RNAi agents for inhibiting DM1 protein kinase (DMPK) expression, compositions and methods of use thereof

Abstract

RNAi agents, compositions comprising RNAi agents, and methods for inhibiting the DM1 protein kinase (DMPK) gene are described herein. The DMPK RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of the DMPK gene. Also described are pharmaceutical compositions comprising one or more DMPK RNAi agents, optionally with one or more additional therapeutic agents. Delivery of the DMPK RNAi agents in vivo to skeletal muscle cells provides inhibition of DMPK gene expression and reduction of DMPK protein levels, and more particularly provides reduction of mutant DMPK-CUG protein levels, which can provide therapeutic benefits to subjects suffering from certain skeletal muscle related diseases or disorders, including type 1 ankylosing muscular dystrophy, including human subjects.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 380,171, filed October 19, 2022, and U.S. Provisional Patent Application Serial No. 63 / 584,283, filed September 21, 2023, the entire contents of which are incorporated herein by reference.

[0003] sequence list

[0004] This application contains a sequence list submitted in XML format, the entire contents of which are incorporated herein by reference. The XML copy is named 30712-WO_SeqListing.xml, created on October 3, 2023, and is 9,007 kb in size. Invention Field

[0005] This disclosure relates to RNA interference (RNAi) agents for inhibiting the expression of the DM1 protein kinase (DMPK) gene, such as double-stranded RNAi agents, compositions including DMPK RNAi agents, and methods of using the same.

[0006] background

[0007] Myotonic dystrophy protein kinase (DMPK) or DM1 protein kinase is primarily expressed in muscle. Myotonic dystrophy type 1 (DM1) is an autosomal dominant multisystemic disease caused by the amplification of >50 CTG repeats in the 3' untranslated region (3'UTR) of the DMPK gene (Legare et al., Neurology Genetics 2019:5(3)). During transcription, the amplified CTG repeats in the 3'UTR result in mRNA transcripts with amplified CUG repeat sequences in the 3'UTR (DMPK-CUG), which prevents the transcripts from crossing nuclear pores into the cytoplasm and leads to nuclear accumulation. Accumulation of mutated DMPK-CUG leads to misregulation of several RNA-binding proteins, including CUGBP1 and MBNL1, which are known to be responsible for the proper RNA processing of multiple gene products prior to translation. It is this misregulation of RNA processing that leads to the expression of incorrect protein isoforms, mislocalization of proteins, or disruption of the synthesis of key proteins, ultimately resulting in loss of cellular function and viability.

[0008] DM1 affects all systems, including the muscular, cardiac, respiratory, endocrine, and central nervous systems (CNS). The hallmark of DM1 is the presence of myotonia, including progressive skeletal muscle damage with a distal-to-proximal pattern, which can also affect respiratory muscles due to misregulation of RNA processing of gene products responsible for normal muscle function.

[0009] Currently, there is no cure for the underlying cause of DM1. Degrading accumulated DMPK-CUG is considered an effective approach to alleviate DM1 pathology. By reducing accumulated transcripts in the muscle nucleus, proper mRNA splicing regulation can be re-established and normal cellular function restored. RNA interference agents, as described in this document, are effective in selectively reducing mRNA targets and are expected to reduce accumulated DMPK-CUG in DM1 patients and restore normal function to affected skeletal muscle.

[0010] Overview

[0011] There is a need for novel RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers, or triggers) capable of selectively and effectively (especially in vivo) inhibiting the expression of the DM1 protein kinase (DMPK) gene, such as double-stranded RNAi agents, like small interfering RNA (siRNA). Furthermore, there is a need for compositions of novel DMPK-specific RNAi agents for treating diseases or conditions that can be at least partially improved by reducing levels of the mutated DMPK-CUG protein, such as myotonic dystrophy type 1.

[0012] Generally, this disclosure relates to DMPK RNAi agents, compositions comprising such RNAi agents, and methods for inhibiting DMPK gene expression in vitro and / or in vivo using the RNAi agents described herein and compositions comprising RNAi agents. The DMPK RNAi agents described herein are capable of selectively and effectively reducing, inhibiting, or silencing the expression of the DMPK gene.

[0013] The DMPK RNAi agents described herein can be used in methods for the therapeutic treatment (including preventative, interventional, or prophylactic treatment) of symptoms and diseases such as type 1 myotonic dystrophy. The methods disclosed herein include administering one or more DMPK RNAi agents to a subject (e.g., a human or animal subject) using any suitable method known in the art, such as subcutaneous (SQ), intramuscular, or intravenous (IV) administration.

[0014] In one aspect, this disclosure relates to an RNAi agent for inhibiting DMPK gene expression, wherein the RNAi agent comprises a sense strand (also called a passenger strand) and an antisense strand (also called a guide strand). The sense strand and the antisense strand may be partially, substantially, or completely complementary to each other. The sense strand of the RNAi agent described herein may each be 15-49 nucleotides in length. The antisense strand of the RNAi agent described herein may each be 17-49 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 17-26 nucleotides in length. The sense strand and the antisense strand may be the same length or different lengths. In some embodiments, the sense strand and the antisense strand are independently 21-26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 21-24 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides in length. In some embodiments, the antisense strand is independently 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some embodiments, the sense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides long. The RNAi agents described herein, upon delivery to cells expressing DMPK, such as skeletal muscle cells (skeletal muscle fibers), inhibit the in vivo and / or in vitro expression of one or more DMPK gene transcripts.

[0015] The DMPK RNAi agents disclosed herein target the DM1 protein kinase (DMPK) gene (see, for example, SEQ ID NO:1, Homo sapiens transcript variant 1). In some embodiments, the RNAi agents disclosed herein target a portion of the DMPK gene having any of the sequences disclosed in Table 1.

[0016] In another aspect, this disclosure relates to pharmaceutical compositions comprising one or more of the disclosed DMPK RNAi agents capable of selectively and effectively reducing DMPK gene expression. Pharmaceutical compositions comprising one or more DMPK RNAi agents described herein may be administered to subjects, such as human or animal subjects, for the treatment (including interventional or prophylactic treatment or inhibition) of symptoms and diseases that can be at least partially improved by reducing DMPK protein levels and, more specifically, reducing levels of mutant DMPK-CUG protein. The pharmaceutical compositions described herein comprise an RNAi agent capable of inhibiting DMPK gene expression and at least one pharmaceutically acceptable excipient.

[0017] Examples of sense and antisense strands of DMPK RNAi agents that can be used in DMPK RNAi agents are provided in Tables 3 and 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5. Examples of duplexes of DMPK RNAi agents are provided in Tables 5.1, 5.2, 5.3, 5.4, 5.6, and 5.7. Examples of 19-nucleotide core stretch sequences that may be composed of or may be included in the sense and antisense strands of certain DMPK RNAi agents disclosed herein are provided in Table 2.

[0018] One aspect described herein is an RNAi agent for inhibiting DMPK gene expression, comprising:

[0019] (i) an antisense strand comprising at least 17 consecutive nucleotides that differ from any of the sequences provided in Table 3 or Table 5.4 by 0 or 1 nucleotide; and

[0020] (ii) a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.

[0021] Another aspect described in this article is an RNAi agent for inhibiting DMPK gene expression, which comprises:

[0022] (i) an antisense strand comprising at least 17 consecutive nucleotides that are different from any of the sequences provided in Table 3 or Table 5.4 having 0 or 1 nucleotides;

[0023] (ii) a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand;

[0024] (iii) a targeting ligand, said targeting ligand being linked to the sense strand and having affinity for skeletal muscle cells and / or receptors present on skeletal muscle cells; and

[0025] (iv) PK / PD modifier, wherein the PK / PD modifier is connected to the sense chain.

[0026] Another aspect described in this article is an RNAi agent for inhibiting DMPK gene expression, which comprises:

[0027] (i) an antisense strand comprising at least 17 consecutive nucleotides that are different from any of the sequences provided in Table 3 or Table 5.4 having 0 or 1 nucleotides;

[0028] (ii) a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand;

[0029] (iii) A targeting ligand, said targeting ligand being attached to the sense strand and having affinity for skeletal muscle cells and / or receptors present on skeletal muscle cells, wherein said targeting ligand is attached to the 5' end of the sense strand; and

[0030] (iv) PK / PD modifier, wherein the PK / PD modifier is connected to the 3' end of the sense chain.

[0031] Another aspect described in this article is an RNAi agent for inhibiting DMPK gene expression, which comprises:

[0032] (i) an antisense strand comprising at least 17 consecutive nucleotides that are different from any of the sequences provided in Table 3 or Table 5.4 having 0 or 1 nucleotides;

[0033] (ii) a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand;

[0034] (iii) A targeting ligand comprising a chemical structure shown in Table 6.2 or 6.3 herein, wherein the targeting ligand is attached to the 5' end of the sense chain; and

[0035] (iv) PK / PD modifiers comprising the chemical structures shown in Tables 6.5 or 6.7 herein, wherein the PK / PD modifiers are connected to the 3' end of the sense chain.

[0036] In another aspect, this disclosure relates to a method for in vivo delivery of DMPK RNAi agents to skeletal muscle cells in a subject (e.g., a mammal, such as a human subject). Compositions for such methods are also described herein.

[0037] One or more DMPK RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. In some embodiments, DMPK RNAi agents are delivered to cells or tissues by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group may include a cell receptor ligand. The targeting group may be linked to the 3' or 5' end of the sense or antisense strand of the DMPK RNAi agent, or may be linked via one or more internal nucleotides of the sense or antisense strand. In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is linked to the 5' end of the sense strand. In some embodiments, the targeting group is internally linked to nucleotides on the sense and / or antisense strands of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker. Exemplary targeting ligands suitable for use, having affinity for skeletal muscle cells and / or receptors present on skeletal muscle cells (e.g., integrin α-v-β-6 (αvβ6)), are shown in Tables 6.2 and 6.3 herein. Example 1 describes the synthesis and conjugation of certain targeting ligands suitable for use with the DMPK RNAi agents disclosed herein.

[0038] In some implementations, the DMPK RNAi agent disclosed herein is conjugated to a targeting group or targeting ligand that directs the RNAi agent to skeletal muscle cells, thereby enabling the RNAi agent to be selectively internalized via receptor-mediated endocytosis or other mechanisms.

[0039] In another aspect, this disclosure relates to a method for inhibiting DMPK gene expression in a subject, the method comprising administering to the subject an amount of DMPK RNAi agent capable of inhibiting DMPK gene expression, wherein the DMPK RNAi agent comprises a sense strand and an antisense strand, and wherein the antisense strand comprises a sequence of any antisense nucleotide sequence in Tables 2, 3, or 5.4. In a further aspect, this disclosure relates to a method for treating (including prophylactic, interventional, or preventative treatment) a disease or symptom that can be at least partially improved by reducing DMPK protein levels (and more specifically, reducing levels of mutant DMPK-CUG protein), the method comprising administering to a subject in need of such treatment a DMPK RNAi agent comprising an antisense strand, the antisense strand comprising a sequence of any sequence in Tables 2, 3, or 5.4. Pharmaceutical compositions for such methods are also described.

[0040] In some embodiments, the DMPK RNAi agent is linked to one or more linker groups or other non-nucleotide groups or compounds (e.g., pharmacokinetic / pharmacodynamic (PK / PD) modulators). PK / PD modulators can increase the circulation time of the conjugated drug and / or increase the activity of the RNAi agent by improving cell receptor binding, improving cellular uptake, and other mechanisms. Examples of PK / PD modulators suitable for use with the DMPK RNAi agents disclosed herein can be found in Tables 6.5 and 6.7 herein.

[0041] In some embodiments, the DMPK RNAi agent is conjugated to a target group, a linker group, a PK / PD regulator, and / or another non-nucleotide group. In some embodiments, the DMPK RNAi agent is conjugated to both a target group and a PK / PD regulator.

[0042] The use of DMPK RNAi agents provides a method for therapeutic (including prophylactic or interventional) treatment of diseases or conditions that can be at least partially improved by reducing DMPK protein levels, specifically including reducing levels of mutant DMPK-CUG proteins. This document describes compositions for delivering DMPK RNAi agents to the skeletal muscle cells of a subject. In some embodiments, the DMPK RNAi agents disclosed herein are capable of reducing DMPK gene expression in the paraspinal, facial, trunk, abdominal, and limb muscle tissues of a subject, such as in the triceps, biceps, quadriceps, pectoralis major, gastrocnemius, soleus, masseter, EDL (extensor digitorum longus), TA (tibialis anterior), trapezius, and / or diaphragm.

[0043] In some embodiments, this document discloses methods for treating (including prophylactic or interventional treatment) a pathological condition (such as myotonic dystrophy type 1) at least partially mediated by DMPK expression, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising a sequence of any one of the sequences in Tables 2, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0044] In some embodiments, this document discloses methods for treating (including prophylactic or interventional treatment) a pathological state at least partially mediated by DMPK expression, wherein the method comprises administering to a subject a therapeutically effective amount of a DMPK RNAi agent comprising a sense strand and an antisense strand, the sense strand comprising a sequence of any of the sequences in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5 of this document, and the antisense strand comprising a sequence of any of the sequences in Table 3 or Table 5.4.

[0045] In some embodiments, this document discloses a method for inhibiting DMPK gene expression, wherein the method includes administering a DMPK RNAi agent to a subject, the DMPK RNAi agent comprising a sense strand and an antisense strand, the sense strand comprising a nucleotide base sequence of any sequence in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5, and the antisense strand comprising a nucleotide base sequence of any sequence in Table 3 or Table 5.4. In other embodiments, this document discloses a method for inhibiting DMPK gene expression, wherein the method includes administering a DMPK RNAi agent to a subject, the DMPK RNAi agent comprising a sense strand and an antisense strand, the sense strand comprising a modified sequence of any modified sequence in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5, and the antisense strand comprising a modified sequence of any modified sequence in Table 3 or Table 5.4.

[0046] As used herein, the terms “oligonucleotide” and “polynucleotide” refer to polymers of linked nucleosides, which may be modified or unmodified independently.

[0047] As used herein, an "RNAi agent" (also known as an "RNAi trigger") refers to a composition containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of degrading or inhibiting (e.g., under appropriate conditions) the translation of a target messenger RNA (mRNA) mRNA transcript in a sequence-specific manner. As used herein, RNAi agents may act via RNA interference mechanisms (i.e., by interacting with RNA interference pathway machinery in mammalian cells, i.e., by interacting with RNA interference pathway machinery, i.e., by RNA-induced silencing complexes or RISCs)) or via any alternative mechanism or pathway. Although the term RNAi agent as used herein is considered to act primarily via RNA interference mechanisms, the disclosed RNAi agents are not limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein consist of a sense strand and an antisense strand, and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and a substrate. The antisense strand of the RNAi agents described herein is at least partially complementary to the targeted mRNA (i.e., DMPK mRNA). RNAi agents may include one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0048] As used herein, when referring to the expression of a given gene, the terms “silence,” “reduction,” “inhibition,” “downregulation,” or “knockdown” mean that when a cell, cell group, tissue, organ, or subject is treated with the RNAi agent described herein, the expression of the gene is reduced compared to a second cell, cell group, tissue, organ, or subject that has not been treated with the RNAi agent described herein, as measured by the level of RNA transcribed from the gene or the level of polypeptides, proteins, or protein subunits translated from mRNA in the cell, cell group, tissue, organ, or subject in which the gene is transcribed.

[0049] As used herein, the terms “sequence” and “nucleotide sequence” refer to a continuous or sequential sequence of nucleotide bases or nucleotides, represented by consecutive letters using standard nomenclature.

[0050] As used herein, a “base,” “nucleotide base,” or “nucleobase” is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the major purine bases adenine and guanine, and the major pyrimidine bases cytosine, thymine, and uracil. Nucleobases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, hybrid bases, size-extended bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P.ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphorous amide compounds containing modified nucleobases) is known in the art.

[0051] As used herein, the term "nucleotide" has the same meaning as commonly understood in the art and therefore refers to a glycoside comprising a sugar moiety, a base moiety, and a covalently linked group (linking group), such as a phosphate ester nucleoside linking group, a thiophosphate ester nucleoside linking group, or a dithiophosphate ester nucleoside linking group, and encompasses naturally occurring nucleotides such as DNA or RNA, as well as non-naturally occurring nucleotides comprising modified sugar and / or base moieties, which are also referred to herein as nucleotide analogs or modified nucleotides. In this document, a mononucleotide may be referred to as a monomer or unit.

[0052] As used herein, and unless otherwise stated, the term "complementary," when used to describe a first nucleobase or nucleotide sequence (e.g., a sense strand or targeting mRNA) relative to a second nucleobase or nucleotide sequence (e.g., an antisense strand or single-stranded antisense oligonucleotide of an RNAi agent), refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize with an oligonucleotide comprising the second nucleotide sequence under certain standard conditions (forming base-pair hydrogen bonds under mammalian physiological conditions (or other suitable in vivo or in vitro conditions)) and form a double-stranded or double-helix structure. Those skilled in the art will be able to select the set of conditions most suitable for hybridization testing. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include native or modified nucleotides or nucleotide mimics, at least to the extent that the hybridization requirements described above are met. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and are identical to A for determining identity or complementarity.

[0053] As used herein, "perfect complementarity" or "complete complementarity" means that in a pair of hybridized nucleobase or nucleotide sequences, all (100%) bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may include all or part of the first or second nucleotide sequence.

[0054] As used herein, "partial complementarity" means that in a pair of hybridized nucleobase or nucleotide sequences, at least 70% but not all of the bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may include all or part of the first or second nucleotide sequence.

[0055] As used herein, “substantially complementary” means that in a pair of hybridized nucleobase or nucleotide sequences, at least 85% but not all of the bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may include all or part of the first or second nucleotide sequence.

[0056] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used to refer to the nucleobase or nucleotide matching between the sense and antisense strands of the RNAi agent or between the antisense strand of the RNAi agent and the sequence of the DMPK mRNA.

[0057] As used herein, the terms "substantially identical" or "substantially identical," when applied to nucleic acid sequences, mean that a nucleotide sequence (or a portion thereof) has at least about 85% sequence identity or more compared to a reference sequence, for example, at least 90%, at least 95%, or at least 99% identity. The percentage of sequence identity is determined by comparing two best-aligned sequences on a comparison window. The percentage is calculated by determining the number of positions in both sequences where the same type of nucleic acid bases appear to generate a number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to generate the percentage of sequence identity. The invention disclosed herein includes nucleotide sequences substantially identical to the nucleotide sequences disclosed herein.

[0058] As used herein, the terms “individual,” “patient,” and “subject” are used interchangeably to refer to a member of any animal species, including but not limited to birds, humans, and other primates, as well as other mammals, including commercially relevant mammals or animal models such as mice, rats, monkeys, cattle, pigs, horses, sheep, cats, and dogs. Preferably, the subject is a human.

[0059] As used herein, the terms “treat” and “treatment” refer to methods or procedures taken to reduce or alleviate the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treatment” and “treatment” can include preventive, managerial, preventative, or interventional treatments, and / or suppressing or reducing the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0060] As used herein, the phrase “introduced into cells” when referring to RNAi agents means the functional delivery of the RNAi agent into cells. The phrase “functional delivery” means the delivery of the RNAi agent into cells in a manner that enables the RNAi agent to have the intended biological activity (e.g., sequence-specific inhibition of gene expression).

[0061] Unless otherwise stated, the symbols used in this article are as follows. This means that any one or more groups can be attached to it, which is consistent with the scope of the invention described herein.

[0062] As used herein, the term "isomer" refers to compounds that have the same molecular formula but differ in the bonding properties or order of their atoms, or in the spatial arrangement of their atoms. Isomers with different spatial arrangements of atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," and mirror-image stereoisomers that cannot be overlapped are called "enantiomers," or sometimes optical isomers. A carbon atom bonded to four different substituents is called a "chiral center."

[0063] As used herein, unless specifically identified in the structure as having a particular conformation, for each structure having an asymmetric center and thus producing enantiomers, diastereomers, or other stereoisomer configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as individual stereoisomers.

[0064] As used in the claims herein, the phrase “consisting of” excludes any element, step, or component not specified in the claims. When used in the claims herein, the phrase “consisting substantially of” limits the scope of the claims to the specified materials or steps and those materials or steps that do not substantially affect the essential and novel features (one or more features) of the claimed invention.

[0065] It will be readily understood and appreciated by those skilled in the art that, depending on the environment in which the compound or composition is situated, the compounds and compositions disclosed herein may have certain atoms in a protonated or deprotonated state (e.g., N, O, or S atoms). Therefore, as used herein, the structures disclosed herein contemplate that certain functional groups (e.g., OH, SH, or NH) may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their protonation state (e.g., pH) based on the environment, which will be readily understood by those skilled in the art. Accordingly, compounds described herein having unstable protons or basic atoms should also be understood to represent salt forms of the corresponding compounds. The compounds described herein may be in the form of free acids, free bases, or salts. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of this invention. Typical pharmaceutically acceptable salts of the disclosed DMPK RNAi agents are present in the form of sodium salts.

[0066] As used herein, the terms “link” or “combination” refer to the connection between two compounds or molecules via covalent bonds. Unless otherwise stated, the terms “link” and “combination” as used herein may refer to a connection between a first compound and a second compound, regardless of the presence or absence of any intermediate atoms or groups of atoms.

[0067] As used herein, the term "including" is used to mean "including but not limited to" and is interchangeable with the phrase "including but not limited to". The term "or" is used to mean "and / or" and is interchangeable with the term "and / or" unless the context clearly indicates otherwise.

[0068] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While the invention may be practiced or tested using methods and materials similar or equivalent to those described herein, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In the event of conflict, this specification, including the definitions, shall prevail. Furthermore, materials, methods, and examples are illustrative only and are not intended to be limiting.

