Zymomonas mobilis recombinant strain for producing D-pantothenic acid as well as preparation method and application of zymomonas mobilis recombinant strain

Through genetic engineering, the reconstruction of Z. motility is constructed, and the D-pantothenic acid synthesis pathway is optimized. The problems of environmental pollution and high biological cost of chemical synthesis are solved, and efficient and low-cost D-pantothenic acid production is achieved, which is suitable for industrial applications.

CN120485087AActive Publication Date: 2025-08-15HUBEI UNIV

Patent Information

Application Number
CN202510711491.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2025-08-15
Estimated Expiration
2045-05-29

AI Technical Summary

Technical Problem

In the prior art, the production of D-pantothenic acid relies on chemical synthesis to have problems of high energy consumption and environmental pollution, while biological methods have high production costs and many by-products, which limits large-scale industrial production. As a potential production strain, Zystrophimuria lacks efficient D-pantothenic acid synthesis pathway.

Method used

Through genetic engineering, Zymotomotic animals was used to introduce specific genes panB, panE, panC, Bsals, ilvC and ilvD to construct recombinant strains, optimize metabolic pathways, enhance D-pantothenic acid synthesis ability, and weaken the degradation pathways to balance energy and material supply during metabolism.

Benefits of technology

It has achieved efficient production of D-pantothenic acid under anaerobic fermentation conditions, with a yield of 160mg/L, which has reduced production costs, met green manufacturing needs, and simultaneously produced ethanol, improving resource utilization and economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485087A_ABST
    Figure CN120485087A_ABST
Patent Text Reader

Abstract

The invention discloses a Zymomonas mobilis recombinant strain for producing D-pantothenic acid as well as a preparation method and application of the Zymomonas mobilis recombinant strain. A hydroxymethyl transferase gene panB, a ketopantoic acid reductase gene panE and a pantothenic acid synthase gene panC are integrated in a genome of the recombinant strain; an expression plasmid containing an acetolactate synthase gene Bsals, a keto acid reductoisomerase gene ilvC and a dihydroxy acid dehydratase gene ilvD is also transferred into the recombinant strain; wherein the nucleotide sequences of the gene Bsals, the gene ilvC, the gene ilvD, the gene panB, the gene panE and the gene panC are shown as SEQ ID NO. 1 to SEQ ID NO. 6 in sequence. The zymomonas mobilis ZM4 is systematically modified through a genetic engineering means, and an optimal enzyme combination adaptive to the zymomonas mobilis is defined by screening hydroxymethyltransferase, pantothenic acid synthase and ketopantoic acid reductase from different sources, so that a core foundation is laid for efficient operation of a D-pantothenic acid synthesis route, and the method has a wide application prospect. The technical bottlenecks of single metabolic pathway and low synthesis efficiency of the traditional strain are broken through.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a recombinant strain of Zymomonas mobilis that produces D-pantothenic acid, and a preparation method and application thereof. Background Art

[0002] D-pantothenic acid (vitamin B5) is a core precursor of coenzyme A and acyl carrier protein in the body, playing a key role in fatty acid metabolism, the tricarboxylic acid cycle, and cellular energy metabolism. Due to its wide range of biological functions, D-pantothenic acid is in huge demand across a variety of sectors, including medicine, food, feed, and cosmetics. According to a report by Grand View Research, the global D-pantothenic acid market is expected to reach US$650 million in 2023, with a compound annual growth rate of approximately 5.2%, demonstrating a promising market outlook.

[0003] Currently, the mainstream production of D-pantothenic acid relies on chemical synthesis, a process involving multiple reactions, such as the condensation of isobutyraldehyde and formaldehyde. This process involves high energy consumption, the separation of compounds, and the use of toxic solvents (such as cyanide). This not only increases production costs but also causes serious environmental pollution, running counter to the current trend of green manufacturing. While biological production of D-pantothenic acid, as an environmentally friendly strategy, offers the advantages of high selectivity and low energy requirements, existing metabolically engineered microorganisms, such as Escherichia coli and Bacillus megaterium, rely on aerobic fermentation, resulting in high fermentation costs and the generation of a large number of by-products, limiting large-scale industrial production.

