMV Fny The sequence of RNA2, capital letters represent the inserted exogenous sequence, wherein the double stop codon is indicated in italics and the restriction enzyme cleavage site is indicated by underline.

[0040] The present invention further constructs a mutant plasmid pCCFR2-TVB-ChiV and a CMV-containing Fny RNA1 plasmid and CMV Fny The plasmid combination of RNA3 was used as a attenuated vaccine to investigate its effect on the combined infection of cucumber mosaic virus, tobacco vein band mosaic virus and pepper vein mottle mosaic virus. It was found that it had a good control effect on the combined infection of the three viruses.

[0041] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below with reference to specific embodiments.

[0042] All experimental materials used in the examples of the present invention that are not specifically described are conventional experimental materials in the art and can be purchased through commercial channels. Where specific experimental conditions and methods are not specified in the examples of the present invention, conventional conditions, such as those in J. Sambrook et al., ed., Molecular Cloning Laboratory Manual (3rd Edition), Science Press, 2002; and D.L. Spector et al., ed., Cell Experiment Manual, Science Press, 2001, were generally followed, or the conditions recommended by the manufacturer.

[0043] The primer sequences used in the present invention are as follows:

[0044] Primers Sequences(5' to 3') Serial number TVB-BamHⅠ-7600-F ATGGATCCCAGCACCTCTGGATACTCTACTAG SEQ ID No.4 TVB-7699-CZ-ChiV-9240-R ATTTCATAATCCCGACACTCCATG SEQ ID No.5 ChiV-9240-CZ-TVB-7699-F GTCGGGATTATGAAATGACATCGAA SEQ ID No.6 ChiV-SmaⅠ-9339-R ATCCCGGGCCAGACCGAACATCCTGTTGC SEQ ID No.7 CMV-Fny2-2510-F AGAATCGACGGGAACGAGGT SEQ ID No.8 CMV-Fny2-R TGGTCTCCTTTTGGAGGC SEQ ID No.9

[0045] Note: Protected bases are in bold and restriction enzyme cleavage sites are underlined.

[0046] Example 1: Mutant plasmid pCC F Construction of R2-TVB-ChiV

[0047] Cucumber mosaic virus RNA2 2b protein premature termination plasmid pCC F R2-2bPTⅡ as the basic vector (plasmid pCC F The construction method of R2-2bPTⅡ is described in paragraph 0043 of the specification of patent CN 112961839 B. The product was digested with SmaI (Takara) under the following reaction conditions: 30°C for 12 h. The product was recovered by anhydrous ethanol precipitation: the product was added to 450 μl of ddH2O, 50 μl of 3.0 M sodium acetate, pH 5.2, and 1 ml of anhydrous ethanol were added, and the product was precipitated at -80°C for 2 h. The product was centrifuged at 12,000 rpm for 10 min, the liquid was discarded, and 600 μl of 70% ethanol was added. The product was centrifuged at 12,000 rpm for 5 min, the liquid was discarded, and the product was centrifuged at 12,000 rpm for 1 min. After centrifugation at 12,000 rpm for 1 min, the liquid in the centrifuge tube was aspirated and 30 μl of ddH2O was added for resolubilization. The product was then digested with BamHI (Takara) at 37°C for 12 h. The digested product was recovered using a DNA recovery kit to obtain the linearized basic vector pCC11, which was digested with BamHI and SmaI. F R2-2bPTⅡ.

[0048] Total RNA from TVBMV-infected leaves was extracted using TransZol Up (TransGen Biotech) and reverse transcribed using EvoM-MLV Reverse Transcriptase (AG). The reverse primer was TVB-7699-CZ-ChiV-9240-R. The reaction conditions were as follows: denaturation at 65°C for 5 min without enzyme addition; after adding reverse transcriptase, reaction was incubated at 42°C for 30 min. PCR was then performed using the reverse-transcribed cDNA as a template in the presence of Phanta Max Super-Fidelity DNA Polymerase (Vazyme). The primer pair was TVB-BamHI-7600-F and TVB-7699-CZ-ChiV-9240-R. PCR reaction conditions included initial denaturation at 95°C for 3 min, followed by 30 cycles of denaturation at 95°C for 15 s, annealing at 52°C for 15 s, and extension at 72°C for 4 s, followed by complete extension at 72°C for 5 min, and storage at 4°C. The PCR product consisted of a 100-bp TVBMV conserved sequence fragment and overlapping sequences for overlap PCR. The PCR product was recovered using a DNA recovery kit.