[0069] Where numerical values ​​are explicitly stated, it should be understood that values ​​of approximately the same quantity or amount as the stated values ​​are also within the scope of this disclosure. Where combinations are disclosed, each sub-combination of the elements of that combination is also specifically disclosed and within the scope of this disclosure. Conversely, where different elements or groups of elements are disclosed individually, their combinations are also disclosed. Where any element disclosed has multiple alternatives, instances where each of those alternatives is excluded individually or in any combination with other alternatives are also disclosed; more than one element may be disclosed with such exclusions, and combinations of all elements with such exclusions are disclosed.

[0070] Other objects, features, aspects, and advantages of the invention will become apparent from the following detailed description, drawings, and claims.

[0071] Brief description of the attached figures

[0072] Figure 1 Show normal splicing conditions and forward and reverse primer sets designed for flanking exons of exons known to be excluded or included under normal transcript splicing conditions, as well as transcripts known to be misspliced ​​in the presence of DMPK-CUG transcript accumulation with mutations in the nucleus, as described in Example 17.

[0073] Figure 2 The expression of hDMPK transcripts in mice under various administration conditions is shown according to the description in Example 18.

[0074] Figure 3 The relative missplicing of mCacna1 in mice under various administration conditions is shown according to the description in Example 18.

[0075] Figure 4 The relative missplicing of mLdb3 in mice under various administration conditions is shown according to the description in Example 18.

[0076] Figure 5 The relative missplicing of mMbnl1 in mice under various administration conditions is shown according to the description in Example 18.

[0077] Figure 6 The relative missplicing of mAtp2a1 in mice under various administration conditions is shown according to the description in Example 18.

[0078] Detailed description

[0079] This document describes RNAi agents (referred to herein as DMPK RNAi agents or DMPK RNAi triggers) for inhibiting the expression of the DMPK gene. Each DMPK RNAi agent comprises a sense strand and an antisense strand. The sense strand can be 15 to 49 nucleotides in length. The antisense strand can each be 17 to 49 nucleotides in length. The sense and antisense strands can be the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 17 to 27 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 19-21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides long. In some embodiments, the sense strand of the RNAi agent is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 36, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides long. In some embodiments, the antisense strand of the RNAi agent is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some implementations, the double-stranded RNAi agent has a double strand of about 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides in length.

[0080] Examples of nucleotide sequences for forming DMPK RNAi agents are provided in Tables 2, 3, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5. Examples of RNAi agent duplexes comprising the sense and antisense sequences from Tables 2, 3, 4.1, 4.2, 4.3, 4.4, 4.5, and 4.6 are shown in Tables 5.1, 5.2, 5.3, 5.4, 5.6, and 5.7.

[0081] In some implementations, a perfectly, substantially or partially complementary region (sometimes referred to as a “double-stranded region”) between the sense and antisense strands is 12-26 nucleotides long (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) and is located at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 imperfectly, substantially or partially complementary nucleotides).

[0082] The sense strand of the DMPK RNAi agent described herein comprises at least 12 consecutive nucleotides and has at least 85% identity with a core extension sequence (also referred to herein as the “core extension” or “core sequence”) of the same number of nucleotides in the DMPK mRNA. In some embodiments, the sense strand core extension sequence is 100% (perfectly) complementary to or at least about 85% (substantially) complementary to the core extension sequence in the antisense strand, and thus the sense strand core extension sequence is typically perfectly identical or at least about 85% identical to a nucleotide sequence of the same length present in the DMPK mRNA target (sometimes referred to, for example, the target sequence). In some embodiments, the length of the sense strand core extension is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the sense strand core extension is 17 nucleotides. In some embodiments, the length of the sense strand core extension is 19 nucleotides. In some embodiments, the length of the sense strand core extension is 21 nucleotides.

[0083] The antisense strand of the DMPK RNAi agent described herein comprises at least 17 consecutive nucleotides, having at least 85% complementarity to a core extension of the same number of nucleotides in the DMPK mRNA, and in some embodiments, having at least 85% complementarity to a core extension of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core extension is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the DMPK mRNA target (e.g., the target sequence). In some embodiments, the length of the antisense strand core extension is 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the antisense strand core extension is 19 nucleotides. In some embodiments, the length of the antisense strand core extension is 17 nucleotides. In some embodiments, the length of the antisense strand core extension is 21 nucleotides. In some embodiments, the length of the antisense strand core extension is 23 nucleotides. The sense strand core extension sequence may be the same length as the corresponding antisense core sequence, or it may be of different lengths.

[0084] The sense and antisense strands of the DMPK RNAi agent are annealed to form a doublet. The sense and antisense strands of the DMPK RNAi agent may be partially, substantially, or completely complementary to each other. Within the complementary doublet region, the sense core extension sequence is at least 85% or 100% complementary to the antisense core extension sequence. In some embodiments, the sense core extension sequence comprises a sequence of at least 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides, which is at least 85% or 100% complementary to the corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense core extension sequence (i.e., the sense and antisense core extension sequences of the DMPK RNAi agent have regions of at least 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides, with at least 85% or 100% base pairing).

[0085] In some implementations, the antisense strand of the DMPK RNAi agent disclosed herein differs from any antisense strand sequence in Tables 2, 3, or 5.4 by 0, 1, 2, or 3 nucleotides.

[0086] In some embodiments, the sense strand of the DMPK RNAi agent disclosed herein differs from any sense strand sequence in Table 2 or Table 4.1 or Table 4.2 or Table 4.3 or Table 4.4 or Table 4.5 or Table 4.6 or Table 5.4 or Table 5.5 by 0, 1, 2 or 3 nucleotides.

[0087] In some implementations, the sense strand and / or antisense strand may optionally and independently contain 1, 2, 3, 4, 5, or 6 additional nucleotides (extensions) at the 3' end, 5' end, or both the 3' and 5' ends of the core extension sequence. If present, the additional antisense strand nucleotides may be complementary to or not complementary to the corresponding sequence in the DMPK mRNA. If present, the additional sense strand nucleotides may be identical to or different from the corresponding sequence in the DMPK mRNA. If present, the additional antisense strand nucleotides may be complementary to or not complementary to the additional nucleotides of the corresponding sense strand, if present.

[0088] As used herein, the extensions at the 5' and / or 3' ends of the core extension sequence of the sense strand and / or the core extension sequence of the antisense strand contain 1, 2, 3, 4, 5, or 6 nucleotides. The extended nucleotides on the sense strand may be complementary or non-complementary to the corresponding nucleotides in the antisense strand (whether core extension sequence nucleotides or extended nucleotides). Conversely, the extended nucleotides on the antisense strand may be complementary or non-complementary to the corresponding nucleotides in the sense strand (whether core extension sequence nucleotides or extended nucleotides). In some embodiments, both the sense and antisense strands of the RNAi agent contain 3' and 5' extensions. In some embodiments, one or more 3' extended nucleotides of one strand pair with one or more 5' extended nucleotide bases of the other strand. In other embodiments, one or more 3' extended nucleotides of one strand do not pair with one or more 5' extended nucleotide bases of the other strand. In some embodiments, the DMPK RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extended nucleotides are unpaired and form overhangs. As used herein, "protruding end" refers to an extension of one or more unpaired nucleotides at the end of the sense or antisense strand that does not form part of the hybrid or double-stranded portion of the RNAi agent disclosed herein.

[0089] In some embodiments, the DMPK RNAi agent comprises a 3' extended antisense strand having a length of 1, 2, 3, 4, 5, or 6 nucleotides. In other embodiments, the DMPK RNAi agent comprises a 3' extended antisense strand having a length of 1, 2, or 3 nucleotides. In some embodiments, one or more of the antisense extended nucleotides comprise a nucleotide complementary to the corresponding DMPK mRNA sequence. In some embodiments, one or more of the antisense extended nucleotides comprise a nucleotide not complementary to the corresponding DMPK mRNA sequence.

[0090] In some embodiments, the DMPK RNAi agent comprises a 3' extended sense strand having a length of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, one or more of the sense strand extending nucleotides comprise adenosine, uridine, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to nucleotides in the DMPK mRNA sequence. In some embodiments, the 3' sense strand extension comprises, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (all listed from 5' to 3').

[0091] The sense strand may have a 3' extension and / or a 5' extension. In some embodiments, the DMPK RNAi agent comprises a sense strand with a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides contain nucleotides that correspond to or are identical to nucleotides in the DMPK mRNA sequence. In some embodiments, the 5' extension of the sense strand is one of, but not limited to, the following sequences: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (all listed from 5' to 3').

[0092] Examples of sequences for forming DMPK RNAi agents are provided in Tables 2, 3, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, and 5.4. In some embodiments, the antisense strand of the DMPK RNAi agent comprises a sequence from any of the sequences in Table 2 or 3. In some embodiments, the antisense strand of the DMPK RNAi agent comprises or consists of any of the modified sequences in Table 3 or Table 5.4. In some embodiments, the antisense strand of the DMPK RNAi agent comprises nucleotides (from 5' to 3') 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 from any of the sequences in Tables 2, 3, or 5.4. In some embodiments, the sense strand of the DMPK RNAi agent comprises a sequence from any of the sequences in Tables 2, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, or 5.4. In some embodiments, the sense strand of the DMPK RNAi agent comprises nucleotides (from the 5' end to the 3' end) of any sequence in Tables 2, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, or 5.4 in sequences 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21. In some embodiments, the sense strand of the DMPK RNAi agent comprises or consists of any of the modified sequences in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0093] In some embodiments, the sense and antisense strands of the RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agent described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, both ends of the RNAi agent form blunt ends. In some embodiments, neither end of the RNAi agent is blunt. As used herein, "blunt end" refers to such an end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs).

[0094] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, a frayed end refers to an end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands form a pair (i.e., no overhang) but are not complementary (i.e., a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form an overhang. The unpaired nucleotides can be on either the sense or antisense strand, thus creating a 3' or 5' overhang. In some implementations, the RNAi agent comprises: blunt ends and staggered ends, blunt ends and 5' protrusions, blunt ends and 3' protrusions, staggered ends and 5' protrusions, staggered ends and 3' protrusions, two 5' protrusions, two 3' protrusions, 5' protrusions and 3' protrusions, two staggered ends, or two blunt ends. Typically, when present, the protrusions are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0095] The DMPK RNAi agents disclosed herein may also include one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the DMPK RNAi agent are modified nucleotides. The DMPK RNAi agents disclosed herein may also include one or more modified nucleoside links, such as one or more phosphate thioester links or phosphate dithioester links. In some embodiments, the DMPK RNAi agent comprises one or more modified nucleotides and one or more modified nucleoside links. In some embodiments, the 2'-modified nucleotide is bound to the modified nucleoside link.

[0096] In some embodiments, DMPK RNAi agents are prepared or provided in the form of salts, mixed salts, or free acids. In some embodiments, DMPK RNAi agents are prepared in the form of sodium salts. These forms, well known in the art, are within the scope of the invention disclosed herein.

[0097] Modified nucleotides

[0098] When used in various oligonucleotide constructs, the modified nucleotides can maintain the activity of the compounds in cells, while increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans after administration of the oligonucleotide construct.

[0099] In some embodiments, the DMPK RNAi agent comprises one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2’-hydroxynucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimics, baseless nucleotides, 2’-modified nucleotides, reverse nucleotides, nucleotides containing modified nucleosides, bridging nucleotides, peptide nucleic acids (PNAs), 2’,3’-seco nucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3’-O-methoxy (2’ nucleoside-linked) nucleotides, 2’-F-arabinonucleotides, 5’-methyl-2’-fluoronucleotides, morpholinonucleotides, vinylphosphonates, and cyclopropylphosphonates. 2'-Modified nucleotides (i.e., nucleotides with a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also known as 2'-methoxynucleotides), 2'-fluoronucleotides (also known as 2'-deoxy-2'-fluoronucleotides), 2'-deoxynucleotides, 2'-methoxyethyl (2'-O-(2-methoxyethyl)) nucleotides (also known as 2'-MOE), 2'-aminonucleotides, and 2'-alkylnucleotides. Not all positions of a given compound need to be uniformly modified. Instead, more than one modification can be introduced into a single DMPK RNAi agent or even into a single nucleotide. Sense and antisense strands of DMPK RNAi agents can be synthesized and / or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide. Various modified nucleotides are well known in the art and described in the prior art.

[0100] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propargyluracil, or 5-propargylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine (hypoxanthine), xanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothyronine, etc. Adenine, 2-thiocytosine, 5-halogenated uracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymidine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaaadenine, 7-deazoguanine, 7-deazoadenine, 3-deazoguanine and 3-deazoadenine.

[0101] In some embodiments, the 5' and / or 3' ends of the antisense strand may include a baseless residue (Ab), which may also be referred to as a "baseless site" or "baseless nucleotide." A baseless residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1' position of the sugar moiety. In some embodiments, the baseless residue may be internally placed within the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand may include one or more additional baseless residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, the baseless (deoxyribose) residue may be replaced with a ribitol (baseless ribose) residue.

[0102] In some embodiments, all or substantially all of the nucleotides in the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all nucleotides are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides that are ribonucleotides (i.e., unmodified ribonucleotides) in both the sense and antisense strands. As used herein, a sense strand in which substantially all nucleotides are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the sense strand. As used herein, an antisense strand in which substantially all nucleotides are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the antisense strand. In some embodiments, one or more nucleotides in the RNAi agent are unmodified ribonucleotides. The chemical structures of some modified nucleotides are listed in Table 6.1 of this document.

[0103] Modified nucleoside linkages

[0104] In some implementations, one or more nucleotides of the DMPK RNAi agent are linked by non-standard ligation or main chain (i.e., modified nucleotide ligation or modified main chain). Modifications to the internucleotide linker or backbone include, but are not limited to, phosphorothioate groups (referred to herein as lowercase "s"), chiral phosphorothioates, thiophosphates, dithiophosphates, triphosphates, aminoalkyl-triphosphates, diphosphorothioates, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphites, phosphoramidites (e.g., 3'-aminophosphatidyl, aminoalkylphosphatidyl, or thiocarbonophosphatidyl), thiocarbonoalkyl-phosphonates, thiocarbonoalkylphosphotriesters, morpholino linkages, borophosphates with normal 3'-5' linkages, 2'-5' linked borophosphate analogs, or borophosphates with reverse polarity, wherein adjacent nucleoside unit pairs are linked in a 3'-5' to 5'-3' or 2'-5' to 5'-2' manner. In some embodiments, the modified internucleotide linker or backbone lacks a phosphorus atom. Phosphorus-deficient internucleotide linkages include, but are not limited to, short-chain alkyl or cycloalkyl interglycosylation linkages, mixed heteroatom and alkyl or cycloalkyl interglycosylation linkages, or one or more short-chain heteroatom or heterocyclic interglycosylation linkages. In some embodiments, the modified internucleotide backbone includes, but is not limited to, siloxane backbones, sulfide backbones, sulfone backbones, formylacetyl and thioformylacetyl backbones, methyleneformylacetyl and thioformylacetyl backbones, olefin-containing backbones, aminosulfonate backbones, methyleneimino and methylenehydrazine backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0105] In some embodiments, the sense strand of the DMPK RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphate-thioester links, and the antisense strand of the DMPK RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphate-thioester links, or the sense and antisense strands may independently contain 1, 2, 3, 4, 5, or 6 phosphate-thioester links. In some embodiments, the sense strand of the DMPK RNAi agent may contain 1, 2, 3, or 4 phosphate-thioester links, and the antisense strand of the DMPK RNAi agent may contain 1, 2, 3, or 4 phosphate-thioester links, or the sense and antisense strands may independently contain 1, 2, 3, or 4 phosphate-thioester links.

[0106] In some embodiments, the sense strand of the DMPK RNAi agent comprises at least two phosphate-thioester nucleoside links. In some embodiments, the phosphate-thioester nucleoside links are located between nucleotides 1-3 from the 3' end of the sense strand. In some embodiments, one phosphate-thioester nucleoside link is located at the 5' end of the sense strand nucleotide sequence, and another phosphate-thioester link is located at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphate-thioester nucleoside links are located at the 5' end of the sense strand, and another phosphate-thioester link is located at the 3' end of the sense strand. In some embodiments, the sense strand does not include any phosphate-thioester nucleoside links between nucleotides, but comprises one, two, or three phosphate-thioester links between terminal nucleotides at the 5' and 3' ends, and optionally between reverse abase-free terminal caps. In some embodiments, the targeting ligand is linked to the sense strand via phosphate-thioester links.

[0107] In some embodiments, the antisense strand of the DMPK RNAi agent comprises four phosphate-thioester nucleoside links. In some embodiments, the four phosphate-thioester nucleoside links are located between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, three phosphate-thioester nucleoside links are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphate-thioester nucleoside link is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the DMPK RNAi agent comprises at least three or four phosphate-thioester nucleoside links in the antisense strand.

[0108] End-capped residues or part

[0109] In some embodiments, the sense chain may include one or more capping residues or portions, sometimes referred to in the art as a “cap,” “terminal cap,” or “capping residue.” As used herein, a “capping residue” is a nonnucleotide compound or other portion capable of binding to one or more ends of the nucleotide sequence of an RNAi agent disclosed herein. Capping residues may provide certain beneficial properties to the RNAi agent, such as, in some cases, protection against exonuclease degradation. In some embodiments, an inverse abase-free residue (invAb) (also referred to as an “inverse abase-free site”) is added as a capping residue (see Table 6.1). (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16; U.S. Patent No. 5,998,203). Capping residues are generally known in the art and include, for example, inverse abase-free residues and carbon chains, such as terminal C3H7 (propyl), C6H… 13 (Hexyl) or C 12 H 25 (Dodecyl) group. In some embodiments, the capping residue is present at the 5' end, 3' end, or both of the 5' and 3' ends of the sense chain. In some embodiments, the 5' end and / or 3' end of the sense chain may include more than one inverted abasic deoxyribose moiety as a capping residue.

[0110] In some embodiments, one or more inverse abase residues (invAbs) are added to the 3' end of the sense strand. In some embodiments, one or more inverse abase residues (invAbs) are added to the 5' end of the sense strand. In some embodiments, one or more inverse abase residues or inverse abase sites are inserted between the nucleotide sequence of the sense strand of the targeting ligand and the RNAi agent. In some embodiments, one or more inverse abase residues or inverse abase sites are inserted between the nucleotide sequence of the sense strand of the PK / PD regulator and the RNAi agent. In some embodiments, including one or more inverse abase residues or inverse abase sites at or near the end of the sense strand of the RNAi agent allows for enhanced activity or other desired properties of the RNAi agent.

[0111] In some embodiments, one or more inverse abase residues (invAbs) are added to the 5' end of the sense strand. In some embodiments, one or more inverse abase residues may be inserted between the nucleotide sequence of the target ligand and the sense strand of the RNAi agent. Inverse abase residues may be linked by phosphate esters, thiophosphate esters (e.g., (invAbs)s shown herein), or other nucleoside linkages. In some embodiments, including one or more inverse abase residues at or near the end of the sense strand of the RNAi agent may allow for enhanced activity or other desired properties of the RNAi agent. In some embodiments, inverse abase (deoxyribose) residues may be replaced by inverse ribitol (abase-free ribose) residues. In some embodiments, the 3' end of the core extension sequence of the antisense strand or the 3' end of the antisense strand sequence may include inverse abase residues. The chemical structures of inverse abase deoxyribose residues are shown in Table 6.1 below.

[0112] DMPK RNAi agent

[0113] The DMPK RNAi agent implementation schemes disclosed herein are designed to target a specific location on the DMPK gene (i.e., a specific location on the DMPK gene transcript). As defined herein, the antisense strand sequence is designed to target the DMPK gene at a specific location on the gene such that the 5' nucleotide of the antisense strand is aligned with the location on the gene 21 nucleotides downstream (towards the 3' end) from the location on the gene when it pairs with a gene base. For example, as shown in Tables 1 and 2 herein, the antisense strand sequence designed to target the DMPK gene at position 820 requires that the 5' nucleotide of the antisense strand be aligned with position 840 of the DMPK gene when it pairs with a gene base.

[0114] As provided herein, for the specific embodiments disclosed herein, the DMPK RNAi agent does not require the nucleotides at position 1 (5'→3') of the antisense strand to be complementary to the gene, provided that the antisense strand and the gene have at least 85% complementarity over a core extension sequence of at least 16 consecutive nucleotides (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementarity). For example, for the DMPK RNAi agents disclosed herein designed to target position 820 of the DMPK gene, the 5' nucleotide of the antisense strand of the DMPK RNAi agent must be aligned with position 840 of the gene; however, the 5' nucleotide of the antisense strand may, but is not required to, be complementary to position 840 of the DMPK gene, provided that the antisense strand and the gene have at least 85% complementarity over a core extension sequence of at least 16 consecutive nucleotides (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity). Among other things, as shown in the various examples disclosed herein, the specific binding site of the antisense strand of the DMPK RNAi agent to the gene (e.g., whether the DMPK RNAi agent is designed to target the DMPK gene at position 820, at position 865, or at some other position) is important for the level of repression achieved by the DMPK RNAi agent.

[0115] In some embodiments, the DMPK RNAi agents disclosed herein target the DMPK gene at or near the DMPK sequences shown in Table 1. In some embodiments, the antisense strand of the DMPK RNAi agents disclosed herein includes a core extension sequence that is wholly, substantially, or at least partially complementary to the DMPK 19mer target sequences disclosed in Table 1.