[0004] Zymomonas mobilis, a naturally occurring ethanol-producing facultative anaerobic Gram-negative bacterium, possesses a unique ED metabolic pathway and high sugar fermentation efficiency. Its high ethanol yield, low biomass accumulation, strong ethanol tolerance, high osmotic pressure tolerance, and the absence of additional oxygen for fermentation make it an ideal industrial cell factory. In recent years, synthetic biology has driven the continuous expansion of its applications, successfully enabling the biosynthesis of a variety of high-value-added products. Importantly, the isobutanol biosynthesis pathway in Z. mobilis intersects with that of D-pantothenate. Both pathways begin with pyruvate and share the key step of converting pyruvate to α-ketoisovalerate. Furthermore, validated key enzymes provide a component library for the pantothenate biosynthesis module. Therefore, building on the established high-yield isobutanol system and metabolic engineering experience of Z. mobilis, the construction of a cell factory for D-pantothenate synthesis holds significant potential and advantages. Summary of the Invention

[0005] The main purpose of the present invention is to propose a recombinant strain of Zymomonas mobilis that produces D-pantothenic acid, as well as its preparation method and application. The present invention aims to use Zymomonas mobilis (ZM4) as the starting strain, transform the strain through genetic engineering, introduce specific exogenous genes, realize the synthesis of D-pantothenic acid in Zymomonas mobilis, and then increase the D-pantothenic acid production through a series of genetic engineering and metabolic engineering modifications.

[0006] To achieve the above objectives, the present invention provides a recombinant strain of Zymomonas mobilis for producing D-pantothenic acid, wherein the genome of the recombinant strain is integrated with the hydroxymethyltransferase gene panB, the ketopantoate reductase gene panE, and the pantothenate synthase gene panC; the recombinant strain is also transformed with an expression plasmid containing the acetolactate synthase gene Bsals, the ketoate reductoisomerase gene ilvC, and the dihydroxyacid dehydratase gene ilvD;

[0007] The nucleotide sequences of the gene Bsals, gene ilvC, gene ilvD, gene panB, gene panE and gene panC are shown in SEQ ID NO.1 to SEQ ID NO.6, respectively.

[0008] SEQ ID NO.1 (Bsals):

[0009]

[0010] SEQ ID NO.2(ilvC):

[0011]

[0012] SEQ ID NO.3(ilvD):

[0013]

[0014] SEQ ID NO.4(panB):

[0015] atgtcagccatcccttcttctaataagcgccgaactattcccgagcttcgcgcgcgtaaaggcaagtcgccgatcgttgctttaacggcttacagtgctttaaccgcccgttttgttgatccttacgccgatttcattcttgtcggggacagtcttgccatggtcgaacatggtatggcgacgactattggtgcctcgcttgatatgatgattttacatggtcaaagcgtgatgcgcggttccgagaaggccgctgtcgtcatcgacatgccttttggttcttacgaagcgagtccacaggaagcctatcataatgctgtccgtattttgtccgaaacaggatgttcagccgtaaaacttgaaggcggctctcatctcgcgcctgttatcgccttcctcacagcacgaggggtgccggttatggggcatattgggttgacgcctcaatatgttcagactttgggcggtttcaaaatacaaggccatagctcggaacaacaagacaagattaaacaggatgctcttgattttgaggccgccggtgctttttccgtcgtgctagaaggggtgaccgaaccgcttgcccgtgaaattacggataatatcgcgataccaacgattggtatcggtgcctcttcttattgtgatggccaagttttggttttggaagatatgctgggcttcaatgacaaggtgccgcgtttcgtcaaaaaatttgctcatcttggggatgacatcaaaaaagcggtttcagactatgccactgcggtttcaaatcgtagttttccagcagaagacaacatctacaggccaaaatcttaa

[0016] SEQ ID NO.5(panE):

[0017] Atgaaaattgcgatcgttggcgctggtgcagttggtggatatttcggagcgttgttacaagaatctggtgcagatatcacgatggttgcacgtggacgaacattagaagccttgaagtctaaaggactccacatcaacgatgcaagaggcgaacgctacgtaccaattcctgcagttgcgagcgtgcaagaactaaaagatgcagatgtagtgatgattgctactaaagcattatcgctgtcctcagatctcgctgaacttttgggtgggatacctgcgaattcggtggtcgcgattactcagaattcgattgaaactgctgatctagcagcgaagagtatcggtgctgatcgtgtgtggcctggtgtggttcgtgggttctttgttcatgaggggccagcctcagtgtcatacaagggaggcccactgtcctacacgtttggtgattctggtgaactttctaggcaattcgcaagcactcttgaacaggccggtattgacggagttctgcatcccgatattttggtggatgtgtgggagaaagccatgttcgtagaggttttcggcgggttgggggctttcgtcgaaaagcaattaggtaccttgcgtacgcattttagggcttccctggaagccttgatggaagaggtggctgaggtggctcgcgcagcaggtgttgcgttgccgagcgatgcggtggagcgcaccatgaattttacggatcggatgcctgagaattcgacgagttcgatgcagcgtgatttggccgcgggagtggctagtgagcttgaggctcagacaggtgcaattgtgcgggcagcacacaaagtgggtgtgaaaactccgcttcatgaccttatttatgctggtcttaagctgaaagaagaggaaaattcactttag