[0049] At the same time, total plant RNA from leaves infected with ChiVMV was extracted using TransZol Up (TransGen Biotech), and reverse transcription was performed under the action of Evo M-MLVReverse Transcriptase (AG). The reverse primer was ChiV-SmaⅠ-9339-R. The reaction conditions were: denaturation at 65°C for 5 minutes without adding enzymes; after adding reverse transcriptase, reaction was carried out at 42°C for 30 minutes. PCR was then performed using the reverse-transcribed cDNA as a template in the presence of Phanta Max Super-Fidelity DNA Polymerase (Vazyme). The primer pair was ChiV-9240-CZ-TVB-7699-F and ChiV-SmaⅠ-9339-R. PCR reaction conditions included initial denaturation at 95°C for 3 min, followed by 30 cycles of denaturation at 95°C for 15 s, annealing at 52°C for 15 s, and extension at 72°C for 4 s, followed by complete extension at 72°C for 5 min, and storage at 4°C. The PCR product consisted of a 100-bp ChiVMV conserved sequence fragment and overlapping sequences for overlap PCR. The PCR product was recovered using a DNA recovery kit.

[0050] The two fragments were linked by overlapping PCR, with each fragment serving as a template. PCR was performed with Phanta Max Super-Fidelity DNA Polymerase (Vazyme) using the primer pair TVB-BamHI-7600-F and ChiV-SmaI-9339-R. PCR reaction conditions included pre-denaturation at 95°C for 3 min, 8 cycles of denaturation at 95°C for 15 s, annealing at 38°C for 15 s, and extension at 72°C for 8 s, 27 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 8 s, and complete extension at 72°C for 5 min. The PCR product was the TVB-ChiV fragment. The PCR product was recovered using a DNA recovery kit.

[0051] The TVB-ChiV fragment was then digested with SmaI (Takara) at 30°C for 4 h; the digested product was recovered using a DNA recovery kit; the product was digested with BamHI (Takara) at 37°C for 4 h; the digested product was recovered using a DNA recovery kit to obtain a TVB-ChiV fragment double-digested with BamHI and SmaI.

[0052] The intermediate vector pCC was double-digested with BamH I and Sma I F The R2-2bPTⅡ and TVB-ChiV fragments were ligated with T4 DNA ligase (Takara) at 16°C overnight. The ligation product was transformed into Escherichia coli DH5α and coated on LB plates with 100 μg / mL kanamycin. The mutant plasmid pCC was obtained by colony PCR, plasmid digestion, and DNA sequencing. F R2-TVB-ChiV.

[0053] Result analysis: After the transformation product was screened by colony PCR, the plasmid was extracted for enzyme digestion identification. Double enzyme digestion identification was performed using BamH I and SmaI. The enzyme digestion results showed that the plasmid could be cut into two fragments with lengths of approximately 7.7 kb and 200 bp respectively. Figure 1 ); confirmed by DNA sequencing: mutant plasmid pCC F R2-TVB-ChiV contains CMV Fny The mutant RNA2 of the isolate, the nucleotide sequence of the mutant RNA2 is shown as SEQ ID NO.1.

[0054] Example 2: Mutant plasmid pCC F Analysis of the pathogenicity and stability of R2-TVB-ChiV

[0055] 1. Test method:

[0056] (1) Plasmid transformation into Agrobacterium:

[0057] First, wild-type CMV Fny RNA1 plasmid (pCB301-CMV Fny -R1), containing wild-type CMV Fny RNA2 plasmid (pCB301-CMV Fny –R2), containing wild-type CMV Fny RNA3 plasmid (pCB301-CMV Fny –R3) and mutant plasmid pCC F R2-TVB-ChiV was used to transform competent cells of Agrobacterium tumefaciens GV3101, and the cells were evenly spread on LB solid medium (50 μg / ml kanamycin, 100 μg / ml rifampicin). After culturing at 28°C for 48 h, a single plaque was picked for colony PCR verification. Then, a single plaque was picked and added to 2 ml LB culture medium (50 μg / ml kanamycin, 100 μg / ml rifampicin) and cultured at 28°C with shaking at 200 rpm for 24 h.