[0116] Table 1. DMPK 19-mer mRNA target sequence (derived from Homo sapiens DM1 protein kinase (DMPK), transcript variant 1, GenBank NM_001081563.2)

[0117]

[0118]

[0119]

[0120] Human DM1 protein kinase (DMPK), transcript variant 1, GenBank NM_001081563.2, gene transcript (3243 bases):

[0121]

[0122]

[0123] In some embodiments, the DMPK RNAi agent includes an antisense strand, wherein position 19 (5′→3′) of the antisense strand is capable of forming a base pair with position 1 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the DMPK RNAi agent includes an antisense strand, wherein position 1 (5′→3′) of the antisense strand is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in Table 1.

[0124] In some embodiments, the DMPK RNAi agent includes an antisense strand, wherein position 2 (5′→3′) of the antisense strand is capable of forming a base pair with position 18 of the 19-mer target sequences disclosed in Table 1. In some embodiments, the DMPK RNAi agent includes an antisense strand, wherein positions 2 to 18 (5′→3′) of the antisense strand are capable of forming a base pair with each of the corresponding complementary bases at positions 18 to 2 of the 19-mer target sequences disclosed in Table 1.

[0125] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from the 5′ end to the 3′ end) may be perfectly complementary to the DMPK gene or may not be complementary to the DMPK gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5′ end to the 3′ end) is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5′ end to the 3′ end) forms an A:U or U:A base pair with the sense strand.

[0126] In some embodiments, the antisense strand of the DMPK RNAi agent comprises a sequence of nucleotides (from 5′ to 3′) 2-18 or 2-19 of any antisense strand sequence in Tables 2, 3, or 5.4. In some embodiments, the sense strand of the DMPK RNAi agent comprises a sequence of nucleotides (from 5′ to 3′) 1-17, 1-18, or 2-18 of any sense strand sequence in Tables 2 or 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0127] In some embodiments, the DMPK RNAi agent comprises (i) an antisense strand containing nucleotides (from 5′ to 3′) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3; and (ii) a sense strand containing nucleotides (from 5′ to 3′) 1-17 or 1-18 of any sense strand sequence in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4 or 5.5.

[0128] In some implementations, the DMPK RNAi agent includes the core 19-mer nucleotide sequence shown in Table 2 below.

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142] The sense and antisense strands of DMPK RNAi agents, which contain or consist of the nucleotide sequences in Table 2, can be modified or unmodified nucleotides. In some embodiments, DMPK RNAi agents having sense and antisense strand sequences that contain or consist of any of the nucleotide sequences in Table 2 are all or substantially modified nucleotides.

[0143] In some embodiments, the antisense strand of the DMPK RNAi agent disclosed herein differs from any antisense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the DMPK RNAi agent disclosed herein differs from any sense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides.

[0144] As used herein, each N listed in the sequences disclosed in Table 2 may be independently selected from any and all nucleotides (including those present on both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleotides complementary to the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleotides non-complementary to the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleotides as the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleotides different from the N nucleotides at the corresponding position on the other strand.

[0145] Tables 3 and 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5 provide the sense and antisense strands of certain modified DMPK RNAi agents. Table 3 provides the antisense strand of modified DMPK RNAi agents and its underlying unmodified nucleotide sequence. Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5 provide the sense strand of modified DMPK RNAi agents and its underlying unmodified nucleotide sequence. In the formation of DMPK RNAi agents, each nucleotide in each of the underlying nucleotide sequences listed in Tables 3 and 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5, as well as in Table 2 above, can be a modified nucleotide.

[0146] The DMPK RNAi agent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing a sequence listed in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5 may hybridize with any antisense strand containing a sequence listed in Table 2, Table 3, or Table 5.4, provided that the two sequences have at least 85% complementary regions over 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences.

[0147] In some implementations, the antisense strand of the DMPK RNAi agent contains the nucleotide sequence of any of the sequences in Tables 2, 3, or 5.4.

[0148] In some embodiments, the DMPK RNAi agent comprises or consists of a duplex of sense and antisense nucleobase sequences having any of the sequences in Tables 2, 3, or 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0149] Table 3 provides examples of antisense strands containing modified nucleotides. Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5 provide examples of sense strands containing modified nucleotides.

[0150] As used in Tables 3 and 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4 and 5.5, the following symbols are used to represent modified nucleotides, targeting groups and linking groups:

[0151] A = Adenosine-3′-phosphate

[0152] C = Cytidine-3′-phosphate

[0153] G = Guanosine-3′-phosphate

[0154] U = uridine-3′-phosphate

[0155] I = Inosine-3′-phosphate

[0156] α = 2′-O-methyladenosine-3′-phosphate

[0157] as = 2′-O-methyladenosine-3′-thiophosphate

[0158] c = 2′-O-methylcytidine-3′-phosphate

[0159] cs=2′-O-methylcytidine-3′-thiophosphate

[0160] g = 2′-O-methylguanosine-3′-phosphate

[0161] gs = 2′-O-methylguanosine-3′-thiophosphate

[0162] i = 2′-O-methylinosine-3′-phosphate

[0163] is = 2′-O-methylinosine-3′-thiophosphate

[0164] t = 2′-O-methyl-5-methyluridine-3′-phosphate

[0165] ts = 2′-O-methyl-5-methyluridine-3′-thiophosphate

[0166] u = 2′-O-methyluridine-3′-phosphate

[0167] us = 2′-O-methyluridine-3′-thiophosphate

[0168] Af = 2′-fluoroadenosine-3′-phosphate

[0169] Afs = 2′-Fluoroadenosine-3′-Thiophosphate

[0170] Cf = 2′-Fluorocytidine-3′-phosphate

[0171] Cfs = 2′-Fluorocytidine-3′-Thiophosphate

[0172] Gf = 2′-Fluoroguanosine-3′-phosphate

[0173] Gfs = 2′-Fluoroguanosine-3′-Thiophosphate

[0174] Tf = 2′-fluoro-5′-methyluridine-3′-phosphate

[0175] Tfs = 2′-Fluoro-5′-methyluridine-3′-thiophosphate

[0176] Uf = 2′-fluorouridine-3′-phosphate

[0177] Ufs = 2′-fluorouridine-3′-thiophosphate

[0178] dT = 2′-deoxythymidine-3′-phosphate

[0179] A UNA =2′,3′-open-chain adenosine-3′-phosphate

[0180] A UNA s = 2′,3′-open-chain adenosine-3′-thiophosphate

[0181] C UNA =2′,3′-Cyclocytidine-3′-phosphate

[0182] C UNA s=2′,3′-open-cytidine-3′-thiophosphate

[0183] G UNA =2′,3′-Octopyguanosine-3′-phosphate

[0184] G UNA s=2′,3′-open-ring guanosine-3′-thiophosphate

[0185] U UNA =2′,3′-open-ring uridine-3′-phosphate

[0186] U UNA s = 2′,3′-open-ring uridine-3′-thiophosphate

[0187] a_2N = 2′-O-methyl-2-aminoadenosine-3′-phosphate, see Table 6.1

[0188] a_2Ns = 2′-O-methyl-2-aminoadenosine-3′-thiophosphate, see Table 6.1

[0189] (invAb) = inverse abase-free deoxynucleotide-5′-phosphate ester, see Table 6.1

[0190] (invAb)s = inverse abasic deoxynucleotide-5′-thiophosphate, see Table 6.1

[0191] s = thiophosphate linker

[0192] ss = dithiophosphate linker

[0193] p = terminal phosphate ester (during synthesis)

[0194] vpdN = Vinylphosphonate deoxynucleotide

[0195] cPrpa = 5′-cyclopropylphosphonate-2′-O-methyladenosine-3′-phosphate (see Table 6.1)

[0196] cPrpas = 5′-cyclopropylphosphonate-2′-O-methyladenosine-3′-thiophosphate (see Table 6.1)

[0197] cPrpu = 5′-cyclopropylphosphonate-2′-O-methyluridine-3′-phosphate (see Table 6.1)

[0198] cPrpus = 5′-cyclopropylphosphonate-2′-O-methyluridine-3′-thiophosphate (see Table 6.1)

[0199] aAlk = 2′-O-propargyl adenosine-3′-phosphate, see Table 6.1

[0200] aAlks = 2′-O-propargyl adenosine-3′-thiophosphate, see Table 6.1

[0201] cAlk = 2′-O-propargylcytidine-3′-phosphate, see Table 6.1

[0202] cAlks = 2′-O-propargylcytidine-3′-thiophosphate, see Table 6.1

[0203] gAlk = 2′-O-propargylguanosine-3′-phosphate, see Table 6.1

[0204] gAlks = 2′-O-propargylguanosine-3′-thiophosphate, see Table 6.1

[0205] tAlk = 2′-O-propynyl-5-methyluridine-3′-phosphate, see Table 6.1

[0206] tAlks = 2′-O-propargyl-5-methyluridine-3′-thiophosphate, see Table 6.1

[0207] uAlk = 2′-O-propargyluridine-3′-phosphate, see Table 6.1

[0208] uAlks = 2′-O-propargyluridine-3′-thiophosphate, see Table 6.1

[0209] (Alk-SS-C6) = See Table 6.1

[0210] (C6-SS-Alk) = See Table 6.1

[0211] (C6-SS-C6) = See Table 6.1

[0212] (6-SS-6) = See Table 6.1

[0213] (C6-SS-Alk-Me) = See Table 6.1

[0214] (NH2-C6) = See Table 6.1

[0215] (Alk-cyHex) = See Table 6.1

[0216] (Alk-cyHex)s = See Table 6.1

[0217] avb6-pep1 = αvβ6 peptide 1, see Table 6.3

[0218] As will be readily understood by those skilled in the art, unless otherwise indicated by the sequence (e.g., via a thiophosphate linking "s" or via a dithiophosphate linking "ss"), nucleotide monomers in oligonucleotides are linked to each other by 5′-3′-phosphodiester bonds. As will be readily understood by those skilled in the art, this includes thiophosphate links as shown in the modified nucleotide sequences disclosed herein, replacing the phosphodiester links typically present in oligonucleotides. Furthermore, it will be readily understood by those skilled in the art that the terminal nucleotide at the 3′ end of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at the corresponding 3′ site of the given monomer, rather than a phosphate moiety. Moreover, as will be readily understood and appreciated by those skilled in the art, although the thiophosphate chemical structures shown herein generally display an anion on the sulfur atom, the invention disclosed herein includes all thiophosphate tautomers (e.g., where the sulfur atom has a double bond and the anion is located on the oxygen atom). Unless otherwise expressly stated herein, the understanding of those skilled in the art is used in describing the DMPK RNAi agents and DMPK RNAi agent compositions disclosed herein.

[0219] The chemical structures provided in Tables 6.1, 6.2, and 6.3 below include some examples of targeting and linking groups for use with the DMPK RNAi agents disclosed herein. Each sense strand and / or antisense strand may have any of the targeting or linking groups listed herein, as well as other targeting or linking groups, which are conjugated to the 5' and / or 3' ends of the sequence.

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231] As shown in Table 4.1 above, in some embodiments, the exemplary DMPK RNAi agent sense strand nucleotide sequences are further shown to include reactive linker groups at both the 5' and 3' ends of the sense strand. For example, some DMPK RNAi agent sense strand sequences shown in Table 4.1 above have a (NH2-C6) linker group at the 5' end of the nucleotide sequence. Similarly, some DMPK RNAi agent nucleotide sequences shown in Table 4.1 above have a (C6-SS-C6) linker group near the 3' end of the nucleotide sequence. Such reactive linker groups are positioned to facilitate the linking of targeting ligands, targeting groups, and / or PK / PD modulators to the DMPK RNAi agents disclosed herein. Linkage or conjugation reactions are well known in the art and provide a means of forming a covalent link between two molecules or reactants. Suitable conjugation reactions for use within the scope of the invention herein include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, and click cycloaddition reactions.

[0232] In some embodiments, the targeting ligand can be synthesized as a tetrafluorophenyl (TFP) ester, which reacts with an amino group (e.g., NH2-C6) to attach the targeting ligand to the DMPK RNAi agent disclosed herein. In some embodiments, the targeting ligand is synthesized as an azide, which can be conjugated to a propargyl or DBCO group via, for example, a click chemical cycloaddition reaction.

[0233] Additionally, the nucleotide sequences shown in Table 4.1 above are synthesized with dT nucleotides at the 3' end of the sense strand, followed by a (3'→5') linker (e.g., C6-SS-C6). Suitable and commercially available dT-loaded resins can be used to initiate the synthesis of the oligonucleotide chains. The (C6-SS-C6) linker can then be used in some embodiments to facilitate the attachment to additional components (e.g., PK / PD modulators or one or more targeting ligands). As described herein, C6-SS-C6 is first reduced, thereby cleaving the dT residues from the molecule, among other things, which can then facilitate the conjugation of the desired PK / PD modulator. Table 4.2 below shows the nucleotide sequences identified in Table 4.1 above, but does not include the 3'-terminal dT nucleotides, as these correctly reflect the sequences of the DMPK RNAi agents disclosed herein when delivered in vivo.

[0234] In addition, Table 4.3 below shows the nucleotide sequences identified in Table 4.1 above, but without terminal linkers (i.e., nucleotide sequences with only end caps).

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241]

[0242]

[0243]

[0244]

[0245]

[0246]

[0247]

[0248]

[0249] As discussed herein, in some embodiments, one or more targeting ligands and / or PK / PD modulators are linked or conjugated to the RNAi agent. In some embodiments, the targeting ligand (or targeting group) and / or PK / PD modulator are linked to the 5' end of the sense strand, the 3' end of the sense strand, and / or one or more internal nucleotides. The synthesis of the sense strand and / or antisense strand can be designed to make reactive groups readily available to facilitate linkage with additional components, such as the targeting ligand or PK / PD modulator. Table 4.5 below depicts the sense strand of the DMPK RNAi agent disclosed in Table 4.1 above after linkage with one or more targeting ligands and / or PK / PD modulators (collectively referred to as Z below). The pharmacological portion is linked to the DMPK RNAi agent using the reaction described in Example 1 below. After conjugation with the targeting ligand, the linking group can have a (NH-C6), (NH-C6)s, or (C6-S) structure, each of which is shown in Table 6.1 below.

[0250] Table 4.5. Sense sequences of DMPK RNAi agents showing the positions of the targeting ligand and / or PK / PD modulator (Z = pharmacological portion (e.g., targeting ligand, targeting group, and / or PK / PD modulator)).

[0251]

[0252]

[0253]

[0254]

[0255] Table 4.6 shows the sense sequences of DMPK RNAi agents where the targeting ligand is attached to the 5' end of the sense strand and the PK / PD regulator is attached to the 3' end of the sense strand. (TL = targeting ligand; PK = PK / PD regulator)

[0256]

[0257]

[0258]

[0259]

[0260] The DMPK RNAi agent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing a sequence listed in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5 may hybridize with any antisense strand containing a sequence listed in Table 2, Table 3, or Table 5.4, provided that the two sequences have at least 85% complementary regions over 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences.

[0261] In some embodiments, the antisense strand of the DMPK RNAi agent disclosed herein differs from any antisense strand sequence in Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the DMPK RNAi agent disclosed herein differs from any sense strand sequence in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5 by 0, 1, 2, or 3 nucleotides.

[0262] In some embodiments, the DMPK RNAi agent antisense strand comprises the nucleotide sequence of any sequence in Table 2 or Table 3. In some embodiments, the DMPK RNAi agent antisense strand comprises the nucleotides (from 5' to 3') 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any sequence in Table 2, Table 3, or Table 5.4. In some embodiments, the DMPK RNAi agent antisense strand comprises or consists of modified sequences of any modified sequences in Table 3.

[0263] In some implementations, the sense strand of the DMPK RNAi agent comprises a nucleotide sequence of any of the sequences in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5. In some implementations, the sense strand of the DMPK RNAi agent comprises nucleotides (from 5' to 3') of any sequence in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5 in the sequence 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24. In some implementations, the sense strand of the DMPK RNAi agent comprises or consists of a modified sequence of any of the modified sequences in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0264] For the DMPK RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) may be perfectly complementary to the DMPK gene or may not be complementary to the DMPK gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) is U, A, or dT (or a modified form thereof). In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end to the 3' end) forms an A:U or U:A base pair with the sense strand.

[0265] In some embodiments, the antisense strand of the DMPK RNAi agent comprises nucleotides (from 5' to 3') 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3. In some embodiments, the sense strand of the DMPK RNAi agent comprises nucleotides (from 5' to 3') 1-17 or 1-18 of any sense strand sequence in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5.

[0266] In some implementations, the DMPK RNAi agent comprises (i) an antisense strand containing a sequence of 2-18 or 2-19 nucleotides (from 5' to 3') of any antisense strand sequence in Table 2 or Table 3, and (ii) a sense strand containing a sequence of 1-17 or 1-18 nucleotides (from 5' to 3') of any sense strand sequence in Table 2 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, or 5.4.

[0267] A sense strand containing sequences listed in Table 2 or Table 4 may hybridize with any antisense strand containing sequences listed in Table 2 or Table 3, provided that the two sequences have at least 85% complementarity over 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences. In some embodiments, the DMPK RNAi agent has a sense strand consisting of a modified sequence of any of the modified sequences in Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, or 5.5, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3 or Table 5.4. Some representative sequence pairings are exemplified by the duplex ID Nos shown in Tables 5.1, 5.2, 5.3, 5.4, 5.6, and 5.7.

[0268] In some embodiments, the DMPK RNAi agent comprises, is composed of, or is substantially composed of a duplex represented by any of the duplex ID Nos presented herein. In some embodiments, the DMPK RNAi agent comprises sense and antisense nucleotide sequences of any duplex represented by any of the duplex ID Nos presented herein. In some embodiments, the DMPK RNAi agent comprises sense and antisense nucleotide sequences of any duplex represented by any of the duplex ID Nos presented herein, as well as a targeting ligand, a targeting group, and / or a linker group, wherein the targeting ligand, targeting group, and / or linker group are covalently linked (i.e., conjugated) to the sense or antisense strand. In some embodiments, the DMPK RNAi agent includes sense and antisense modified nucleotide sequences of any duplex ID No. presented herein. In some embodiments, the DMPK RNAi agent comprises sense and antisense modified nucleotide sequences of any duplex ID No. presented herein, as well as a targeting ligand, a targeting group, and / or a linker group, wherein the targeting ligand, targeting group, and / or linker group are covalently linked to the sense or antisense strand.

[0269] In some embodiments, the DMPK RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any antisense / sense duplex as shown in Table 2 or Table 5.1 (or Table 5.2, Table 5.3, Table 5.4, Table 5.6, or Table 5.7), and further comprises a targeting group.

[0270] In some embodiments, the DMPK RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense / sense duplex as specified in Tables 5.1, 5.2, 5.3, 5.4, 5.6, or 5.7, and contains one or more linker groups selected from the following: (NH2-C6), (C6-NH2), (C6-SS-C6), or (6-SS-6), each as defined in Table 6.1.

[0271] In some implementations, the DMPK RNAi agent comprises an antisense strand and a sense strand, which are modified nucleotide sequences having any of the antisense strand and / or sense strand nucleotide sequences in Table 3 or Tables 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4 or 5.5.

[0272] In some embodiments, the DMPK RNAi agent comprises an antisense strand and a sense strand, having a modified nucleotide sequence having a nucleotide sequence of either the antisense strand and / or the sense strand of any duplex of Table 5.1 (or Tables 5.2, 5.3, 5.4, 5.6 or 5.7), and also contains an integrin targeting group.

[0273] In some implementations, the DMPK RNAi agent comprises, is composed of, or is substantially composed of any of the duplexes in Table 5.1 (or Tables 5.2, 5.3, 5.4, 5.6, or 5.7).

[0274] Table 5.1. DMPK RNAi agent duplexes with corresponding sense and antisense strand ID numbers

[0275]

[0276]

[0277]

[0278]

[0279] Table 5.2. DMPK RNAi agent duplexes with corresponding sense and antisense strand IDs and sequence IDs of modified and unmodified nucleotide sequences.

[0280]

[0281]

[0282]

[0283]

[0284]

[0285] *The modified SS sequence is taken from Table 4.2 (showing the unadded terminal dT for manufacturability).

[0286] Table 5.3. DMPK RNAi double strands with corresponding sense and antisense strand IDs at the target location on the DMPK gene.

[0287]

[0288]

[0289]

[0290]

[0291]

[0292]

[0293] As described herein, in some embodiments, the sense and antisense nucleotide sequences in duplex form can be linked to certain targeting ligands and / or PK / PD modulators. Some exemplary targeting ligands and / or PK / PD modulators we have linked are shown in Table 5.4 below, which shows fully conjugated duplexes with the “AC” identifier prefix.

[0294]

[0295]

[0296]

[0297]

[0298]

[0299]

[0300] Table 5.6. DMPK RNAi agent duplexes with corresponding sense and antisense strand IDs, as well as sequence IDs for modified and unmodified nucleotide sequences. (Targeting ligand conjugates are shown.)

[0301]

[0302]

[0303] Table 5.7. ID numbers of DMPK RNAi conjugate duplexes targeting locations on the DMPK gene

[0304]

[0305]

[0306]

[0307] In some embodiments, DMPK RNAi agents are prepared or provided in the form of salts, mixed salts, free acids, or free bases. In some embodiments, DMPK RNAi agents are prepared in the form of pharmaceutically acceptable salts. In some embodiments, DMPK RNAi agents are prepared in the form of pharmaceutically acceptable sodium salts. These forms, well-known in the art, are within the scope of the invention disclosed herein. The RNAi agents described herein, when delivered to cells expressing DMPK genes, inhibit or knock down the expression of one or more DMPK genes in vivo and / or in vitro.

[0308] In some embodiments, the compositions described herein comprise a combination or mixture of at least two DMPK RNAi agents with different sequences. In some embodiments, the two or more DMPK RNAi agents are each separately and independently linked to a target group. In some embodiments, the two or more DMPK RNAi agents are each linked to a target group comprising or consisting of a target ligand. In some embodiments, the two or more DMPK RNAi agents are each linked to a target group.