[0018] SEQ ID NO.6(panC):

[0019] ttgctcgttattcataccatagccgaacttcgcgcccatcttgatgaacatcgccaaaatcgccgcaaaattggcttggtgcctacaatgggtttcttacatcaaggacatatggccttagcgcaaaaagcgagggaagaatctgatgtggtggtgcttagtatttttgttaacccgatacagttcggcgttaatgaagatctcgatgtttacccaagagatttacctcacgacatcgcgttatgtaaagaaaatggggtagatatcatttttgcgccttcggtggctgaaatctatccagaaccgataatgacctcggtcgaggttcaatcactttccaatattttgattggtcgtcatcgtcccaatcatttccgtggcgtgacgacgatcgtcgcaaagttattgaatattgtcgaacccgataagattattttcggagaaaaggactatcaacagcttattatagtccgtcggatgatccgtgatctttcctacaaagccgaagtgattggggtgccgatagttcgtgaaaaggacggcttggcctgttcttcgcgcaatgcaagattgaccaaagaagatcgcgctgcggcggtcattctttcgcaatccttgaaaaaagcccaaaaaaggattttggaaggcgaaaaagatgtctccactatccgccagttaatagaagacgatatcaaaagcgaagcacgggcaaaaattcaatctattgatatctgccatgctacaaaattagatactctcgacaggatagataatcagccgattgttattctactcgctgtcgcttttggtgacgtcgttctgatcgatcagcagctcgttacgcccaaggagaaagcgctctaa

[0020] Preferably, the genes Bsals, ilvC and ilvD are expressed through the pEZ15A vector to obtain plasmid A4, and are expressed using the inducible promoter Ptet.

[0021] Preferably, the genes panB and panC are derived from any one of panB1-panC endogenous to Zymomonas mobilis, panB2-panC endogenous to Zymomonas mobilis, EcpanB-EcpanC of Escherichia coli, and CgpanB-CgpanC of Corynebacterium glutamicum.

[0022] Preferably, the genes panB and panC are derived from endogenous panB2-panC of Zymomonas mobilis.

[0023] Preferably, the gene panE is derived from any one of EcpanE of Escherichia coli, CgpanE of Corynebacterium glutamicum, BspanE of Bacillus subtilis and BlpanE of Bacillus licheniformis.

[0024] Preferably, the gene panE is derived from CgpanE of Corynebacterium glutamicum.

[0025] Preferably, the recombinant strain further comprises overexpression of the key enzyme in serine synthesis, phosphoglycerate dehydrogenase gene serA and overexpression of the serine hydroxymethyltransferase gene glyA.

[0026] Preferably, the recombinant strain further comprises weakening the expression of the pantothenate kinase coaA gene in the D-pantothenic acid degradation pathway;

[0027] Overexpression of the endogenous glucose-6-phosphate dehydrogenase gene zwf of Zymomonas mobilis;

[0028] The heterologous aspartate decarboxylase gene panD from Corynebacterium glutamicum was introduced.

[0029] The present invention also provides a method for constructing a recombinant strain of Zymomonas mobilis for producing D-pantothenic acid, characterized in that it comprises the following steps:

[0030] S1, construct expression plasmid;

[0031] S2. transforming the expression plasmid into Zymomonas mobilis to obtain transformants;

[0032] S3. Construct editing plasmids and homologous recombination plasmids, and integrate the screened genes and strategies into the relevant sites of the Zymomonas mobilis genome.

[0033] The present invention also provides an application of the recombinant strain in producing D-pantothenic acid.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] (1) The present invention systematically transforms ZM4 through genetic engineering, and innovatively screens the three key enzyme genes (panB, panE, and panC) in the D-pantothenic acid synthesis pathway based on the pyruvate to α-ketoisovalerate bioconversion module. By using the dual-plasmid co-expression system of the pEZ15A vector (A4 plasmid) and the 39P plasmid, the carbon flow distribution is precisely regulated to ensure sufficient carbon flux in the acetolactate pathway while successfully constructing a recombinant strain with the ability to synthesize D-pantothenic acid. This process identifies the optimal enzyme combination adapted to ZM4 by screening hydroxymethyltransferases, pantothenate synthases, and ketopantoate reductases from different sources, laying the core foundation for the efficient operation of the D-pantothenic acid synthesis pathway and breaking through the technical bottleneck of the traditional strains with a single metabolic pathway and low synthesis efficiency.