[0058] 200 μl of bacterial solution was added to 5 ml of LB culture medium (50 μg / ml kanamycin, 100 μg / ml rifampicin), and cultured at 28° C. and 200 rpm for 12 h.

[0059] Place the bacterial suspension in a 10 ml centrifuge tube and centrifuge at 6000 rpm for 10 min at room temperature. Collect the bacterial cells and resuspend them in 1 ml of Agrobacterium resuspension solution (10 mM MgCl2, 10 mM MES, 0.15 mM AS) to obtain Agrobacterium suspension containing different plasmids. Adjust the concentration to make the OD 600 Both are 1.2.

[0060] (2) Agrobacterium infiltration and infection of Nicotiana benthamiana:

[0061] Adjust the OD 600 Values ​​containing wild-type CMV Fny Agrobacterium culture containing RNA1 plasmid, wild-type CMV Fny Agrobacterium culture containing RNA2 plasmid and wild-type CMV Fny Equal volumes of Agrobacterium culture containing RNA3 plasmid were mixed to form the first Agrobacterium mixture (R1 / R2 / R3);

[0062] Adjust the OD 600 Values ​​containing wild-type CMV Fny Agrobacterium culture containing RNA1 plasmid, mutant plasmid pCC F Agrobacterium culture of R2-TVB-ChiV and wild-type CMV FnyEqual volumes of Agrobacterium culture containing RNA3 plasmid were mixed to form the second Agrobacterium mixture (R1 / R2-TVB-ChiV / R3);

[0063] The first Agrobacterium mixture and the second Agrobacterium mixture were allowed to stand at 28°C for 3 h.

[0064] Take a 1ml disposable syringe, remove the needle, and draw up the first and second Agrobacterium mixtures, respectively. Select Nicotiana benthamiana plants at the 6-8 leaf stage. Use pressure to inject the bacterial solution in the syringe between the veins on the back of the leaves. Inject two leaves per plant, and ensure that the injection volume covers at least 1 / 3 of the leaf.

[0065] The inoculated plants were cultured at 25°C with alternating 16 h light / 8 h dark periods.

[0066] 14 days after inoculation, the disease of tobacco was observed; total RNA was extracted from the upper non-inoculated leaves and cloned into pCC F Primers CMV-Fny2-2510-F (SEQ ID NO.8) and CMV-Fny2-R (SEQ ID NO.9) were designed upstream and downstream of the insertion site of the exogenous fragment of R2-TVB-ChiV, and RT-PCR detection was performed to determine whether the inserted exogenous fragment was stable by the length of the amplified fragment. If pCC F R2-TVB-ChiV is stable, and the corresponding PCR product fragment length should be 758 bp.

[0067] 2. Test results:

[0068] 14 days after inoculation, the symptoms showed that the mock N. benthamiana did not develop disease and grew well; the N. benthamiana inoculated with wild-type CMV (R1 / R2 / R3) developed severe disease, with dwarf plants and shrunken leaves; the N. benthamiana inoculated with mutant pCC F The symptoms of the R2-TVB-ChiV Nicotiana benthamiana plants were basically the same as those of the mock plants, with no obvious virus symptoms, indicating that pCC F R2-TVB-ChiV is CMV Fny The attenuated mutant of RNA2 ( Figure 2 ).

[0069] RT-PCR results showed that the amplified band of the wild-type CMV (R1 / R2 / R3) inoculated sample was approximately 540 bp, which was consistent with the expected band size ( Figure 3 , lane3); mutant pCC F The amplified band of the R2-TVB-ChiV inoculated sample was approximately 758 bp, which was consistent with the expected band size ( Figure 3 , lane4), indicating that the inserted exogenous fragment can exist stably, indicating that the mutant pCCF R2-TVB-ChiV has stable inheritance.

[0070] Example 3: Mutant plasmid pCC F Cross-protection effect and stability analysis of R2-TVB-ChiV

[0071] 1. Test method:

[0072] Using the method in Example 2, the first Agrobacterium mixed solution (R1 / R2 / R3), the mutant plasmid pCC F The second Agrobacterium mixture of R2-TVB-ChiV (R1 / R2-TVB-ChiV / R3) was inoculated 7 days later with target virulent CMV, TVBMV, ChiVMV alone or with three viruses in combination and pre-inoculated with mutant plasmid pCC F R2-TVB-ChiV plants (R1 / R2-TVB-ChiV / R3) and plants not pre-inoculated with mutants (mock).