[0309] Targeting groups, linking groups, and delivery mediators

[0310] In some embodiments, the DMPK RNAi agent contains or is conjugated with one or more nonnucleotide groups, including but not limited to targeting groups, linker groups, pharmacokinetic / pharmacodynamic (PK / PD) modulators, delivery polymers, or delivery mediators. Nonnucleotide groups can enhance the targeting, delivery, or attachment of the RNAi agent. Examples of linker groups are provided in Table 6.1, and examples of targeting groups or targeting ligands are provided in Tables 6.2 and 6.3. The nonnucleotide group can be covalently linked to the 3' and / or 5' end of either the sense strand or the antisense strand. In some embodiments, the DMPK RNAi agent contains a nonnucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the nonnucleotide group is linked to the 5' end of the sense strand of the DMPK RNAi agent. The nonnucleotide group can be linked to the RNAi agent directly or indirectly via a linker / connector group. In some embodiments, the nonnucleotide group is linked to the RNAi agent via an unstable, cleavable, or reversible bond or linker.

[0311] In some embodiments, the nonnucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate it is linked to, thereby improving the cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, the nonnucleotide group enhances the endocytosis of the RNAi agent.

[0312] Targeting groups or ligands enhance the pharmacokinetic or biodistribution properties of conjugates or RNAi agents linked to them, thereby improving cell-specific (and in some cases organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugates or RNAi agents. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have a higher valence state toward their target. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules. In some embodiments, a linker (e.g., a PEG linker or one, two, or three base-free and / or ribitol (base-free ribose) residues that may serve as linkers in some cases) is used to connect the targeting group to the RNAi agent.

[0313] The DMPK RNAi agents described herein can be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5'- and / or 3'- ends. These reactive groups can then be used to attach the target moiety using methods typical of the art.

[0314] For example, in some embodiments, the DMPK RNAi agent synthesis disclosed herein has an NH2-C6 group (represented as (NH2-C6) in the modified sequence herein) at the 5' end of the sense strand of the RNAi agent. The terminal amino group can then be reacted with, for example, a group containing a targeting ligand to form a conjugate. In some embodiments, the DMPK RNAi agent synthesis disclosed herein has one or more alkynyl groups at the 5' end of the sense strand of the RNAi agent. The terminal alkynyl group can then be reacted with, for example, a group containing a targeting ligand to form a conjugate.

[0315] In some embodiments, the RNAi agent comprises a targeting group containing two or more targeting ligands. In some embodiments, the targeting group may be conjugated to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the targeting group may be conjugated to an internal nucleotide on the RNAi agent. In some embodiments, the targeting group may consist of two targeting ligands linked together, referred to as a "bident" targeting group. In some embodiments, the targeting group may consist of three targeting ligands linked together, referred to as a "tridentent" targeting group. In some embodiments, the targeting group may consist of four targeting ligands linked together, referred to as a "tetradentent" targeting group.

[0316] In some embodiments, the use of a targeting ligand facilitates cell-specific targeting to cells that have a desired receptor on their respective surfaces, and binding to the targeting ligand can facilitate the entry of a therapeutic agent (e.g., an RNAi agent) linked to it into cells, such as skeletal muscle cells. The targeting ligand can be monomeric or monovalent (e.g., having a single targeting moiety) or polymeric or multivalent (e.g., having multiple targeting moieties). The targeting group can be attached to the 3' and / or 5' ends of the RNAi oligonucleotide using methods known in the art.

[0317] Embodiments of this disclosure include pharmaceutical compositions for in vivo delivery of DMPK RNAi agents to skeletal muscle cells. Such pharmaceutical compositions may include, for example, DMPK RNAi agents conjugated to a targeting group comprising a targeting ligand.

[0318] In some implementations, the DMPK RNAi agents disclosed herein can reduce DMPK gene expression in one or more of the following tissues: paraspinal, facial, trunk, abdominal, and limb muscle tissues, including, for example, the triceps, biceps, quadriceps, pectoral, gastrocnemius, soleus, masseter, EDL (extensor digitorum longus), TA (tibialis anterior), trapezius, and / or diaphragm.

[0319] In some embodiments, a linker group is conjugated to an RNAi agent. The linker group facilitates covalently linking the agent to a targeting group, a pharmacokinetic modulator, a delivery polymer, or a delivery medium. The linker group may be attached to the 3' and / or 5' end of the sense or antisense strand of the RNAi agent. In some embodiments, the linker group is attached to the sense strand of the RNAi agent. In some embodiments, the linker group is conjugated to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linker group is conjugated to the 5' end of the sense strand of the RNAi agent. Examples of linker groups include, but are not limited to: C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6) and alkynes, alkyl groups, baseless residues / nucleotides, amino acids, triyne functionalized groups, ribitols, and / or PEG groups.

[0320] A linker or connecting group is a connection between two atoms that links a chemical group (e.g., an RNAi agent) or segment of interest to another chemical group (e.g., a targeting group, a drug kinetic modulator, or a delivery polymer) or segment of interest via one or more covalent bonds. Unstable connections contain unstable bonds. Connections may optionally include spacer groups that increase the distance between the two connected atoms. Spacer groups may further add flexibility and / or length to the connection. Spacer groups include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, areneyl groups, and arynyl groups; each group may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the above list is not intended to limit the scope of the description.

[0321] In some embodiments, the target group is linked to the DMPK RNAi agent without the use of an additional adapter. In some embodiments, the target group is designed to have readily available adapters to facilitate linkage with the DMPK RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, the same adapter can be used to link the two or more RNAi agents to their respective target groups. In some embodiments, when two or more RNAi agents are included in the composition, different adapters can be used to link the two or more RNAi agents to their respective target groups.

[0322] Any DMPK RNAi agent nucleotide sequence listed in Tables 2, 3, and 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5, whether modified or unmodified, may contain a 3' and / or 5' targeting group, a linker group, and / or a pharmacokinetic modulator. Any DMPK RNAi agent sequence listed in Tables 3, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 5.4, and 5.5, or otherwise described herein, containing a 3' or 5' targeting group, a linker group, or a pharmacokinetic modulator, may alternatively not contain a 3' or 5' targeting group, a linker group, or a PK / PD modulator, or may contain different 3' or 5' targeting groups, linkers, or PK / PD modulators, including but not limited to those shown in Tables 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, or 6.7. Any DMPK RNAi agent duplex listed in Table 5.1 (or Tables 5.2, 5.3, 5.4, 5.6, or 5.7), whether modified or unmodified, may further include a targeting group, a linker group, or a PK / PD regulator, including but not limited to those shown in Tables 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, or 6.7, and in some embodiments, the targeting group, linker group, and / or PK / PD regulator may be attached to the 3' or 5' end of the sense or antisense strand of the DMPK RNAi agent duplex.

[0323] Table 6.1 provides examples of some modified nucleotides and linking groups.

[0324] Table 6.1. Structures of various modified nucleotides and linking groups

[0325]

[0326]

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333] Alternatively, other linking groups known in the art may be used. In many cases, the linking group is commercially available, or alternatively, it may be incorporated into a commercially available nucleotide phosphorylamide.

[0334] In some implementations, the targeting ligand is linked to the DMPK RNAi agent disclosed herein. Examples of some targeting ligands are provided in Table 6.2:

[0335] Table 6.2. Structures representing the target ligands

[0336]

[0337]

[0338]

[0339]

[0340]

[0341]

[0342] Or its pharmaceutically acceptable salt, wherein This indicates the linking point with the DMPK RNAi agent. In some embodiments, PEG or other linker groups are incorporated between the RNAi agent and the targeting ligand.

[0343] In some embodiments, the targeting groups in Table 6.2 are synthesized with reactive groups, thereby allowing efficient coupling of targeting ligands comprising one or more targeting groups to the RNAi agents disclosed herein. In some embodiments, the targeting groups identified in Table 6.2 are synthesized as azides to facilitate conjugation with RNAi agents.

[0344] In some implementations, the DMPK RNAi agent is linked to a targeting ligand having the structure disclosed in Table 6.3:

[0345] Table 6.3. Exemplary targeting ligands for use in combination with DMPK RNAi agents.

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352]

[0353] Or its pharmaceutically acceptable salt, wherein This indicates the connection point with the DMPK RNAi agent.

[0354] In some embodiments, a delivery medium can be used to deliver RNAi agents to cells or tissues. The delivery medium is a compound that improves the delivery of RNAi agents to cells or tissues. The delivery medium may include, but is not limited to, polymers such as amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines.

[0355] In some embodiments, RNAi agents may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems in the art that can be used for nucleic acid delivery. RNAi agents may also be chemically conjugated to targeting groups, lipids (including but not limited to cholesterol and its derivatives), encapsulated in nanoparticles, liposomes, micelles, conjugated to polymers or DPCs (see, for example, WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169 and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, all incorporated herein by reference), via iontophoresis, or by incorporating other delivery media or systems available in the art, such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or protein carriers. In some embodiments, RNAi agents may be conjugated to antibodies having affinity for skeletal muscle cells. In some implementations, the RNAi agent may be linked to a targeting ligand having affinity for skeletal muscle cells or receptors present on skeletal muscle cells.

[0356] Pharmacokinetic / Pharmacodynamic (PK / PD) modulators

[0357] In some embodiments, the DMPK RNAi agents disclosed herein are further or alternatively linked to one or more PK / PD modulators. Table 6.4 provides examples of certain pharmacokinetic / pharmacodynamic (PK / PD) modulators suitable for use with the RNAi agents disclosed herein. In Table 6.4, the PK / PD modulators are obtained from commercial suppliers as shown, or otherwise synthesized using commercially available materials:

[0358] Table 6.4. Exemplary PK / PD modulator compounds.

[0359]

[0360]

[0361]

[0362]

[0363]

[0364]

[0365]

[0366] In some implementations, the PK / PD modulators in Table 6.4, after conjugation with a DMPK RNAi agent, have the following structures as shown in Table 6.5:

[0367] Table 6.5. Exemplary PK / PD modulators conjugated with DMPK RNAi agents.

[0368]

[0369]

[0370]

[0371]

[0372]

[0373]

[0374]

[0375] Or its pharmaceutically acceptable salt, wherein This indicates the connection point with the DMPK RNAi agent.

[0376] In other embodiments, the PK / PD modulator that can be conjugated to the DMPK RNAi agent described herein can be selected from the PK / PD modulators in Table 6.6:

[0377] Table 6.6: Exemplary PK / PD modulators for conjugation with DMPK RNAi agents (compound numbers appear before structures)

[0378]

[0379]

[0380]

[0381]

[0382]

[0383]

[0384]

[0385]

[0386]

[0387]

[0388]

[0389]

[0390] In some implementations, the PK / PD modulators in Table 6.6, after conjugation with a DMPK RNAi agent, have the following structures as shown in Table 6.7:

[0391] Table 6.7. Exemplary PK / PD modulators for use with DMPK RNAi agents

[0392]

[0393]

[0394]

[0395]

[0396]

[0397]

[0398]

[0399]

[0400]

[0401]

[0402]

[0403] Where R Z This refers to the remainder of the DMPK RNAi agent.

[0404] In some embodiments, the DMPK RNAi agent may comprise one or more PK / PD modulators. In some embodiments, the DMPK RNAi agents disclosed herein comprise one, two, three, four, five, six, seven or more PK / PD modulators.

[0405] PK / PD modulators can be conjugated to DMPK RNAi agents using any method known in the art. Many PK / PD modulators, including several mentioned above, are commercially available. In some embodiments, such as several of the compounds shown in Table 6.4, the PK / PD modulator may include a maleimide moiety and react with an RNAi agent containing a disulfide bond to form an RNAi agent containing the PK / PD modulator. The disulfide bond can be reduced and added to the maleimide via a Michael addition reaction. Exemplary reaction schemes are shown below:

[0406]

[0407] Where R ZZ It contains RNAi agents, and This indicates the connection point with any suitable group known in the art. In some examples of the reaction schemes described above, Attached to alkyl groups, such as hexyl (C6H) 13 ).

[0408] In some embodiments, the PK / PD modifier precursor may contain a sulfone moiety and be reactive with a disulfide bond. An exemplary reaction scheme is shown below:

[0409]

[0410] Where R ZZ It contains RNAi agents, and This indicates the connection point with any suitable group known in the art. In some examples of the reaction schemes described above, Attached to alkyl groups, such as hexyl (C6H) 13 ).

[0411] In some embodiments, the PK / PD modulator precursor may comprise an azide moiety and react with an RNAi agent comprising an alkyne to form a compound comprising a PK / PD modulator conjugated with the RNAi agent, according to the following general reaction scheme:

[0412]

[0413] Where R ZZ It contains RNAi agents.

[0414] In some embodiments, the PK / PD modulator precursor may comprise an alkyne moiety and react with an RNAi agent containing a disulfide bond to form a compound comprising a PK / PD modulator conjugated with the RNAi agent, according to the following general reaction scheme:

[0415]

[0416] RZZ contains an RNAi agent, and This indicates the connection point with any suitable group known in the art. In some examples of the reaction schemes described above, Attached to alkyl groups, such as hexyl (C6H) 13 ).

[0417] In some embodiments, the PK / PD regulator can be conjugated to the 5' end of the sense or antisense strand, the 3' end of the sense or antisense strand, or an internal nucleotide of the DMPK RNAi agent. In some embodiments, the DMPK RNAi agent is synthesized with a disulfide bond-containing portion at the 3' end of the sense strand, and the PK / PD regulator can be conjugated to the 3' end of the sense strand using the general synthetic protocol described above.

[0418] Pharmaceutical compositions and formulations

[0419] The DMPK RNAi agents disclosed herein can be formulated as pharmaceutical compositions or formulations (also referred to herein as "medicines"). In some embodiments, the pharmaceutical composition comprises at least one DMPK RNAi agent. These pharmaceutical compositions are particularly suitable for inhibiting the expression of DMPK mRNA in target cells, cell populations, tissues, or organisms. The pharmaceutical compositions can be used to treat subjects suffering from a disease, condition, or symptom that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. In some embodiments, the disease to be treated is myotonic dystrophy type 1. The pharmaceutical compositions can be used to treat subjects at risk of developing a disease or symptom that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. In one embodiment, the method comprises administering a DMPK RNAi agent, as described herein, linked to a target ligand, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including mediators, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition comprising the DMPK RNAi agent to form a pharmaceutical formulation or medicine suitable for in vivo delivery to a subject (including humans).

[0420] In some embodiments, one or more of the described DMPKRNAi agents, in pharmaceutically acceptable carriers or diluents, are administered to a mammal. In some embodiments, the mammal is a human. Pharmaceutical compositions comprising one or more DMPKRNAi agents can be administered in a variety of ways, depending on whether local or systemic treatment is required. Administration can be, but is not limited to, intravenous, intra-arterial, subcutaneous (SQ), intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration.

[0421] Pharmaceutical compositions including DMPK RNAi agents and the methods disclosed herein reduce the level of target mRNA in cells, cell populations, tissues, organs, or subjects, including by administering a therapeutically effective amount of the DMPK RNAi agent described herein to the subject, thereby inhibiting the expression of DMPK mRNA in the subject. In some embodiments, the subject has been previously identified or diagnosed with a disease or condition at least partially mediated by DMPK expression. In some embodiments, the subject has been previously identified or diagnosed with a condition, disease, or condition that would benefit from reduced levels of one or more DMPK proteins in cells or tissues, and more specifically, a mutation that reduces the level of DMPK-CUG protein. In some embodiments, the subject has been previously diagnosed with one or more skeletal muscle diseases such as myotonic dystrophy type 1. In some embodiments, the subject has been experiencing symptoms associated with one or more skeletal muscle diseases.

[0422] In some embodiments, the pharmaceutical compositions described, including DMPK RNAi agents, are used to treat or manage the clinical presentation of subjects who would benefit from DMPK expression inhibition. In some embodiments, one or more pharmaceutical compositions are administered to a subject requiring such treatment in a therapeutically effective or preventatively effective amount. In some embodiments, administration of any of the disclosed DMPK RNAi agents can be used to reduce the number, severity, and / or frequency of symptoms of disease in a subject.

[0423] The pharmaceutical compositions described, including DMPK RNAi agents, can be used to treat one or more symptoms in subjects suffering from a disease or condition that would benefit from reduced or suppressed DMPK mRNA expression. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions including DMPK RNAi agents is administered to the subject to treat the symptoms.

[0424] The route of administration is the path through which a DMPK RNAi agent comes into contact with the body. Methods of administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are generally well known in the art and can be applied to the administration of the compositions described herein. The DMPK RNAi agents disclosed herein can be administered via any suitable route in a formulation appropriately tailored to that route. In some embodiments, the pharmaceutical composition can be administered by injection, such as intravenous, intramuscular, intradermal, subcutaneous, intra-articular, or intraperitoneal administration, or topically.

[0425] The pharmaceutical compositions comprising DMPK RNAi agents described herein can be delivered to cells, cell populations, tissues, or subjects using oligonucleotide delivery technologies known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vivo or in vitro) can be modified to suit the use of the compositions described herein. For example, delivery can be local (e.g., direct injection, implantation, or topical), systemic, or via subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, percutaneous, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the composition is administered via subcutaneous injection, intramuscular injection, or intravenous administration.

[0426] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0427] In some embodiments, pharmaceutical formulations comprising the DMPK RNAi agents disclosed herein, suitable for SQ or IV administration, can be prepared in aqueous sodium phosphate buffer (e.g., the DMPK RNAi agent is formulated in water with 0.5 mM sodium monohydrogen phosphate and 0.5 mM sodium dihydrogen phosphate). In some embodiments, pharmaceutical formulations comprising the DMPK RNAi agents disclosed herein, suitable for SQ or IV administration, can be prepared in water for injection.

[0428] As used herein, a pharmaceutical composition or drug comprises a pharmacologically effective amount of at least one of the said therapeutic compounds and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, such as a DMPK RNAi agent) intentionally included in a drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dose. Excipients may serve to a) facilitate handling of the drug delivery system during manufacturing, b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API, c) facilitate product identification, and / or d) enhance any other property of the overall safety and effectiveness of the API during storage or use. Pharmaceutically acceptable excipients may or may not be inert substances.

[0429] Excipients include, but are not limited to: absorption enhancers, anti-adhesion agents, defoamers, antioxidants, adhesives, buffers, carriers, coating agents, colors, delivery enhancers, delivery polymers, detergents, dextran, glucose, diluents, disintegrants, emulsifiers, synergists, fillers, flavoring agents, flow aids, humectants, lubricants, oils, polymers, preservatives, brine, salt, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, tension modifiers, mediators, water repellents, and wetting agents.

[0430] Suitable pharmaceutical compositions for injection include sterile aqueous solutions (wherein being water-soluble) or dispersions and sterile powders for immediate preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, antibacterial water, etc. ELTM (BASF, Parsippany, NJ) or phosphate-buffered saline (PBS). It should be stable under manufacturing and storage conditions and should be protected against microbial contamination (e.g., bacteria and fungi). The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate flowability can be maintained by using a coating such as lecithin, by maintaining the desired particle size in the dispersed state, and by using surfactants. In many cases, it is preferable to include isotonic agents in the composition, such as sugars, polyols such as mannitol, sorbitol, and sodium chloride. Extended absorption of the injectable composition can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin.

[0431] Sterile injectable solutions can be prepared as needed by incorporating the active compound in the desired amount with one or more of the ingredients listed above into a suitable solvent, followed by filtration and sterilization. Typically, dispersions are prepared by incorporating the active compound into a sterile medium containing a basic dispersion medium and any other desired ingredients from the list above. In the case of sterile powders used to prepare sterile injectable solutions, preparation methods include vacuum drying and freeze-drying, which produce a powder of the active ingredient plus any additional desired ingredients from its previously sterile filtered solution.

[0432] Formulations suitable for intra-articular administration can be in the form of sterile aqueous formulations of the drug, which can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposome formulations or biodegradable polymer systems can also be used to present the drug for intra-articular and ophthalmic administration.

[0433] The active compound can be prepared with a carrier that protects the compound from rapid elimination from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoester, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in U.S. Patent No. 4,522,811.

[0434] DMPK RNAi agents can be formulated in compositions in dose-unit form to facilitate administration and dosage uniformity. A dose-unit form refers to a physically discrete unit suitable as a unit dose for a subject to be treated; each unit contains a calculated predetermined amount of the active compound to produce the desired therapeutic effect in combination with the desired drug delivery system. The specifications of the dose-unit form of the present invention depend on and are directly influenced by the unique characteristics of the active compound, the therapeutic effect to be achieved, and the inherent limitations in the art of formulating such active compounds into a medicament for treating an individual.

[0435] Pharmaceutical compositions may contain other additional ingredients commonly found in pharmaceutical compositions. Such additional ingredients include, but are not limited to, antipruritic agents, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). Cells, tissues, or isolated organs expressing or containing RNAi agents as defined herein are also considered for use as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeuticly effective amount,” or simply “effective amount,” refers to the amount of RNAi agent that produces a pharmacological, therapeutic, or preventative outcome.

[0436] In some embodiments, the methods disclosed herein further include the step of administering a second therapeutic agent or treatment in addition to administering the RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another DMPK RNAi agent (e.g., a DMPK RNAi agent targeting a different sequence within a DMPK target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0437] Typically, the effective dose of the DMPK RNAi agents disclosed herein will be in the range of about 0.0001 to about 20 mg / kg body weight per dose, for example, about 0.5 to about 10 mg / kg body weight per dose. The dosage and frequency of administration (e.g., daily, every two weeks, weekly, monthly, quarterly, or semi-annually) may depend on variables such as the patient's overall health condition, the relative biological efficacy of the delivered compound, the pharmaceutical formulation, the presence and type of excipients present in the formulation, and the route of administration. Similarly, it should be understood that the initial dose may be increased above the aforementioned upper limits to rapidly achieve the desired blood or tissue levels, or the initial dose may be less than the optimal dose.

[0438] In some embodiments, the effective amount of the DMPK RNAi agent disclosed herein may be administered at a fixed dose of about 0.0001 mg to about 2,500 mg. In some embodiments, the effective amount of the DMPK RNAi agent disclosed herein may be administered at a fixed dose of about 100 mg, about 150 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 600 mg, about 700 mg, about 750 mg, about 800 mg, about 900 mg, or about 1,000 mg.

[0439] For the purpose of treating a disease or for the formation of a drug or composition for the treatment of a disease, the pharmaceutical compositions described herein, including DMPK RNAi agents, may be combined with excipients or with a second therapeutic agent or treatment (including, but not limited to, second or other RNAi agents, small molecule drugs, antibodies, antibody fragments, peptides and / or aptamers).

[0440] When added to pharmaceutically acceptable excipients or adjuvants, the DMPK RNAi agents can be packaged into kits, containers, packages, or dispensers. For example, the pharmaceutical compositions described herein can be packaged in pre-filled syringes or vials.

[0441] Treatment methods and expression inhibition

[0442] The DMPK RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) who may benefit from the administration of RNAi agents and who suffer from a disease or condition. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) who would benefit from a reduction and / or inhibition of DMPK mRNA expression.

[0443] In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) suffering from diseases or conditions including, but not limited to, myotonic dystrophy type 1, wherein the subject would benefit from a reduction in DMPK protein levels (more specifically, a reduction in the level of mutant DMPK-CUG protein). Treatment of the subject may include therapeutic and / or prophylactic treatment. A therapeutically effective amount of one or more DMPK RNAi agents described herein is administered to the subject. The subject may be a human, a patient, or a human patient. The subject may be an adult, adolescent, child, or infant. Administration of the pharmaceutical compositions described herein may be to humans or animals.

[0444] In some embodiments, the DMPK RNAi agent is used to treat at least one or more symptoms in a subject that are at least partially mediated by DMPK protein levels. A therapeutically effective amount of any one or more DMPK RNAi agents described herein is administered to the subject. In some embodiments, a preventatively effective amount of any one or more RNAi agents described herein is administered to the subject, thereby treating the subject by preventing or suppressing at least one symptom.

[0445] In some embodiments, this disclosure provides methods for treating a disease, symptom, condition, or pathological state in a patient in need, said disease, symptom, condition, or pathological state being at least partially mediated by DMPK gene expression in the subject, said methods comprising administering any of the DMPK RNAi agents described herein to the patient.

[0446] In some embodiments, the DMPK RNAi agent is used to treat or manage a clinical presentation or pathological condition in a subject, wherein the clinical presentation or pathological condition is at least partially mediated by DMPK expression. The subject is administered a therapeutically effective amount of one or more DMPK RNAi agents described herein, or a composition containing a DMPK RNAi agent. In some embodiments, the method includes administering a composition comprising a DMPK RNAi agent described herein to a subject to be treated.

[0447] In some implementations, compared to subjects who had not received the DMPK RNAi agent or who had not received the DMPK RNAi agent, the gene expression level or mRNA level of the DMPK gene in certain skeletal muscle cells of subjects who had received the DMPK RNAi agent was reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. In some implementations, compared to subjects who had not received the DMPK RNAi agent or who had not received the DMPK RNAi agent, subjects who had received the DMPK RNAi agent showed a reduction in DMPK protein levels (including levels of mutant DMPK-CUG protein) of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. Gene expression levels, protein levels, and / or mRNA levels in the subjects may be reduced in the subjects' cells, cell populations, tissues, and / or other fluids. In some embodiments, compared to subjects who had not received the DMPK RNAi agent or who had not received the DMPK RNAi agent, the DMPK mRNA levels in certain skeletal muscle cells or skeletal muscle tissue of subjects who had received the DMPK RNAi agent were reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%. In some embodiments, compared to subjects who had not received the DMPK RNAi agent or who had not received the DMPK RNAi agent, the DMPK protein levels (including mutant DMPK-CUG protein levels) in the skeletal muscle cells and / or skeletal muscle tissue of subjects who had received the DMPK RNAi agent were reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%.

[0448] As noted herein, DMPK protein levels (including levels of mutated DMPK-CUG protein) and / or DMPK mRNA levels in subjects can be reduced in the subjects' cells, cell populations, tissues, blood, and / or other fluids (e.g., serum), as will be understood by those skilled in the art. For example, in some embodiments, subjects who have been given the DMPK RNAi agent have reduced DMPK mRNA levels by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, compared to subjects who have not received the DMPK RNAi agent or subjects who have not received the DMPK RNAi agent. In some implementations, compared to subjects who had not received the DMPK RNAi agent or subjects who had not received the DMPK RNAi agent, subjects who had received the DMPK RNAi agent showed a reduction in DMPK mRNA and / or DMPK protein levels in skeletal muscle cell subsets of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%.

[0449] In some implementations, DMPK RNAi agents can reduce DMPK gene expression in one or more of the following muscle tissues: triceps, biceps, quadriceps, gastrocnemius, soleus, masseter EDL (extensor digitorum longus), TA (tibialis anterior), trapezius, and / or diaphragm.

[0450] The reduction in gene expression, mRNA, and protein levels can be assessed using any method known in the art. For example, the embodiments described herein provide appropriate methods for measuring DMPK protein levels (including levels of mutant DMPK-CUG protein) and DMPK mRNA levels in subjects. A reduction or decrease in DMPK mRNA levels and / or DMPK protein levels (including levels of mutant DMPK-CUG protein) is collectively referred to herein as a reduction or decrease in DMPK or inhibition or reduction of DMPK gene expression. The embodiments described herein illustrate known methods for assessing DMPK gene expression inhibition.

[0451] Cells, tissues, organs and non-human organisms

[0452] Cells, tissues, organs, and non-human organisms comprising at least one DMPK RNAi agent described herein are considered. Such cells, tissues, organs, or non-human organisms are prepared by delivering the RNAi agent to the cells, tissues, organs, or non-human organisms.

[0453] The above-described implementation schemes and projects are now illustrated with the following non-limiting examples. Example

[0454] Example 1. Synthesis of DMPK RNAi Agent

[0455] The DMPK RNAi agent disclosed in this paper was synthesized according to the following:

[0456] A. Synthesis. The sense and antisense strands of the DMPK RNAi agent are synthesized using a solid-phase phosphoramide technique for oligonucleotide synthesis. Depending on scale, the following steps are employed. (Bioautomation) (Bioautomation) or OP Pilot 100 (GE Healthcare). Contains controlled-aperture glass (CPG, or Synthesized on a solid support prepared from Prime Synthesis (Aston, PA, USA). All RNA and 2′-modified RNA phosphoramide were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2′-O-methylphosphoramide used included the following: (5′-O-dimethoxytriphenylmethyl-N 6 -(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, 5′-O-dimethoxytriphenylmethyl-N 4 -(acetyl)-2′-O-methyl-cytidine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, (5′-O-dimethoxytriphenylmethyl-N 2-(isobutyryl)-2′-O-methyl-guanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide and 5′-O-dimethoxytriphenylmethyl-2′-O-methyl-uridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide. 2′-deoxy-2′-fluorophosphamide carries the same protecting group as 2′-O-methylRNAamide. 5′-dimethoxytriphenylmethyl-2′-O-methyl-inosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from Glen Research (Virginia). Reverse-base-free (3′-O-dimethoxytriphenylmethyl-2′-deoxyribose-5′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from ChemGenes (Wilmington, MA, USA). UNA phosphoramide comprises 5′-(4,4′-dimethoxytriphenylmethyl)-N 6 -(benzoyl)-2′,3′-open-ring adenosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, 5′-(4,4′-dimethoxytriphenylmethyl)-N-acetyl-2′,3′-open-ring cytosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, 5′-(4 Cyclopropylphosphonate phosphoramides were synthesized according to International Patent Application Publication No. WO 2017 / 214112 and Erich F. Altenhofer et al., Synthesis of a novel cyclopropylphosphonate nucleotide as a phosphate mimic, Chemical Communications (June 2021) (DOI: 10.1039 / d1cc02328d). The TFA amino-linked phosphoramide is also commercially available (ThermoFisher).

[0457] B. Cleavage and deprotection of oligomers bound to the support. After solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt.% aqueous methylamine and 28% to 31% ammonium hydroxide (Aldrich) at 30°C for 1.5 hours. The solution was evaporated, and the solid residue was redissolved in water (see below).

[0458] C. Purification. Crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13μm column and a Shimadzu LC-8 system. Buffer A consisted of 20mM Tris, 5mM EDTA, pH 9.0, and 20% acetonitrile. Buffer B was the same as buffer A but with the addition of 1.5M sodium chloride. UV traces were recorded at 260 nm. Appropriate fractions were combined and then run on size-resistance HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25fine, with a run buffer of 100mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile or filtered water. Alternatively, the combined fractions were desalted and exchanged for a suitable buffer or solvent system via tangential flow filtration.

[0459] D. Annealing. An RNAi agent was formed by mixing complementary strands in equimolar amounts of RNA solutions (sense and antisense) in 1×PBS (phosphate-buffered saline, 1×, Corning, Cellgro). Some RNAi agents were freeze-dried and stored at -15 to -25°C. The double-strand concentration was determined by measuring the absorbance of the solution in 1×PBS on a UV-Vis spectrometer. The double-strand concentration was then determined by multiplying the absorbance at 260 nm by a conversion factor and a dilution factor. The conversion factor used was 0.050 mg / (mL·cm) or determined experimentally.

[0460] E. Synthesis of SM45-p conjugated with RNAi agents; (S)-3-(4-((14-azido-3,6,9,12-tetraoxotetradecyl)oxy)naphth-1-yl)phenyl)-3-(2-(5-(((4-methylpyridin-2-yl)amino)pentanoylamino)acetamido)propionic acid

[0461]

[0462] Cs₂CO₃ (0.94 g) was added to a DMF solution of compound 1 (0.50 g) under N₂(g) conditions. Compound 2 (0.49 g) was then slowly added dropwise. The reaction was stirred overnight. Approximately 50% conversion to the desired product was then confirmed by LC-MS. The reaction mixture was quenched with NaHCO₃ (10 mL). The product was extracted with EtOAc (3 × 15 mL) and washed with water (3 × 10 mL) and brine (10 mL). The combined organic phases were dried over Na₂SO₄, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and a gradient from hexane to EtOAc (0–70%), with the product eluting at 16% B. The product was concentrated under vacuum to provide a clear oil (0.35 g, yield 45.0%). LC-MS: Calculation of [M+H] + 323.19 m / z, observed 328.38 m / z.

[0463]

[0464] LiOH (0.078 g) was added to a 1:1 THF / water solution of compound 1 (0.35 g) under normal atmosphere at set time. The reaction was stirred at set time until complete conversion was observed by LC-MS. After 1 hour, the reaction mixture was acidified to pH 3 with 6N HCl. The product was extracted with EtOAc (3 × 15 mL). The combined organic phases were dried over Na2SO4, filtered, and concentrated to give a clear, colorless oil (0.32 g, yield 94.9%). No separation was required. LC-MS: Calculation of [M+H] + 309.17 m / z, observed 309.24 m / z.

[0465]

[0466] TBTU (0.058 g) was added to a DMF solution of compounds 1 (0.10 g) and 2 (0.049 g) under ambient conditions, followed by the addition of DIPEA (0.079 mL). The reaction was stirred for 1 hour until complete conversion was observed by LC-MS. The reaction mixture was then quenched with NaHCO3 (10 mL). The product was extracted with EtOAc (3 × 15 mL) and washed with water (3 × 10 mL) and brine (10 mL). The combined organic phases were dried over Na2SO4, filtered, and concentrated. The residue was purified using silica gel as the stationary phase and in a gradient of 20% MeOH (0-70%) from DCM to DCM, with the product eluting at 23% B. The product was concentrated under vacuum to provide a clear, colorless oil (0.088 g, yield 63.6%).

[0467]

[0468] Add 0.22 mL of TFA to a DCM solution of compound 1 (0.088 g). Stir the reaction mixture under ambient conditions. Continue stirring for 5 hours until complete conversion is confirmed by LC-MS. Azeotropically concentrate the reaction mixture under vacuum using PhMe. No separation is required. Concentration yields a clear, colorless oil (0.10 g, 113% yield). LC-MS: Calculate [M+H] + 814.41 m / z, observed 814.63 m / z.

[0469]

[0470] LiOH (0.0078 g) was added to a 1:1 THF / water solution of compound 1 (0.10 g) under normal atmosphere at set time. The reaction was stirred at set time until complete conversion was observed by LC-MS. After 4 hours, the reaction mixture was acidified to pH 3 with 6N HCl. The product was extracted with 20% CF3CH2OH / DCM (3 × 15 mL). The combined organic phases were dried over Na2SO4, filtered, and concentrated to provide a pale yellow solid (0.104 g, yield 119%). LC-MS: Calculation of [M+H] + 800.39 m / z, observed 800.76 m / z.

[0471] F. Synthesis of activated ester skeletal muscle cell receptor peptide (αvβ6 peptide 1 / avb6-pep1) conjugated with RNAi agents

[0472]

[0473]

[0474] Peptide 1 was prepared by modifying Arg-Gly-Asp(tBu)-Leu-Ala-Abu-Leu-Cit-Aib-Leu-Peg5-CO2-2-Cl-Trt resin 1, obtained at a scale of 4.1 mmol as described above, using a standard Fmoc peptide chemistry system on a CS Bio peptide synthesizer with pre-loaded Fmoc-Peg5-CO2H 2-Cl-Trt resin (0.79 mmol / g). Peptide 6-2 was cleaved from the resin to tetrafluorophenyl ester 6-3, and the crude product was used for the next step without purification.

[0475] Final deprotection was performed by treating the crude peptide with a deprotection mixture of TFA / TIS / H2O = 90:5:5 (80 mL) for 6–31.5 hours. The reaction mixture was added dropwise to tert-butyl methyl ether (700 mL), and the resulting precipitate was collected by centrifugation. The precipitate was washed with another tert-butyl methyl ether (500 mL). The residue was purified by RP-HPLC (Phenomenex Gemini C18 250 × 50 mm, 10 μm, 60 mL / min, 30–45% ACN gradient in water containing 0.1% TFA, approximately 1 g crude per run) to give 4.25 g of purified peptide 6–4.

[0476] G. Conjugation of the target ligand. Before or after annealing, the 5′ or 3′ amino-functionalized sense chain is conjugated to the target ligand directly or by using a linker such as an alkyne-functionalized linker (e.g., DBCO or linkers 1-10 as shown in Table 6.1) (which can then be used to facilitate conjugation with the target ligand).

[0477] The following is a general description of the conjugation of activated ester functionalized linkers, including DBCO and linkers 1-10, with single-chain or annealed double chains: The amine-functionalized double chain was dissolved in 90% DMSO / 10% H2O at a concentration of approximately 50-70 mg / mL. 40 equivalents of triethylamine were added, followed by 3 equivalents (L4). The reaction was monitored by RP-HPLC. Once complete, the conjugate was precipitated twice in a 1x phosphate-buffered saline / acetonitrile (1:14) solvent system and dried.

[0478] i. Conjugation of targeted ligands with propargyl linkers

[0479] Before or after annealing, the 5′ or 3′ tridentate alkyne functionalized sense chain is conjugated to the αvβ6 integrin ligand. The following example describes the conjugation of the αvβ6 integrin ligand to the annealed double chain: Stock solutions of 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M copper(II) sulfate pentahydrate (Cu(II)SO4·5H2O), and 2 M sodium ascorbate solution were prepared in deionized water. A 75 mg / mL DMSO solution of the αvβ6 integrin ligand was prepared. 25 μL of 1 M Hepes pH 8.5 buffer was added to a 1.5 mL centrifuge tube containing the trikyne functionalized double chain (3 mg, 75 μL, 40 mg / mL in deionized water, ~15,000 g / mol). After vortexing, 35 μL of DMSO was added and the solution was vortexed again. Add the αvβ6 integrin ligand to the reaction (6 equivalents / double chain, 2 equivalents / alkyne, ~15 μL) and vortex the solution. Check the pH using pH paper and confirm it is ~8. In a separate 1.5 mL centrifuge tube, mix 50 μL of 0.5 M THPTA with 10 μL of 0.5 M Cu(II)SO4·5H2O, vortex, and incubate at room temperature for 5 minutes. After 5 minutes, add the THPTA / Cu solution (7.2 μL, 6 equivalents 5:1 THPTA:Cu) to the reaction vial and vortex. Immediately afterwards, add 2 M ascorbic acid (5 μL, 50 equivalents / double chain, 16.7 / alkyne) to the reaction vial and vortex. Once the reaction is complete (usually within 0.5–1 hour), immediately purify the reaction by non-denaturing anion exchange chromatography.

[0480] ii. Conjugation of targeting ligands to amino-functionalized sense chains

[0481] The following procedure can be used to conjugate activated ester-functionalized targeting ligands, such as αvβ6 peptide 1, to amine-functionalized RNAi agents containing amines, such as C6-NH2, NH2-C6, or (NH2-C6)s as shown in Table 6.1 above.

[0482] The annealed, freeze-dried RNAi agent was dissolved in DMSO and 10% water (v / v%) to a concentration of 25 mg / mL. Then, 50–100 equivalents of TEA and three equivalents of the activated ester targeting ligand were added to the mixture. The reaction was stirred for 1–2 hours while being monitored by RP-HPLC-MS (mobile phase A: 100 mM HFIP, 14 mM TEA; mobile phase B: acetonitrile; column: XBridge C18). After the reaction was complete, 12 mL of acetonitrile was added, followed by 0.4 mL of PBS, and the mixture was centrifuged. The solid precipitate was collected and dissolved in 0.4 mL of 1xPBS, followed by the addition of 12 mL of acetonitrile. The resulting precipitate was collected and dried under high vacuum for 1 hour.

[0483] Synthesis of H.PK / PD modifiers

[0484] PEG48+C22

[0485]

[0486] TBTU (396 mg, 1.233 mmol, 1.2 equivalents) was added at room temperature to a solution of compound 1 (350 mg, 1.027 mmol, 1.0 equivalents), compound 2 (181 mg, 1.130 mmol, 1.1 equivalents), and diisopropylethylamine (0.537 mL, 3.082 mmol, 3.0 equivalents) in anhydrous DMF (3 mL). The reaction was maintained at room temperature for 2 hours. The reaction was quenched with a saturated aqueous solution of NaHCO3 (20 mL), and the aqueous phase was extracted with dichloromethane (3 × 10 mL). The organic phases were combined, dried over anhydrous Na2SO4, and concentrated. The product was purified and eluted with 4-5% methanol in dichloromethane. LC-MS: [M+H] was calculated. + 483.44, found 483.67.

[0487]

[0488] A solution of compound 1 (290 mg, 0.600 mmol, 1.0 equivalent) in anhydrous 1,4-dioxane (1 mL) containing HCl was added at room temperature. The reaction was maintained at room temperature for 3 hours, and the solvent was concentrated. The product was used directly without further purification. LC-MS: Calculation of [M+H] + 383.39, found 383.57.

[0489]

[0490] Triethylamine (0.014 mL, 0.0967 mmol, 3.0 equivalent) was added to anhydrous DMF (2 mL) solutions of compound 1 (83 mg, 0.0322 mmol, 1.0 equivalent) at room temperature. The reaction was maintained at room temperature for 3 hours, and the solvent was concentrated. The products were separated by CombiFlash and eluted with 10–15% methanol in dichloromethane. LC-MS: Calculation of [M+4H] + / 4 698.18, found 698.49, calculate [M+3H] + / 3 930.58, found 930.61.

[0491] Synthesis of LP29-p

[0492]

[0493] TBTU (50.1 mg) was added to a DMF solution of compound 1 (40 mg) and compound 2 (334 mg), followed by DIPEA (0.082 mL) under ambient conditions. The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was then concentrated directly for separation. The residue was purified by CombiFlash using silica gel as the stationary phase and a gradient of 20% MeOH (0-80%) in DCM over 20-30 minutes, in which the product eluted at 71% B. The product was concentrated under vacuum to provide a white, oily residue. LC-MS: Calculation of [M+H] + 2539.62 m / z, observed 1288.21 (+2 / 2, +H2O) m / z.

[0494]

[0495] 4M HCl / dioxane (21.2 mg) was added to compound 1 (147 mg) at room temperature. The reaction mixture was stirred under ambient conditions. The reaction was stirred overnight until complete conversion was confirmed by LC-MS. The reaction mixture was azeotropically reacted with PhMe and concentrated overnight under vacuum to provide an oil. LC-MS: Calculation of [M+H] + 2439.57 m / z, observed 611.16(+4 / 4) m / z.

[0496]

[0497] An anhydrous DCM solution of compound 1 (143 mg) and NEt3 (0.024 mL) was prepared and stirred under a bubbling nitrogen atmosphere. Then, compound 2 (23.4 mg) was added to the reaction mixture. The reaction mixture was stirred at room temperature until complete conversion was observed by LC-MS.

[0498] The reaction mixture was then concentrated directly for separation. The residue was purified by CombiFlash using silica gel as the stationary phase and in a gradient of DCM to 20% MeOH (0-100% B) in DCM. The product eluted at 54% B. LC-MS: [M+H] was calculated. + 5506.42 m / z, observed 1854.41 (+3 / 3, +H2O) m / z.