[0073] The target virulent CMV (NCBI accession number: Fny1:D00356, Fny2:D00355, Fny3:D10538) was inoculated with Agrobacterium infiltration in Example 2, and the target virulent TVBMV (NCBI accession number: EU734432) and ChiVMV (NCBI accession number: JX088636) were inoculated with friction inoculation to infect plants pre-inoculated with mutants and plants not pre-inoculated with mutants.

[0074] Friction inoculation: Weigh 0.5g of diseased leaves, add 5ml of PBS buffer, and grind thoroughly in a sterile mortar. Sprinkle a small amount of corundum on the upper surface of the Nicotiana benthamiana leaf. Gently rub the leaf surface with disposable gloves to create a mechanical wound. Use a pipette to draw diseased sap into the mechanical wound and gently press until the sap evenly covers the injured leaf surface.

[0075] The inoculated plants were cultured at 25°C with alternating 16 h light / 8 h dark periods.

[0076] 14 days after inoculation of the target virus, observe the disease incidence of tobacco, calculate the disease index and relative control efficacy; and classify the disease according to the national standard of the People's Republic of China "Grading and Investigation Methods of Tobacco Diseases and Insect Pests GB / T 23222-2008".

[0077] Level 0: The whole plant is disease-free.

[0078] Level 1: The veins of the heart leaves are clear or the leaves are slightly mosaic, and the diseased plants have no obvious dwarfing.

[0079] Level 3: One-third of the leaves are mosaic but not deformed, or the diseased plant is shrunk to more than three-quarters of its normal height.

[0080] Level 5: One-third to one-half of the leaves are mosaic, or a few are deformed or the main and lateral veins are necrotic, or the plant is dwarfed to two-thirds to three-quarters of its normal size.

[0081] Level 7: One-half to two-thirds of the leaves are mosaic, or deformed or the main and lateral veins are necrotic, or the plant is dwarfed to one-half to two-thirds of its normal size.

[0082] Level 9: The leaves of the entire plant are mosaic, severely deformed or necrotic, and the diseased plant is stunted to more than half of its normal height.

[0083] Disease index = ∑(number of diseased plants at each level × disease level) / (total number of plants surveyed × highest representative value) × 100

[0084] Relative efficacy (%) = (1-disease index of treatment group / disease index of control group) × 100%

[0085] Total RNA was extracted from the upper non-inoculated leaves and cloned into pCC F Primers CMV-Fny2-2510-F (SEQ ID NO.8) and CMV-Fny2-R (SEQ ID NO.9) were designed upstream and downstream of the insertion site of the exogenous fragment of R2-TVB-ChiV, and RT-PCR detection was performed to determine whether the inserted exogenous fragment was stable by the length of the amplified fragment. If pCC F R2-TVB-ChiV is stable, and the corresponding PCR product fragment length should be 758 bp.

[0086] 2. Test results:

[0087] The results are as follows Figure 4 As shown, the inoculation symptoms showed that the mock Nicotiana benthamiana did not develop disease and grew well; the wild-type CMV (R1 / R2 / R3)-inoculated Nicotiana benthamiana developed severe disease, with dwarf plants and shrunken leaves; the mutant pCC F The symptoms of R2-TVB-ChiV Nicotiana benthamiana plants are basically the same as those of the mock plants.

[0088] CMV virulent direct inoculation without inoculation of mutant pCC F The leaves of Nicotiana benthamiana plants with R2-TVB-ChiV were severely wrinkled; the mutant pCC was pre-inoculated with virulent CMV. F The R2-TVB-ChiV Nicotiana benthamiana plants are in good growth condition with flat leaves; this indicates that pCC F R2-TVB-ChiV has a preventive effect on CMV with a relative protection efficacy of 100.0%.

[0089] TVBMV virulent direct inoculation without inoculation of mutant pCC F Benthamna with R2-TVB-ChiV, dwarf plants, mosaic leaves; TVBMV virulent pre-inoculation mutant pCC F The leaves of the R2-TVB-ChiV Nicotiana benthamiana plant are flat and the plant height is slightly shorter; this indicates that pCC F R2-TVB-ChiV has a preventive effect against TVBMV, with a relative efficacy of 43.5%.