[0499] Synthesis of LP38-p

[0500]

[0501] TBTU (43.8 mg) was added to a DMF solution of compound 1 (35 mg) and compound 2 (299 mg) under ambient conditions, followed by DIPEA (0.071 mL). The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was then concentrated directly for separation. The residue was purified by CombiFlash using silica gel as the stationary phase and a gradient of 20% MeOH (0-100%) from DCM to DCM over 20-30 min, in which the product eluted at 56% B. The product was concentrated under vacuum to provide a white, oily residue. LC-MS: Calculation of [M+H] + 2539.62 m / z, observed 1288.07 (+2 / 2, +H2O) m / z.

[0502]

[0503] 4M HCl / dioxane (26.7 mg) was added to compound 1 (186 mg) at room temperature. The reaction mixture was stirred under ambient conditions. The reaction was stirred overnight until complete conversion was confirmed by LC-MS. The reaction mixture was azeotropically reacted with PhMe and concentrated overnight under vacuum to provide an oil. LC-MS: Calculation of [M+H] + 2439.57 m / z, observed 1220.97(+2 / 2) m / z.

[0504]

[0505] Compound 2 (8.7 mg) was added under ambient conditions to a DMF solution of compound 1 (181 mg), TBTU (24 mg), and DIEA (0.033 mL). The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was then concentrated directly for separation. The residue was purified by CombiFlash using silica gel as the stationary phase and a gradient of 20% MeOH (0-100%) from DCM to DCM over 20-30 min, in which the product eluted at 65% B. The product was concentrated under vacuum to provide a white, oily residue. LC-MS: Calculation of [M+H] + 5089.22 m / z, observed 1036.24 (+5 / 5, +H2O) m / z.

[0506]

[0507] 4M HCl / dioxane (9.3 mg) was added to compound 1 (130 mg) at room temperature (rt). The reaction mixture was stirred under ambient conditions. The reaction was stirred overnight until complete conversion was confirmed by LC-MS. The reaction mixture was azeotropically reacted with PhMe and concentrated overnight under vacuum to provide an oil. LC-MS: Calculation of [M+H] + 4989.17 m / z, observed 1248.58(+4 / 4) m / z.

[0508]

[0509] An anhydrous DCM solution of compound 1 (128 mg) and NEt3 (0.018 mL) was prepared at room temperature under bubbling nitrogen (g). Compound 2 (10.3 mg) was then slowly added. The reaction mixture was stirred until complete conversion was observed by LC-MS. The reaction mixture was then concentrated directly. The residue was purified over 30 minutes using silica gel as the stationary phase via CombiFlash with a gradient of DCM to 20% MeOH / DCM (0–100%), where the product eluted at 100% B. The product was concentrated to provide a white solid. LC-MS: Calculation of [M+H] + 5299.28 m / z, observe 1786.62 (+3 / 3, +H2O) m / z.

[0510] Synthesis of LP238-p

[0511]

[0512] Iodimethane (4.20 mL, 67.50 mmol) was added to a suspension of compound 1 (5.00 g, 22.50 mmol) and Cs₂CO₃ (25.66 g, 78.75 mmol) in anhydrous DMF (80 mL) at room temperature. The reaction mixture was stirred at room temperature for 48 hours. The reaction was quenched with water (200 mL) and the mixture was extracted with EtOAc (3 x 100 mL). The organic phases were combined and washed with water and brine. The organic layer was dried over anhydrous Na₂SO₄ and concentrated. Compound 2 was given as a pale yellow solid, 5.41 g, 96%. Compound 2 was used directly without further purification. LC-MS: [M+H] calculated 251.05, found 251.18.

[0513]

[0514] LiOH (2.59 g, 108.08 mmol) was added to a THF / H₂O (50 mL / 50 mL) solution of compound 2 (5.41 g, 21.62 mmol) at room temperature. The reaction mixture was stirred for 1 hour at room temperature. After removing THF under vacuum, the pH was adjusted to ~2 with [C]HCl. Extraction was then performed with EtOAc (3 x 60 mL). The organic layers were combined, washed with brine, dried over anhydrous Na₂SO₄, and concentrated. Compound 3 was given as a pale white solid, 5 g, 98%. Compound 3 was used directly without further purification. LC-MS: [M+H] calculated 237.03, found 237.26.

[0515]

[0516] EDC (7.07 g, 36.90 mmol), DMAP (0.30 g, 2.46 mmol), and compound 4 (6.13 g, 36.90 mmol) were added to a THF / DMF (80 mL / 20 mL) solution of compound 3 (5.81 g, 24.60 mmol) at room temperature. The reaction mixture was stirred overnight at room temperature. After removing the solvent under vacuum, the residue was packed onto a 120 g column and compound 5 was eluted with 0–50% EtOAc in hexane. Compound 5 was given as a white solid, 9.36 g, 99%. LC-MS: [M+H] calculated 385.03, found 385.46.

[0517]

[0518] To a DCM (110 mL) solution of compound 5 (2.29 g, 5.96 mmol), 70% m-CPBA (5.14 g, 27.79 mmol) was added at 0 °C. The reaction mixture was stirred for 6 hours at room temperature. Then, 1.8 g of m-CPBA was added. The reaction mixture was stirred overnight at room temperature. After filtration, the solvent was removed under vacuum. The residue was recrystallized twice from DCM / EtOAc (50 mL / 50 mL). Compound 6 was given as white needle-like crystals, 1.93 g, 78%. LC-MS: [M+H]417 was calculated, and 417 was found.

[0519]

[0520]

[0521] Palmitoyl chloride (1.31 g, 4.78 mmol) and TEA were added to a DCM (100 mL) solution of compound 7 (10.00 g, 4.34 mmol) at 0 °C. The reaction mixture was stirred overnight at room temperature, and then the solvent was removed under vacuum. The residue was purified by silica gel chromatography with 0–20% MeOH in DCM. Compound 8 was given as a white solid, 10.0 g, 90%.

[0522]

[0523] Compound 8 (9.56 g, 3.76 mmol) was dissolved in 25 mL of 4N HCl / dioxane and stirred at room temperature for 1 hour. All solvent was removed and the residue was dried under vacuum for 2 hours. The residue was redissolved in 150 mL of DCM and TEA was added, followed by compound 9 (1.10 g, 1.79 mmol) and COMU (1.69 g, 3.94 mmol). The reaction mixture was stirred overnight at room temperature. After standard post-treatment (1N HCl, saturated sodium bicarbonate, brine washing), DCM was removed. Compound 10 was purified by passing it through a 120 g column with 0–20% MeOH in DCM to obtain compound 10, 5.90 g, 60%.

[0524]

[0525] Compound 10 (4.50 g, 0.82 mmol) was dissolved in 20 mL of 4N HCl / dioxane and stirred at room temperature for 1 hour. All solvent was removed and the residue was dried under vacuum for 2 hours. The residue was redissolved in 100 mL of DCM and TEA was added, followed by compound 6 (0.69 g, 1.65 mmol). The reaction mixture was stirred overnight at room temperature. TEA was removed by washing with 1 M HCl and the organic layer was concentrated. Crude LP238-p was purified by silica gel chromatography with 0–20% MeOH in DCM. 2.80 g (60%) of LP238-p as a pale yellow solid was obtained.

[0526] I. Conjugation of PK / PD modulators with RNAi agents

[0527] One or more lipid PK / PD modulator precursors may be linked to the RNAi agents disclosed herein before or after annealing and before or after conjugation of one or more targeting ligands. The following describes a general conjugation process for linking lipid PK / PD modulator precursors to the constructs illustrated in the examples shown herein.

[0528] A. Conjugation of maleimide-containing lipid PK / PD modulator precursors

[0529] The following describes the general procedure for linking a maleimide-containing lipid PK / PD regulator precursor to the (C6-SS-C6) or (6-SS-6) functionalized sense strand of an RNAi agent by dithiothreitol reduction of the disulfide followed by thiol-Michael addition of the corresponding maleimide-containing lipid PK / PD regulator precursor: In a vial, the functionalized sense strand is dissolved in sterile water at 50 mg / mL. Then, 20 equivalents of each of 0.1 M Hepes pH 8.5 buffer and dithiothreitol are added. The mixture is allowed to react for one hour, then the conjugate is precipitated in acetonitrile and PBS, and the solid is centrifuged to obtain the precipitate.

[0530] A precipitate was prepared in a 70 / 30 mixture of DMSO and water at a solid concentration of 30 mg / mL. A lipid PK / PD modulator precursor containing maleimide was then added at 1.5 equivalents. The mixture was allowed to react for 30 minutes. The product was purified by AEX-HPLC (mobile phase A: 25 mM TRIS pH = 7.2, 1 mM EDTA, 50% acetonitrile; mobile phase B: 25 mM TRIS pH = 7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile; stationary phase TSKgel-30; 1.5 cm × 10 cm). The solvent was removed by rotary evaporation, and desalting was performed by 2 × 10 mL exchange with sterile water using a 3K rotary column. The solid product was lyophilized and stored for later use.

[0531] B. Conjugation of sulfone-containing lipid PK / PD modulator precursors

[0532] In a vial, the functionalized sense chain was dissolved in sterile water at a concentration of 50 mg / mL. Then, 20 equivalents of each of 0.1 M pH 8.5 buffer and dithiothreitol were added. The mixture was allowed to react for one hour, and then the conjugate was precipitated in acetonitrile and PBS, and the solid was centrifuged to obtain the precipitate.

[0533] A precipitate was prepared in a 70 / 30 mixture of DMSO and water at a solid concentration of 30 mg / mL. A sulfone-containing lipid PK / PD modulator precursor was then added in 1.5 equivalents. The vial was purged with N2 and heated to 40°C with stirring. The mixture was allowed to react for one hour. The product was purified by AEX-HPLC (mobile phase A: 25 mM TRIS pH = 7.2, 1 mM EDTA, 50% acetonitrile; mobile phase B: 25 mM TRIS pH = 7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile; stationary phase TSKgel-30; 1.5 cm × 10 cm). The solvent was removed by rotary evaporation, and desalting was performed using a 3K rotary column with 2 × 10 mL of sterile water. The solid product was lyophilized and stored for later use.

[0534] C. Conjugation of lipid PK / PD regulator precursors containing azide compounds

[0535] Weigh 1 molar equivalent of Cu(I)-loaded TG-TBTA resin into a glass vial. Purge the vial with N2 for 15 minutes. Then, dissolve the functionalized sense chain in sterile water at a concentration of 100 mg / mL in a separate vial. Add two equivalents of an azide-containing lipid PK / PD modulator precursor (50 mg / mL in DMF) to the vial. Then add TEA, DMF, and water until the final reaction conditions are 33 mM TEA, 60% DMF, and 20 mg / mL of the conjugate. Transfer the solution to a vial containing the resin using a syringe. Remove the N2 purging, seal the vial, and transfer it to a stirring plate at 40°C. Allow the mixture to react for 16 hours. Filter the resin using a 0.45 μm filter.

[0536] The product was purified using AEX (mobile phase A: 25 mM TRIS pH = 7.2, 1 mM EDTA, 50% acetonitrile; mobile phase B: 25 mM TRIS pH = 7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile; stationary phase TSKgel-30; 1.5 cm × 10 cm). Acetonitrile was removed using a rotary evaporator, and desalting was performed by exchanging 2 × 10 mL of sterile water using a 3K column. The solid product was then lyophilized and stored for later use.

[0537] D. Conjugation of alkyne-containing lipid PK / PD regulator precursors

[0538] The following describes a general procedure for linking an activated alkyne-containing lipid PK / PD regulator precursor to the (C6-SS-C6) or (6-SS-6) functionalized sense strand of an RNAi agent by disulfide bond reduction with dithiothreitol followed by addition with an alkyne-containing PK / PD regulator precursor: In a vial, 10 mg of siRNA containing the (C6-SS-C6) or (6-SS-6) functionalized sense strand is dissolved in sterile water at a concentration of 50 mg / mL. Then, 20 equivalents of each of 0.1 M Hepes pH 8.5 buffer and dithiothreitol (1 M in sterile water) are added. The mixture is allowed to react for one hour, and then purified on an XBridge BEHC4 column using mobile phase A with 100 mM HFIP, 14 mM TEA, and mobile phase B with acetonitrile according to the following formula, where %B represents the amount of mobile phase B and the remainder is mobile phase A.

[0539] time ％B 0 3 8 70 10 90 11 90 11.1 3 13 3

[0540] The product was precipitated once by adding 12 mL of acetonitrile and 0.4 mL of 1XPBS, and the resulting solid was centrifuged to form a precipitate. The precipitate was redissolved in 0.4 mL of 1XPBS and 12 mL of acetonitrile. The precipitate was dried under high vacuum for one hour.

[0541] A precipitate was prepared in a vial at a solid concentration of 30 mg / mL in a 70 / 30 mixture of DMSO and water. A lipid PK / PD modulator precursor containing alkyne was then added at 2 equivalents relative to the siRNA. Then, 10 equivalents of TEA were added. The vial was purged with N2, and the reaction mixture was heated to 40°C with stirring. The mixture was allowed to react for one hour. Purification was performed using anion-exchange HPLC with a TSKgel-30 packed column (1.5 cm × 10 cm) using mobile phase A (25 mM TRIS pH = 7.2, 1 mM EDTA, 50% acetonitrile) and mobile phase B (25 mM TRIS pH = 7.2, 1 mM EDTA, 500 mM NaBr, 50% acetonitrile), where %B represents the amount of mobile phase B and the remainder is mobile phase A.

[0542] time ％B 4 10 7 80 10.5 80 11 10 14 10

[0543] Collect the fraction containing the product and remove acetonitrile using a rotary evaporator. Desalt the product by exchanging 2 × 10 mL of sterile water using a 3K rotary column. Then, freeze-dry the product and store it for later use.

[0544] J. Assembly of Connector-4

[0545]

[0546] Cs₂CO₃ (7.71 g) was added to a DMF solution of compound 1 (3.00 g) at rt. Then, compound 2 (1.85 mL) was slowly added. The reaction was stirred overnight under N₂ (g). The near-complete conversion to the desired product was then confirmed by LC-MS. The reaction mixture was quenched with NaHCO₃ (10 mL). The product was extracted with EtOAc (5 x 10 mL) and washed with water (3 x 8 mL) and brine (8 mL). The combined organic phases were dried over Na₂SO₄, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and a gradient from hexane to EtOAc (0–30%), with the product eluting at 14% B. The product was concentrated under vacuum to provide a white solid. LC-MS: Calculation of [M+H] + 191.06 m / z, observed 191.23 m / z.

[0547]

[0548] LiOH (1.08 g) was added to a 1:1 THF / water solution of compound 1 (2.87 g) at ambient pressure. The reaction was stirred until complete conversion was observed by LC-MS. The remaining starting material was extracted with EtOAc, and the aqueous phase was acidified to pH 3 with 6N HCl. The product precipitated as a white solid and was filtered under vacuum and washed with water. Due to its wet / viscous nature, a solvent was required to transfer the solid to a round-bottom flask; the material was transferred via MeOH and DCM. Due to poor solubility in either and in combination, the material could not be dried with Na2SO4 and was accordingly concentrated only under vacuum to provide a white, fluffy crystalline solid. Separation was not required. LC-MS: Calculation of [M+H] + 177.05 m / z, observed 177.19 m / z.

[0549]

[0550] EDC (1.20 g) was added to a DMF (10.0 mL) solution of compounds 1 (1.00 g) and 2 (1.04 g) under N2 (g) at rt. The reaction mixture was stirred until complete conversion was observed by LC-MS. Since the product could not be successfully observed after overnight stirring, the reaction mixture was quenched with NaHCO3, followed by precipitation. The precipitate was confirmed to contain the starting material by LC-MS and filtered under vacuum, attempting to resuspend it in MeOH / DCM, and then concentrated under vacuum. The mixture was then redissolved in DMF, dried over Na2SO4, filtered under vacuum, and washed with DMF. EDC was added back to the filtrate (reaction mixture), and the mixture was allowed to be stirred at rt overnight. The reaction mixture was directly concentrated and azeotropically reacted with MeOH and PhMe for separation. The residue was purified using silica gel as the stationary phase and eluted with a 20% (0-15% B) gradient from DCM to MeOH / DCM. The product was eluted at 0% B to provide a white solid. LC-MS: [M+H] was calculated. + 325.04 m / z, observed 325.35 m / z.

[0551] Example 2. hDMPK-GLuc AAV mouse model

[0552] To evaluate certain DMPK RNAi agents, a DMPK-GLuc (Gaussia Luciferase) AAV (adeno-associated virus) mouse model was used. Six- to eight-week-old male C57BL / 6 mice were transduced with DMPK-GLuc AAV serotype 8, administered at least 14 days prior to administration of the DMPK RNAi agent or control. Two types of DMPK-GLuc AAV were used. The genome of the first DMPK-GLuc AAV contained the 548-1918 region of the human DMPK cDNA sequence (GenBank NM_001081563.2) inserted into the 3' UTR of the GLuc reporter gene sequence. The genome of the second DMPK-GLuc AAV contained the 1891-3243 region of the human DMPK cDNA sequence (GenBank NM_001081563.2) inserted into the 3' UTR of the GLuc reporter gene sequence. Mice were injected via tail vein with 4.8E12 to 5.0E12 GC / kg of the corresponding virus in PBS at a total volume of 10 mL / kg animal body weight to generate hDMPK-GLuc AAV mouse models. Inhibition of DMPK expression by the DMPK RNAi agent resulted in a concomitant inhibition of GLuc expression, as measured. Prior to treatment administration (days 7-1 before administration), via Pierce... TM The Gaussia Luciferase Glow Assay Kit (Thermo Fisher Scientific) measures serum GLuc expression levels and groups mice according to their mean GLuc levels.

[0553] Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region into serum separation tubes (Sarstedt AG & Co., Nümbrecht, Germany). The blood was allowed to clot at ambient temperature for 20 minutes. The tubes were centrifuged at 8,000 × g for 3 minutes to separate the serum, which was then stored at 4°C. The serum was then discharged according to the manufacturer's instructions via Pierce. TMThe Gaussia Luciferase Glow Assay Kit collects and measures serum. Serum GLuc levels for each animal can be normalized to a control group of mice injected with the vector control to account for treatment-independent changes in DMPK expression in the model. To do this, firstly, the GLuc level for each animal at each time point is divided by that animal's pre-treatment expression level (Day 1) to determine the "normalized to pre-treatment" expression ratio. Expression at a specific time point is then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the average "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal can be assessed by normalizing only to pre-treatment levels.

[0554] To evaluate the activity of DMPK RNAi agents in the DMPK-AAV model described in the examples below, certain DMPK RNAi agents were conjugated to a targeting ligand containing N-acetylgalactosamine with a chemical structure called NAG37 (see Table 6.3). NAG37 is known to bind with high affinity to desialylate glycoprotein receptors that are highly expressed on liver cells (including hepatocytes) (see, for example, International Patent Application Publication No. WO2018044350A1). The NAG37-conjugated DMPK RNAi agents were used to evaluate AAV-DMPK expression in the liver.

[0555] Example 3. In vivo testing of DMPK RNAi agent in DMPK-AAV mice.

[0556] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μL / 25 g body weight containing 2.0 mg / kg (mpk), 4.0 mg / kg (mpk) of DMPK RNAi agent, or saline without DMPK RNAi agent as a control, according to Table 7 below.

[0557] Table 7. DMPK RNAi agent and administration method used in Example 2

[0558]

[0559]

[0560] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the mean "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0561] Four (4) mice were tested in each group (n=4). The expression level of DMPK was determined according to the above procedure. The experimental data are shown in Table 8 below.

[0562] Table 8. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 3

[0563]

[0564]

[0565] The DMPK RNAi agents in groups 2-4 and 5-11 showed a decrease in DMPK-AAV compared to the saline control (group 1) on day 8, a decrease in all groups on day 15, and a decrease in all groups on day 22. Group 9 showed a particularly robust knockdown at 2.0 mg / kg on day 22. Furthermore, a dose-response to the DMPK RNAi agent AD09699 was observed.

[0566] Example 4. In vivo testing of DMPK RNAi agent in DMPK-AAV mice.

[0567] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μL / 25 g body weight containing 1.0 mg / kg (mpk), 2.0 mg / kg (mpk), or 4.0 mg / kg (mpk) of DMPK RNAi agent, or saline without DMPK RNAi agent as a control, according to Table 9 below.

[0568] Table 9. DMPK RNAi agent and administration method used in Example 4

[0569] Group ID Dosing regimen Group 1 saline A single SQ injection on day 1 Group 2 1.0mg / kg AD09699 A single SQ injection on day 1 Group 3 2.0mg / kg AD09699 A single SQ injection on day 1 Group 4 4.0mg / kg AD09699 A single SQ injection on day 1 Group 5 2.0 mg / kg AD10261 A single SQ injection on day 1 Group 6 2.0 mg / kg AD10262 A single SQ injection on day 1 Group 7 2.0 mg / kg AD10263 A single SQ injection on day 1 Group 8 2.0 mg / kg AD10264 A single SQ injection on day 1 Group 9 2.0 mg / kg AD10265 A single SQ injection on day 1 Group 10 1.0 mg / kg AD10302 A single SQ injection on day 1 Group 11 2.0 mg / kg AD10302 A single SQ injection on day 1 Group 12 4.0 mg / kg AD10302 A single SQ injection on day 1

[0570] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the mean "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0571] Four (4) mice were tested in each group (n=4). DMPK expression levels were determined according to the procedure described above. Experimental data are shown in Table 10 below.

[0572] Table 10. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 4

[0573]

[0574]

[0575] The DMPK RNAi agents in groups 2, 3, 4, 9, 10, and 12 showed a decrease in DMPK-AAV compared to the saline control (group 1) on day 8, a decrease on day 15 in groups 2, 3, 5, 9, 10, and 12, and a decrease on day 22 in groups 2, 5, 7, 10, and 12.

[0576] Example 5. In vivo testing of DMPK RNAi agent in DMPK-AAV mice.

[0577] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μL / 25 g body weight containing 1.0 mg / kg (mpk), 3.0 mg / kg (mpk), or 5.0 mg / kg (mpk) of DMPK RNAi agent, or saline without DMPK RNAi agent as a control, according to Table 11 below.

[0578] Table 11. DMPK RNAi agent and administration method used in Example 5

[0579] Group ID Dosing regimen Group 1 saline A single SQ injection on day 1 Group 2 1.0mg / kg AD09699 A single SQ injection on day 1 Group 3 3.0mg / kg AD09699 A single SQ injection on day 1 Group 4 5.0mg / kg AD09699 A single SQ injection on day 1 Group 5 3.0 mg / kg AD09702 A single SQ injection on day 1 Group 6 3.0 mg / kg AD10261 A single SQ injection on day 1 Group 7 3.0 mg / kg AD10262 A single SQ injection on day 1 Group 8 3.0 mg / kg AD10263 A single SQ injection on day 1 Group 9 3.0 mg / kg AD10264 A single SQ injection on day 1 Group 10 3.0 mg / kg AD10265 A single SQ injection on day 1 Group 11 1.0 mg / kg AD10302 A single SQ injection on day 1 Group 12 3.0 mg / kg AD10302 A single SQ injection on day 1

[0580] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the mean "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0581] Four (4) mice were tested in each group (n=4). DMPK expression levels were determined according to the procedure described above. The experimental data are shown in Table 12 below.

[0582] Table 12. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 5

[0583]

[0584]

[0585] In each dosing group (i.e., groups 2 to 12), the DMPK RNAi agent showed a decrease in DMPK-AAV compared to the saline control (group 1) at all measured time points. AD09699 showed a greater knockdown (i.e., dose response) at higher doses.

[0586] Example 6. In vivo testing of DMPK RNAi agent in DMPK-AAV mice.

[0587] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μL / 25 g body weight containing 3.0 mg / kg (mpk) of DMPK RNAi agent or saline without DMPK RNAi agent as a control, according to Table 13 below.

[0588] Table 13. DMPK RNAi agent and administration method used in Example 6

[0589] Group ID Dosing regimen Group 1 saline A single SQ injection on day 1 Group 2 3.0mg / kg AD09699 A single SQ injection on day 1 Group 3 3.0 mg / kg AD11130 A single SQ injection on day 1 Group 4 3.0 mg / kg AD11131 A single SQ injection on day 1 Group 5 3.0 mg / kg AD11132 A single SQ injection on day 1 Group 6 3.0 mg / kg AD11133 A single SQ injection on day 1 Group 7 3.0 mg / kg AD11134 A single SQ injection on day 1 Group 8 3.0 mg / kg AD11135 A single SQ injection on day 1 Group 9 3.0 mg / kg AD11136 A single SQ injection on day 1 Group 10 3.0 mg / kg AD11137 A single SQ injection on day 1 Group 11 3.0 mg / kg AD11138 A single SQ injection on day 1 Group 12 3.0 mg / kg AD11139 A single SQ injection on day 1 Group 13 3.0 mg / kg AD11140 A single SQ injection on day 1 Group 14 3.0 mg / kg AD11141 A single SQ injection on day 1

[0590] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the mean "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0591] Four (4) mice were tested in each group (n=4). DMPK expression levels were determined according to the procedure described above. Experimental data are shown in Table 14 below.

[0592] Table 14. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 6

[0593]

[0594]

[0595] In each dosing group (i.e., groups 2 to 14), the DMPK RNAi agent showed a reduction in DMPK-AAV compared to the saline control (group 1) at all measured time points. Groups 6 and 9 showed a knockdown of more than 40% on day 22.

[0596] Example 7. In vivo testing of DMPK RNAi agent in DMPK-AAV mice.

[0597] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μL / 25 g body weight containing 3.0 mg / kg (mpk) of DMPK RNAi agent or saline without DMPK RNAi agent as a control, according to Table 15 below.

[0598] Table 15. DMPK RNAi agent and administration method used in Example 7

[0599]

[0600]

[0601] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the mean "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0602] Four (4) mice were tested in each group (n=4). The expression level of DMPK was determined according to the above procedure. The experimental data are shown in Table 16 below.

[0603] Table 16. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 7

[0604]

[0605]

[0606] In each dosing group (i.e., groups 2 to 11), the DMPK RNAi agent showed a decrease in DMPK-AAV compared to the saline control (group 1) on days 8 and 22. The DMPK RNAi agents in groups 2–8, 10, and 11 showed a decrease in DMPK-AAV compared to the saline control (group 1) on day 15. Group 5 showed a particularly robust (>50%) knockdown on days 15 and 22.

[0607] Example 8. In vivo testing of DMPK RNAi agent in DMPK-AAV mice.

[0608] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl / 25 g body weight containing 4.0 mg / kg (mpk) of DMPK RNAi agent or saline without DMPK RNAi agent as a control, according to Table 17 below.

[0609] Table 17. DMPK RNAi agent and administration method used in Example 8

[0610]

[0611]

[0612] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the ratio of each individual animal's "normalized to pre-treatment" expression to the mean "normalized to pre-treatment" expression ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0613] Four (4) mice were tested in each group (n=4). DMPK expression levels were determined according to the procedure described above. Experimental data are shown in Table 18 below.

[0614] Table 18. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 8

[0615]

[0616]

[0617] In each dosing group (i.e., groups 2 to 14), the DMPK RNAi agent showed a reduction in DMPK-AAV compared to the saline control (group 1) at all measured time points. Groups 2 and 13 showed a mean knockdown of greater than 50% on day 15.

[0618] Example 9. In vivo testing of DMPK RNAi agent in cynomolgus monkeys.

[0619] On day 1, the cynomolgus monkeys were weighed and the RNAi agent was administered intravenously. Muscle biopsies were collected on day -14 (before treatment), day 29, and day 57. At each time point, the cynomolgus monkeys were fasted overnight (for at least 12 hours but no more than 18 hours). Dosing was administered to the animals according to Table 19.

[0620] Table 19. DMPK RNAi agent and administration method used in Example 9

[0621]

[0622] The individual dose is calculated based on body weight recorded each day of administration. The test sample is administered as a single intravenous (iv) injection via the cephalic vein. The IV injection volume is administered slowly over 1 minute. Select and prepare the cephalic vein, flushing it with 0.5 ml of saline just before the IV administration and flushing it with 1.0 ml of saline after the test sample administration.

[0623] Muscle biopsies were collected from the study animals while they were sedated. Animals were sedated with Telazol (4–6 mg / kg) and supplemented with Ketamine (approximately 5 mg / kg) if necessary to maintain an appropriate level of sedation. Biopsy collection included at least 100 mg from the quadriceps and triceps muscles on day -14 (pre-treatment), day 29, and day 57. Biopsies were collected from alternating limbs. Biopsies collected on day -14 and day 57 were collected from sites 1–2 cm apart. Table 20 shows mRNA expression from samples taken from the quadriceps muscles of cynomolgus monkeys. Table 21 shows mRNA expression from samples taken from the triceps muscles of cynomolgus monkeys. DMPK mRNA expression in cynomolgus monkeys was quantified by probe-mediated quantitative PCR and normalized to day -14 pre-treatment for each test group (geometric mean, ± geometric SD).

[0624] Table 20. Mean relative DMPK mRNA expression in quadriceps muscle of cynomolgus monkeys in Example 9

[0625]

[0626] Table 21. Mean relative DMPK mRNA expression in the triceps muscle of cynomolgus monkeys in Example 9

[0627]

[0628]

[0629] As shown in Tables 20 and 21 above, the DMPK RNAi agent showed inhibition in both quadriceps and triceps muscles, demonstrating its ability to silence DMPK expression in nonhuman primates. More specifically, the RNAi agent AC001890 achieved approximately 84% inhibition in the triceps muscle at 20 mg / kg on day 29.

[0630] Example 10. In vivo testing of DMPK RNAi agent in DMPK-AAV mice.

[0631] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μl / 25 g body weight containing 3.0 mg / kg (mpk) of DMPK RNAi agent or saline without DMPK RNAi agent as a control, according to Table 22 below.

[0632] Table 22. DMPK RNAi agent and administration method used in Example 10

[0633]

[0634]

[0635] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the ratio of each individual animal's "normalized to pre-treatment" expression to the mean "normalized to pre-treatment" expression ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0636] Four (4) mice were tested in each group (n=4). The expression level of DMPK was determined according to the above procedure. The experimental data are shown in Table 23 below.

[0637] Table 23. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 10

[0638]

[0639]

[0640] In each dosing group (i.e., groups 2 to 11), the DMPK RNAi agent showed a reduction in DMPK-AAV compared to the saline control (group 1) at all measurement time points. More specifically, AD10875 achieved approximately 51% inhibition at day 22 at 3.0 mg / kg.

[0641] Example 11. In vivo testing of DMPK RNAi agent in DMPK-AAV mice

[0642] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μL / 25 g body weight containing 2.0 mg / kg (mpk) of DMPK RNAi agent or saline without DMPK RNAi agent as a control, according to Table 24 below.

[0643] Table 24. DMPK RNAi agent and administration method used in Example 11

[0644]

[0645]

[0646] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the mean "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0647] Four (4) mice were tested in each group (n=4). DMPK expression levels were determined according to the procedure described above. Experimental data are shown in Table 25 below.

[0648] Table 25. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 11

[0649]

[0650]

[0651] The DMPK RNAi agents in groups 2, 3, 4, 5, 6, 7, 11, and 12 showed a decrease in DMPK-AAV compared to the saline control (group 1) on day 8, a decrease in groups 2, 3, and 11 on day 15, and a decrease in groups 2, 4, 6, 11, and 12 on day 22.

[0652] Example 12. In vivo testing of DMPK RNAi agent in DMPK-AAV mice

[0653] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μL / 25 g body weight containing 1.0 mg / kg (mpk), 2.0 mg / kg (mpk), or 4.0 mg / kg (mpk) of DMPK RNAi agent, or saline without DMPK RNAi agent as a control, according to Table 26 below.

[0654] Table 26. DMPK RNAi agent and administration method used in Example 12

[0655] Group ID Dosing regimen Group 1 saline A single SQ injection on day 1 Group 2 1.0 mg / kg AD09721 A single SQ injection on day 1 Group 3 2.0 mg / kg AD09721 A single SQ injection on day 1 Group 4 4.0 mg / kg AD09721 A single SQ injection on day 1 Group 5 2.0 mg / kg AD09722 A single SQ injection on day 1 Group 6 2.0 mg / kg AD09923 A single SQ injection on day 1 Group 7 2.0 mg / kg AD09706 A single SQ injection on day 1 Group 8 2.0 mg / kg AD09707 A single SQ injection on day 1 Group 9 2.0 mg / kg AD09709 A single SQ injection on day 1 Group 10 2.0 mg / kg AD09708 A single SQ injection on day 1 Group 11 2.0 mg / kg AD09922 A single SQ injection on day 1 Group 12 2.0mg / kg AD09723 A single SQ injection on day 1

[0656] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the mean "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0657] Four (4) mice were tested in each group (n=4). DMPK expression levels were determined according to the procedure described above. Experimental data are shown in Table 27 below.

[0658] Table 27. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 12

[0659]

[0660]

[0661] In each dosing group (i.e., groups 2 to 12), except for group 10 on days 15 and 22, the DMPK RNAi agent showed a reduction in DMPK-AAV compared to the saline control (group 1) at all measurement time points. More specifically, AD09721 achieved approximately 56% inhibition at day 8 at 4.0 mg / kg.

[0662] Example 13. In vivo testing of DMPK RNAi agent in DMPK-AAV mice

[0663] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μL / 25 g body weight containing 4.0 mg / kg (mpk) of DMPK RNAi agent or saline without DMPK RNAi agent as a control, according to Table 28 below.

[0664] Table 28. DMPK RNAi agent and administration method used in Example 13

[0665] Group ID Dosing regimen Group 1 saline A single SQ injection on day 1 Group 2 4.0 mg / kg AD09721 A single SQ injection on day 1 Group 3 4.0 mg / kg AD08910 A single SQ injection on day 1 Group 4 4.0 mg / kg AD08911 A single SQ injection on day 1 Group 5 4.0 mg / kg AD08912 A single SQ injection on day 1 Group 6 4.0 mg / kg AD08913 A single SQ injection on day 1 Group 7 4.0 mg / kg AD08914 A single SQ injection on day 1 Group 8 4.0 mg / kg AD08915 A single SQ injection on day 1 Group 9 4.0 mg / kg AD08916 A single SQ injection on day 1 Group 10 4.0 mg / kg AD08917 A single SQ injection on day 1 Group 11 4.0 mg / kg AD08918 A single SQ injection on day 1 Group 12 4.0 mg / kg AD08919 A single SQ injection on day 1

[0666] Serum was collected on days 1, 8, 15, and 22 for Gaussian luciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the mean "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0667] Four (4) mice were tested in each group (n=4). The expression level of DMPK was determined according to the above procedure. The experimental data are shown in Table 29 below.

[0668] Table 29. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 13

[0669]

[0670]

[0671] The DMPK RNAi agents in groups 2, 3, 4, 5, and 6 showed a decrease in DMPK-AAV compared to the saline control (group 1) on day 8, a decrease on day 15 in groups 2, 3, 5, 6, 8, and 11, and a decrease on day 22 in groups 2, 3, 6, 8, and 11.

[0672] Example 14. In vivo testing of DMPK RNAi agent in DMPK-AAV mice

[0673] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μL / 25 g body weight containing 3.0 mg / kg (mpk), 6.0 mg / kg (mpk) of DMPK RNAi agent, or saline without DMPK RNAi agent as a control, according to Table 30 below.

[0674] Table 30. DMPK RNAi agent and administration method used in Example 14

[0675]

[0676]

[0677] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the mean "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0678] Four (4) mice were tested in each group (n=4). The expression level of DMPK was determined according to the above procedure. The experimental data are shown in Table 31 below.

[0679] Table 31. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 14

[0680]

[0681]

[0682] In each dosing group (i.e., groups 2 to 13), the DMPK RNAi agent showed a reduction in DMPK-AAV compared to the saline control (group 1) at all measurement time points. More specifically, AD11953 achieved approximately 69% inhibition at day 15 at 6.0 mg / kg.

[0683] Example 15. In vivo testing of DMPK RNAi agent in DMPK-AAV mice.

[0684] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μL / 25 g body weight containing 2.0 mg / kg (mpk), 4.0 mg / kg (mpk) of DMPK RNAi agent, or saline without DMPK RNAi agent as a control, according to Table 32 below.

[0685] Table 32. DMPK RNAi agent and administration method used in Example 15

[0686]

[0687]

[0688] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the mean "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0689] Four (4) mice were tested in each group (n=4). The expression level of DMPK was determined according to the above procedure. The experimental data are shown in Table 33 below.

[0690] Table 33. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 15

[0691]

[0692]

[0693] In each dosing group (i.e., groups 2 to 11), the DMPK RNAi agent showed a reduction in DMPK-AAV compared to the saline control (group 1) at all measurement time points. More specifically, AD10560 achieved approximately 71% inhibition at day 22 at 4.0 mg / kg.

[0694] Example 16. In vivo testing of DMPK RNAi agent in DMPK-AAV mice.

[0695] The DMPK-AAV mouse model described in Example 2 above was used. On day 1, each mouse received a single subcutaneous (SQ) injection of 250 μL / 25 g body weight containing 3.0 mg / kg (mpk) of DMPK RNAi agent or saline without DMPK RNAi agent as a control, according to Table 34 below.

[0696] Table 34. DMPK RNAi agent and administration method used in Example 16

[0697] Group ID Dosing regimen Group 1 saline A single SQ injection on day 1 Group 2 3.0 mg / kg AD09721 A single SQ injection on day 1 Group 3 3.0 mg / kg AD08913 A single SQ injection on day 1 Group 4 3.0 mg / kg AD11667 A single SQ injection on day 1 Group 5 3.0 mg / kg AD11668 A single SQ injection on day 1 Group 6 3.0 mg / kg AD11669 A single SQ injection on day 1 Group 7 3.0 mg / kg AD11670 A single SQ injection on day 1 Group 8 3.0 mg / kg AD09923 A single SQ injection on day 1

[0698] Serum was collected on days 1, 8, 15, and 22 for Gaussialuciferase glow assay to quantify GLuc expression levels. GLuc expression at specific time points was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the mean "normalized to pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum GLuc levels for each animal were assessed by normalizing only to pre-treatment levels.

[0699] Four (4) mice were tested in each group (n=4). DMPK expression levels were determined according to the procedure described above. Experimental data are shown in Table 35 below.

[0700] Table 35. Mean DMPK levels normalized to pre-treatment and control in AAV-hDMPK mice from Example 16

[0701]

[0702]

[0703] In each dosing group, the DMPK RNAi agent showed a decrease in DMPK-AAV compared to the saline control on days 8 and 22, and a decrease was observed in all groups except group 3 on day 15. More specifically, AD11670 achieved approximately 43% inhibition at day 8 with a dose of 3.0 mg / kg.

[0704] Example 17. TREDT960I / HSA-rtTA mouse model

[0705] To evaluate DMPK RNAi agents in vivo, a transgenic model of myotonic dystrophy type 1 was used. TREDT960I (FVB / NJ-Tg(tetO-DMPK*)A2352Coop / J) was commercially obtained from Jackson Laboratories (JAX) and crossed with HSA-rtTA mice (B6; C3-Tg(ACTA1-rtTA,tetO-cre)102Monk / J) to produce homozygous progeny that expressed human DMPK exons 11-15, the UTR, and a 960-interrupted CTG repeat in skeletal muscle after tetracycline administration.

[0706] TREDT960I Mouse Background: TREDT960I mice were generated in an FVB background using standard techniques. The TREDT960I transgene contains a human genome segment containing exons 11-15 of DMPK with 960 interrupted CTG repeats located at the naturally occurring repeat site. Each interrupted CTG repeat contains 20 CTGs formed by the ligation of SalI and XhoI restriction sites, separated by 5-nucleotide spacers. Furthermore, the transgene contains a 307 bp DMPK 3' flanking region containing the natural polyadenylation signal and two copies of the cHS4 insulator flanking the 5' and 3' ends of the expression construct to prevent interference from chromosomal insertion sites. This mutated DMPK gene is directed by the tetO (tet-responsive element) promoter. The transgene construct was microinjected into the pronucleus of FVB / NJ zygotes. Subsequently, the TREDT960I transgenic founder line A2352 was established and maintained for at least 20 generations in the FVB / NJ context.

[0707] Because the mutated DMPK construct is directed by the tetO promoter, expression depends on the tissue expressing tetracycline transcription activator (rtTA). When crossed with mice expressing rtTA in a specific tissue, the resulting offspring will express the DMPK transgene in that tissue in the presence of tetracycline.

[0708] HSA-rtTA / TRE-Cre mouse background: HSA-rtTA / TRE-Cre mice are transgenic mice with a tetracycline (doxycycline)-induced Cre-mediated recombination system that specifically targets skeletal muscle cells. To achieve this, a first transgenic construct containing Cre, a Cre recombinase controlled by tetO (tetracycline-responsive regulatory element), and a second transgenic construct containing rtTA (trans-tetracycline-controlled transcription activator) controlled by human ACTA1 (actin, α1) were co-injected into fertilized (C57BL / 6×C3H)F2 mouse oocytes, which were then backcrossed into C57BL / 6J mice for three generations.

[0709] The offspring of crosses between TREDT960I and HSA-rtTA / TRE-Cre mice used in the studies supporting this application were either double transgenic and homozygous for the TREDT960I transgene and hemizygous for the HSA-rtTA / TRE-Cre transgene, or homozygous for the TREDT960I transgene and non-carrier for the HSA-rtTA / TRE-Cre transgene. Cre recombinase expression had no effect on transgene expression in TREDT960I animals and was considered an inert byproduct of this model.

[0710] DMPK expression of doxycycline induction: Doxycycline, a stable tetracycline antibiotic, was administered to animals via doxycycline-mixed rodent feed. In some studies, doxycycline was administered from birth (to lactating mothers fed doxycycline-mixed rodent feed) until weaning, followed by free access to other food until termination, unless the doxycycline-mixed rodent feed was replaced with standard rodent feed as part of the study procedure. The doxycycline-mixed rodent feed contained 2 g of doxycycline hydrochloride per kilogram of rodent feed. In some studies, doxycycline administration did not begin until 4 weeks prior to the start of the study, at which point the standard rodent feed was replaced with doxycycline-mixed rodent feed as part of the study procedure. The doxycycline-mixed rodent feed contained 2 g of doxycycline hydrochloride per kilogram of rodent feed.

[0711] Weight assessment: Body weight was recorded on all days of RNAi administration and on the day of tissue harvest. Body weight was normalized to the mean body weight of homozygous TREDT960I / HSA-rtTA / TRE-Cre non-carrier control group or homozygous TREDT960I transgenic / hemisyltransferase / TRE-Cre control group on the first day of tamoxifen administration and fed a standard rodent diet (doxycycline-free) and administered saline (RNAi-free).

[0712] Tissue collection: Mice were anesthetized with 3-4% isoflurane and euthanized by exsanguination. Tissues of interest for gene expression analysis were harvested and flash-frozen in liquid nitrogen, then stored at -80°C. Tissues of interest for histology were fixed in formalin, then embedded in paraffin and stained using histochemical or immunohistochemical protocols.

[0713] Gene expression analysis: The entire frozen tissue was homogenized using the Precellys tissue homogenization system, and RNA was isolated by acid guanosine thiocyanate-phenol-chloroform extraction. SuperScript was used. TM VILO TMThe cDNA synthesis kit (Thermo) synthesizes complementary DNA from extracted RNA and measures gene expression using a QX200 droplet digital PCR (Bio-Rad) or QuantFlex 7qRT-PCR (Applied Biosystems) system with a Taqman primer / probe set (Thermo-Fisher) designed to detect genes of interest. Gene expression was normalized to the mean of a doxycycline-induced control group, which was fed rodent feed mixed with doxycycline and saline (without RNAi agent).