[0090] ChiVMV virulent direct inoculation of the mutant pCC F Benthamna plants with R2-TVB-ChiV were dwarfed and had yellow leaves. ChiVMV was inoculated with virulent pre-inoculation mutant pCC F The leaves of the R2-TVB-ChiV Nicotiana benthamiana plant are flat and the plant height is slightly shorter; this indicates that pCC F R2-TVB-ChiV has a preventive effect against ChiVMV, with a relative efficacy of 85.7%.

[0091] CMV, TVBMV and ChiVMV mixed virulent inoculation was directly performed on the mutant pCC that had not been inoculated previously. F Benthamna plants with R2-TVB-ChiV were severely dwarfed, with leaves shrunken and curled; the mutant pCC was pre-inoculated with a mixture of CMV, TVBMV, and ChiVMV. F The leaves of the R2-TVB-ChiV Nicotiana benthamiana plant are flat and the plant height is slightly shorter; this indicates that pCC F R2-TVB-ChiV has a preventive effect against a mixture of CMV, TVBMV and ChiVMV, with a relative efficacy of 29.6%.

[0092] RT-PCR results showed that the amplified band of the wt inoculated sample was approximately 540 bp, which was consistent with the expected band size ( Figure 5 , lane3); pre-inoculated mutant pCC F The amplified band of the R2-TVB-ChiV inoculated sample was approximately 758 bp, which was consistent with the expected band size ( Figure 5 , lane4 / 5 / 6 / 7 / 8), indicating that the inserted exogenous fragment can exist stably, indicating that the mutant pCC F R2-TVB-ChiV has stable inheritance.

[0093] Combined with the above results, it is shown that the mutant pCC F R2-TVB-ChiV has cross-protective effects against CMV, TVBMV, ChiVMV and their mixture, and the mutant pCC FR2-TVB-ChiV remained genetically stable after inoculation with virulent CMV, TVBMV, ChiVMV, and a mixture of the three.

[0094] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. A mutant plasmid resistant to cucumber mosaic virus, tobacco vein band mosaic virus and pepper vein mottle mosaic virus, characterized in that: The mutant plasmid contains CMV Fny The mutant RNA2 of the isolate, the nucleotide sequence of the mutant RNA2 is shown as SEQ ID NO.

1.

2. The method for constructing a mutant plasmid according to claim 1, characterized in that: The following steps are involved: PCC F R2-2bPTⅡ was used as the basic vector, and the TVBMV gene fragment shown in SEQ ID NO.2 and the ChiVMV gene fragment shown in SEQ ID NO.3 were inserted into the basic vector to construct a mutant plasmid.

3. The construction method according to claim 2, characterized in that The TVBMV gene fragment and ChiVMV gene fragment were inserted into the basic vector by overlapping PCR, enzyme digestion and ligation; The primer sequences used for overlapping PCR amplification are shown as SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, respectively.

4. Use of the mutant plasmid according to claim 1 in the following (1) or (2): (1) Preparation of attenuated vaccines for preventing and treating plant diseases; (2) Prevent and control the combined infection of cucumber mosaic virus, tobacco vein band mosaic virus and pepper vein mottle mosaic virus.

5. The use according to claim 4, characterized in that The plant disease is caused by combined infection of cucumber mosaic virus, tobacco vein band mosaic virus and pepper vein mottle mosaic virus.

6. A plant attenuated vaccine, characterized in that: The attenuated vaccine uses the mutant plasmid described in claim 1 as an active ingredient.

7. The attenuated plant vaccine according to claim 6, characterized in that The plant attenuated vaccine also includes: Fny RNA1 plasmid and CMV Fny Plasmid for RNA3.

8. The attenuated plant vaccine according to claim 7, characterized in that In the plant attenuated vaccine, the mutant plasmid, containing CMV Fny RNA1 plasmid and CMV Fny The volume ratio of RNA3 plasmid is 1:1:

1.

9. Use of the attenuated plant vaccine according to any one of claims 6 to 8 in preventing and treating plant diseases caused by combined infection of cucumber mosaic virus, tobacco vein band mosaic virus and pepper vein mottle mosaic virus.

Images