[0714] Competitive missplicing analysis: Primer sets were designed for transcripts known to be misspliced ​​when the mutant DMPK-CUG accumulates in the myonuclear region. Forward and reverse primers were designed for exons flanking exons known to be excluded or included under normal transcript splicing conditions and misspliced ​​and incorrectly included or excluded in the presence of accumulated mutant DMPK-CUG transcripts in the nucleus. FAM-labeled probes were designed for interfaces between flanking exons that interact only in the absence of excluded exons. HEX-labeled probes were designed for excluded exons. Figure 1 A graphical representation of the primer design is shown.

[0715] Complementary DNA was generated from isolated RNA from collected tissues. For each transcript of interest, the percentage of missplicing transcripts isolated from tissues treated with or without doxycycline and / or RNAi agents was determined using a mixture of primer sets and FAM- and HEX-labeled probes. Examples of transcripts of interest may include exon 22 of Atp2a1, exon 28 of Cacna1, exon 8 of Ldb3, and exon 7 of Mbnl1.

[0716] Example 18. In vivo testing of DMPK RNAi agent in TREDT960I / HSA-rtTA mouse model.

[0717] The DMPK TREDT960I / HAS-rtTA mouse model described in Example 17 above was used. On days 1, 8, 15, 22, and 29, each mouse received a single intravenous (iv) injection of 200 μl / 20 g body weight containing 20.0 mg / kg (mpq), 40.0 mg / kg (mpq) of DMPK RNAi, or saline without DMPK RNAi as a control. The treatment groups are shown in Table 36 below. Eight mice (n=8) were injected into each group, consisting of four males and four females.

[0718] The test groups also received either regular rodent feed or feed mixed with doxycycline. All animals remained on the doxycycline-mixed feed from receipt until the start of the study. At the start of the study, Group 1 was switched to the regular feed, while all other groups remained on the doxycycline-mixed feed.

[0719] On day 36, tissues were harvested. Tibialis anterior (TA), triceps (Tri), and gastrocnemius (Gas) muscle tissues were collected from transverse and longitudinal / oblique sections. Tissue samples were processed for CUG-(ISH) / mouse MBNL1 (Ab) and DMPK RNAscope staining. Tissue samples were then processed for RNA isolation and cDNA generation. Quantitative polymerase chain reaction (qPCR) analysis of human DMPK and mouse Arl1, as well as missplicing analysis of mSerca1 (Atp2A1), mMbnl1, mCac1.1 (Cacna1), and mLdb3 were then performed.

[0720]

[0721] Figure 2 The relative hDMPK transcript levels in the test groups are shown. The displayed hDMPK transcript levels are normalized to group 2. Figure 2 The introduction of AC002324 showed that it suppressed the hDMPK transcript level.

[0722] Figure 3 Figures 7 to 7 show the relative missplicing of mCacna1, mLdb3, mMbnl1, and mAtp2a1 in the test group. The relative missplicing levels were normalized to group 2. Figures 3 to 6 The introduction of the DMPK RNAi agent AC002324 showed that splicing of these measured genes was prevented.

[0723] for Figures 2 to 6 Statistical significance is expressed as follows: * is p<0.05, ** is p<0.01, *** is p<0.001, and **** is p<0.0001.

[0724] Example 19. In vivo testing of DMPK RNAi agent in cynomolgus monkeys.

[0725] On day 1, the cynomolgus monkeys were weighed and administered the drug via intravenous injection. Muscle biopsies were collected on day -14 (before treatment), day 29, and day 57. At each time point, the cynomolgus monkeys were fasted overnight (for at least 12 hours but no more than 18 hours). The animals were administered the drug according to Table 37.

[0726] Table 37. DMPK RNAi agent and administration method used in Example 19

[0727]

[0728] Individual doses were calculated based on body weight recorded each day of administration. The test sample was administered via a cephalic vein as a single intravenous (iv) injection. For groups 1–3, the IV injection volume was administered slowly over 1 minute. The cephalic vein was selected and prepared, flushed with 0.5 ml of saline immediately before IV administration, and flushed with 1.0 ml of saline immediately after test sample administration.

[0729] Muscle biopsies were collected during the sedation procedure. Animals were sedated with Telazol (4–6 mg / kg) and, if necessary, supplemented with Ketamine (approximately 5 mg / kg) to maintain an appropriate level of sedation. Biopsy collection included at least 100 mg from the quadriceps and triceps muscles on days -14 (pre-treatment), 29, 57, and 85. Biopsies were collected from alternating limbs. Biopsies collected on days -14 / 57 and 29 / 85 were collected from sites 1–2 cm apart. Table 38 shows mRNA expression from samples taken from the quadriceps muscles of cynomolgus monkeys. Table 39 shows mRNA expression from samples taken from the triceps muscles of cynomolgus monkeys. DMPK mRNA expression in cynomolgus monkeys was quantified by probe-based quantitative PCR and normalized to pre-treatment day -14 for each test group (geometric mean, ± geometric SD).

[0730] Table 38. Mean relative DMPK mRNA expression in quadriceps muscle of cynomolgus monkeys in Example 19.

[0731]

[0732] Table 39. Mean relative DMPK mRNA expression in the triceps muscle of cynomolgus monkeys in Example 19.

[0733]

[0734] As shown in Tables 38 and 39 above, the DMPK RNAi agent exhibited inhibition in both quadriceps and triceps muscles, demonstrating its ability to silence DMPK expression in nonhuman primates. More specifically, the RNAi agent AC002691 achieved approximately 89% inhibition in the triceps muscle at 10 mg / kg on day 29 and approximately 88% inhibition in the triceps muscle at 10 mg / kg on day 85.

[0735] Example 20. In vivo testing of DMPK RNAi agent in cynomolgus monkeys.

[0736] The cynomolgus monkeys were weighed and administered the drug via subcutaneous (SQ) injection on day 1 (for group 1) and day 1 and day 29 (for group 2). Muscle biopsies were collected on day -14 (before treatment), day 29, day 57, and day 85. The animals were administered the drug according to Table 40.

[0737] Table 40. DMPK RNAi agent and administration for Example 20.

[0738]

[0739] Individual doses were calculated based on body weight recorded each day of administration. For Group 1, the test product was administered as a single subcutaneous (SQ) injection in the mid-scapular region on Day 1; for Group 2, the test product was administered as a single subcutaneous (SQ) injection in the mid-scapular region on Day 1 and Day 29. The injection site was shaved and prepared according to standard safety procedures prior to injection.

[0740] Muscle biopsies were collected during the sedation procedure. Animals were sedated with Telazol (5–8 mg / kg) and, if necessary, supplemented with Ketamine (approximately 5 mg / kg) to maintain an appropriate level of sedation. Biopsy collections included at least 100 mg from the quadriceps and triceps muscles on days -14 (pre-treatment), 29, 57, and 85. Biopsies were collected from alternating limbs. Biopsies collected on days -14 / 57 and 29 / 85 were collected from sites 1–2 cm apart. Table 41 shows mRNA expression from samples taken from the quadriceps muscles of cynomolgus monkeys. Table 42 shows mRNA expression from samples taken from the triceps muscles of cynomolgus monkeys. DMPK mRNA expression in cynomolgus monkeys was quantified by probe-based quantitative PCR and normalized to pre-treatment day -14 for each test group (geometric mean, ± geometric SD).

[0741] Table 41. Mean relative DMPK mRNA expression in quadriceps muscle of cynomolgus monkeys in Example 20.

[0742]

[0743]

[0744] Table 42. Mean relative DMPK mRNA expression in the triceps muscle of cynomolgus monkeys in Example 20.

[0745]

[0746] As shown in Tables 41 and 42 above, AC002691 demonstrated significant inhibition in both quadriceps and triceps muscles that persisted until at least day 85, demonstrating its ability to silence DMPK expression in nonhuman primates. More specifically, the RNAi agent AC002691 achieved approximately 90% inhibition in triceps muscles at 10 mg / kg on day 29 and approximately 87% inhibition in quadriceps muscles at 10 mg / kg on day 85.

[0747] Example 21. In vivo testing of DMPK RNAi agent in cynomolgus monkeys.

[0748] On day 1 and day 29 (for groups 1–3), the cynomolgus monkeys were weighed and administered the drug via intravenous (IV) injection. For groups 1–3, muscle biopsies and blood were collected on day -14 (before treatment), day 29, day 57, and day 85. The animals were administered the drug according to Table 43.

[0749] Table 43. DMPK RNAi agent and administration for Example 21.

[0750]

[0751] Individual doses were calculated based on body weight recorded each day of administration. For groups 1–3, the test product was administered as a single intravenous (IV) injection on days 1 and 29. The injection site was shaved and prepared according to standard safety procedures prior to injection.

[0752] Muscle biopsies were collected during the sedation procedure. Animals were sedated with Telazol (5-8 mg / kg) and, if necessary, supplemented with Ketamine (approximately 5 mg / kg) to maintain an appropriate level of sedation.

[0753] Muscle biopsies collected in groups 1–3 included at least 100 mg from the quadriceps and triceps muscles on days -14 (pre-treatment), 29, 57, and 85. Biopsies were collected from alternating limbs. Biopsies collected on days -14 / 57 and 29 / 85 were collected from sites 1–2 cm apart. Table 44 shows mRNA expression from samples taken from the quadriceps muscles of cynomolgus monkeys. Table 45 shows mRNA expression from samples taken from the triceps muscles of cynomolgus monkeys. DMPK mRNA expression in cynomolgus monkeys was quantified by probe-based quantitative PCR and normalized to pre-treatment day -14 for each test group (geometric mean, ± geometric SD).

[0754] Table 44. Mean relative DMPK mRNA expression in quadriceps muscle of cynomolgus monkeys in Example 21.

[0755]

[0756] Table 45. Mean relative DMPK mRNA expression in the triceps muscle of cynomolgus monkeys in Example 21.

[0757]

[0758]

[0759] As shown in Tables 44 and 45 above, AC002691 demonstrated significant inhibition in both quadriceps and triceps muscles that persisted until at least day 85, demonstrating its ability to silence DMPK expression in nonhuman primates. More specifically, the RNAi agent AC002691 achieved approximately 93% inhibition in the triceps muscle at 10.0 mg / kg on day 29, and approximately 90% inhibition in the quadriceps muscle at 5.0 mg / kg on day 29.

[0760] Other implementation plans

[0761] It should be understood that although the invention has been described in conjunction with its detailed description, the foregoing description is intended to illustrate and not limit the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications of the invention are within the scope of the appended claims.

Claims

1. An RNAi agent for inhibiting the expression of DM1 protein kinase (DMPK) gene, comprising: i. an antisense strand comprising at least 17 consecutive nucleotides that differ by 0 or 1 nucleotide from any of the sequences provided in Table 2, Table 3, or Table 5.4; and ii. A sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2, Table 3, or Table 5.

4.

3. The RNAi agent of claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 consecutive nucleotides that differs by 0 or 1 nucleotide from any of the sequences provided in Table 2, Table 4.1, Table 4.2, Table 4.3, Table 4.4, Table 4.5, Table 4.6, Table 5.4, or Table 5.5, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand over 17 consecutive nucleotides.

4. The RNAi agent of any one of claims 1-3, wherein at least one nucleotide of the DMPK RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.

5. The RNAi agent of any one of claims 1-3, wherein all or substantially all nucleotides are modified nucleotides.

6. The RNAi agent of any one of claims 4-5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinylphosphonate-containing nucleotides, cyclopropylphosphonate-containing nucleotides, and 3'-O-methyl nucleotides.

7. The RNAi agent of claim 5, wherein all or substantially all of the modified nucleotides are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

8. The RNAi agent of any one of claims 1-7, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences provided in Table 3.

9. The RNAi agent of any one of claims 1-8, wherein the sense strand comprises a nucleotide sequence of any one of the modified sequences provided in Table 4.1, Table 4.2, Table 4.3, Table 4.4, Table 4.5, Table 4.6, Table 5.4, or Table 5.

5.

10. The RNAi agent of claim 1, wherein the antisense strand comprises a nucleotide sequence of any modified sequence provided in Table 3, and the sense strand comprises a nucleotide sequence of any modified sequence provided in Table 4.1, Table 4.2, Table 4.3, Table 4.4, Table 4.5, Table 4.6, Table 5.4, or Table 5.

5.

11. The RNAi agent of any one of claims 1-10, wherein the RNAi agent is linked to a targeting ligand.

12. The RNAi agent of claim 11, wherein the targeting ligand is linked to the sense strand.

13. The RNAi agent of claim 12, wherein the targeting ligand is linked to the 5' end of the sense strand.

14. The RNAi agent of any one of claims 11-13, wherein the targeting ligand has affinity for skeletal muscle cells and / or a cell receptor expressed on skeletal muscle cells.

15. The RNAi agent of any one of claims 11-14, wherein the targeting ligand is selected from: or a pharmaceutically acceptable salt thereof, wherein Indicates the point of attachment to the RNAi agent.

16. The RNAi agent of any one of claims 1-15, wherein the RNAi agent is further linked to a pharmacokinetic / pharmacodynamic (PK / PD) modulator. The RNAi agent of claim 16 , wherein a PK / PD modulator is linked to the sense strand. The RNAi agent of claim 17 , wherein the PK / PD modulator is linked to the 3′ end of the sense strand.

19. The RNAi agent of any one of claims 16-18, wherein the PK / PD modulator is selected from: or a pharmaceutically acceptable salt thereof, wherein Indicates the point of attachment to the RNAi agent.

20. The RNAi agent of any one of claims 17-18, wherein the PK / PD modulator is selected from: where R Z Contains an RNAi agent.

21. The RNAi agent of any one of claims 1-20, wherein the sense strand is 15-49 nucleotides in length and the antisense strand is 17-30 nucleotides in length.

22. The RNAi agent of claim 21, wherein the sense strand and the antisense strand are each 18-24 nucleotides in length.

23. The RNAi agent of claim 22, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

24. The RNAi agent of claim 23, wherein the RNAi agent has two blunt ends.

25. The RNAi agent of any one of claims 1-24, wherein the sense strand comprises one or two terminal caps.

26. The RNAi agent of any one of claims 1-25, wherein the sense strand comprises one or two inverted abasic deoxyribose residues.

27. The RNAi agent of claim 1, wherein the RNAi agent consists of a sense strand and an antisense strand that form a duplex having a structure of any one of the duplexes in Table 5.1, Table 5.2, Table 5.3, Table 5.4, Table 5.6, or Table 5.

7.

28. The RNAi agent of claim 27, wherein the sense strand further comprises an inverted abasic deoxyribose residue at the 3' end and / or the 5' end of the nucleotide sequence.

29. The RNAi agent of claim 28, wherein all or substantially all nucleotides are modified nucleotides.

30. The RNAi agent of any one of claims 1-29, wherein the antisense strand comprises, consists of, or consists essentially of a nucleobase sequence that differs by 0 or 1 nucleotide from a sequence selected from: UCGUAAUACUCCAUGACCAGG(SEQ ID NO:1507); UUGUAGUGGACGAUCUUGCCA (SEQ ID NO: 1457); and UAGACAAUAAAUACCGAGGAA (SEQ ID NO: 1468).

31. The RNAi agent of claim 31, wherein all or substantially all nucleotides are modified nucleotides.

32. The RNAi agent of any one of claims 1-31, wherein the antisense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotide from a nucleotide sequence selected from: cPrpusCfsGfuAfauacUfcCfaUfgAfccagsg (SEQ ID NO:757); cPrpusUfsgsuAfguggacGfaUfcUfugccsa (SEQ ID NO:759); and cPrpusAfsgacaauaAfaUfaCfcGfaggasa (SEQ ID NO:724); wherein a, c, g, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage.

33. The RNAi agent of any one of claims 1-32, wherein the sense strand comprises, consists of, or consists essentially of a nucleobase sequence that differs by 0 or 1 nucleotide from a sequence selected from: CCUGGUCAUGGAGUAUUACGA (SEQ ID NO: 1579); UGGCAAGAUCGUCCACUACAA (SEQ ID NO: 1525); and UUCCUCGGUAUUUAUUGUCUA (SEQ ID NO: 1543).

34. The RNAi agent of any one of claims 1-33, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotide from a nucleotide sequence selected from: ccugucaUfgGfAfguauuacga (SEQ ID NO: 1162); uggcaagaUfcGfuccacuacaa (SEQ ID NO: 1127); and uuccucggUfaUfUfuauugucua(SEQ ID NO:1130); where a, c, g, and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; and cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine.

35. The RNAi agent of any one of claims 1-34, wherein the RNAi agent comprises: (i) an antisense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence of cPrpusCfsGfuAfauacUfcCfaUfgAfccagsg (SEQ ID NO: 757); and a sense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence of ccuggucaUfgGfAfguauuacga (SEQ ID NO: 1162); (ii) an antisense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence of cPrpusUfsgsuAfguggacGfaUfcUfugccsa (SEQ ID NO: 759); and a sense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence of uggcaagaUfcGfuccacuacaa (SEQ ID NO: 1127); or (iii) an antisense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence of cPrpusAfsgacaauaAfaUfaCfcGfaggasa (SEQ ID NO: 724); and a sense strand comprising, consisting of, or consisting essentially of the modified nucleotide sequence of uuccucggUfaUfUfuauugucua (SEQ ID NO: 1130); in, a, c, g, and u represent 2′-O-methyladenosine, 2′-O-methylcytidine, 2′-O-methylguanosine, and 2′-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, 2′-fluorocytidine, 2′-fluoroguanosine, and 2′-fluorouridine, respectively; cPrpu represents 5′-cyclopropylphosphonate-2′-O-methyluridine; and s represents a phosphorothioate linkage.

36. The RNAi agent of any one of claims 27-29, wherein the sense strand of the RNAi agent is linked to a targeting ligand.

37. The RNAi agent of claim 36, wherein the targeting ligand has an affinity for a cellular receptor expressed on skeletal muscle cells.

38. The RNAi agent of any one of claims 36-37, wherein the targeting ligand comprises a compound having a structure shown in Table 6.2 or Table 6.

3.

39. The RNAi agent of any one of claims 1-38, wherein the RNAi agent is a pharmaceutically acceptable salt.

40. The RNAi agent of claim 39, wherein the RNAi agent is a sodium salt.

41. A pharmaceutical composition comprising the RNAi agent of any one of claims 1-39, wherein the pharmaceutical composition comprises a pharmaceutically acceptable excipient.

42. A method for inhibiting DMPK gene expression in a cell, the method comprising introducing an effective amount of the RNAi agent of any one of claims 1-39 or the pharmaceutical composition of claim 41 into the cell.

43. The method of claim 42, wherein the cell is located within a subject.

44. The method of claim 43, wherein the subject is a human subject.

45. The method of any one of claims 42-44, wherein DMPK gene expression is inhibited by at least about 40%.

46. ​​The method of any one of claims 42-45, wherein DMPK protein levels are reduced by at least about 40%.

47. The method of any one of claims 42-46, wherein the level of mutant DMPK protein is reduced by at least 40%.

48. A method of treating one or more symptoms or diseases that can be at least partially ameliorated by reduced DMPK protein levels and / or reduced DMPK mRNA levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the pharmaceutical composition of claim 41.

49. The method of claim 48, wherein the disease is myotonic dystrophy type 1.

50. The method of any one of claims 42-49, wherein DMPK gene expression is reduced in one or more of the subject's paraspinal, facial, trunk, abdominal, and limb muscle tissues.

51. The method of any one of claims 42-50, wherein DMPK gene expression is decreased in one or more of the subject's triceps, biceps, quadriceps, gastrocnemius, soleus, EDL (extensor digitorum longus), TA (tibialis anterior), or diaphragm.

52. The method of any one of claims 42-51, wherein the RNAi agent is administered at a dose of about 0.5 mg / kg to about 10.0 mg / kg body weight.

53. The method of claim 52, wherein the RNAi agent is administered by subcutaneous (SQ) injection.

54. The RNAi agent of any one of claims 1-40 or the pharmaceutical composition of claim 41 for use in treating a disease, disorder or symptom mediated at least in part by reduced DMPK protein levels or reduced DMPK mRNA levels, or both.

55. The pharmaceutical composition of claim 41 for use in the preparation of a medicament for treating a disease, disorder or symptom mediated at least in part by decreased DMPK protein levels or decreased DMPK mRNA levels, or both.

56. A composition for inhibiting DM1 protein kinase (DMPK) gene expression, the composition comprising: i. an RNAi agent comprising an antisense strand having a length of 18 to 49 nucleotides that is at least partially complementary to a portion of SEQ ID NO: 1; ii. a targeting ligand linked to the RNAi agent, wherein the targeting ligand has an affinity for skeletal muscle cells; and iii. PK / PD modulators linked to RNAi agents.

57. An RNAi agent for inhibiting DM1 protein kinase (DMPK) gene expression, comprising: i. a sense strand comprising a nucleotide sequence comprising at least 15 consecutive nucleotides that differ from the stretch of 15 consecutive nucleotides of SEQ ID NO: 1 by 0, 1, 2, or 3 nucleotides; and ii. an antisense strand comprising a nucleotide sequence that is at least partially complementary to the sense strand.

58. An RNAi agent for inhibiting DM1 protein kinase (DMPK) gene expression, comprising: i. an antisense strand comprising a nucleotide sequence comprising at least 15 consecutive nucleotides that are at least partially complementary to a stretch of 15 consecutive nucleotides of SEQ ID NO: 1; and ii. A sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.

Images