[0036] (2) The present invention achieves an increase in D-pantothenic acid production through a multi-dimensional modular optimization strategy. First, the expression efficiency of the target gene is enhanced by targeting the promoter of the key enzyme gene; second, the cofactor NADPH supply-related genes and one-carbon unit supply-related genes are overexpressed to accurately balance the energy and material supply in the metabolic process; at the same time, by weakening the D-pantothenic acid degradation pathway and supplementing the endogenously missing β-alanine synthesis pathway, the product loss is effectively reduced and the accumulation of D-pantothenic acid is increased. After integration and optimization, the strain can synthesize 120mg / L of D-pantothenic acid by anaerobic fermentation in pure glucose medium, and the yield is increased to 220mg / L under the condition of supplementing β-alanine. Through strategy integration, a stable synthesis level of 160mg / L is finally achieved, which is significantly better than similar research results, showing the significant advantages of modular metabolic engineering in improving the synthesis efficiency of microorganisms.

[0037] (3) The present invention uses Zymomonas mobilis as a facultative anaerobic microorganism, and its unique metabolic characteristics give the recombinant strain significant industrial application potential. During the anaerobic fermentation process, there is no need for additional oxygen introduction and supporting complex equipment such as stirring, ventilation and sterilization, which greatly reduces the energy consumption and equipment investment costs in the fermentation process, and meets the development needs of green biomanufacturing. In addition, the strain can simultaneously produce ethanol while synthesizing D-pantothenic acid, and the metabolic pathways of the two do not interfere with each other. The ethanol production is not affected by the synthesis of D-pantothenic acid. This multi-product co-production characteristic further improves the economic benefits and resource utilization of the fermentation process. The successful construction of this strain provides a new technical path for the low-cost and efficient industrial production of D-pantothenic acid, and is expected to promote industrial upgrading and sustainable development in related biochemical fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0039] Figure 1 The diagram (A) shows the construction of the recombinant strains DPA-0, DPA-1, DPA-2, DPA-3 and DPA-4 of the present invention and their D-pantothenic acid production diagram (B).

[0040] Figure 2 The diagram (A) shows the construction of the recombinant strains DPA-2, DPA-6, DPA-7 and DPA-8 of the present invention and their D-pantothenic acid production diagram (B).

[0041] Figure 3 The diagram (A) shows the construction of the recombinant strains DPA-11, DPA-12, DPA-13, DPA-14, DPA-15 and DPA-16 of the present invention and their D-pantothenic acid production diagram (B).

[0042] Figure 4 The diagram (A) shows the construction of the recombinant strains DPA-17, DPA-18, DPA-19 and DPA-20 of the present invention and their D-pantothenic acid production diagram (B).

[0043] Figure 5 The diagram (A) shows the construction of the recombinant strains DPA-9, DPA-21 and DPA-22 of the present invention and their D-pantothenic acid production diagram (B).

[0044] Figure 6 The diagram (A) shows the construction of the recombinant strains DPA-9 and DPA-23 of the present invention and their D-pantothenic acid production diagram (B).

[0045] Figure 7 The diagram (A) shows the construction of the recombinant strains DPA-26, DPA-27 and DPA-28 of the present invention and their D-pantothenic acid production diagram (B).

[0046] Figure 8 The diagram (A) shows the construction of the recombinant strains DPA-A1, DPA-A2, DPA-A3, DPA-A4 and DPA-A5 of the present invention and their D-pantothenic acid production diagram (B).

[0047] Figure 9 The diagram (A) shows the construction of the recombinant strains DPA-A5, DPA-A8, and DPA-A9 of the present invention, and their D-pantothenic acid production diagram (B).

[0048] The purpose, features and advantages of the present invention will be further described with reference to the accompanying drawings and in conjunction with the embodiments. DETAILED DESCRIPTION

[0049] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. If specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. If the reagents or instruments used are not specified by the manufacturer, they are all conventional products that can be purchased commercially. In addition, the technical solutions between the various embodiments can be combined with each other, but must be based on the ability of ordinary technicians in this field to achieve. When the combination of technical solutions is mutually contradictory or cannot be achieved, it should be considered that the combination of such technical solutions does not exist and is not within the scope of protection required by the present invention. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0050] The present invention uses Zymomonas mobilis ZM4 as the starting strain and first transforms the strain through genetic engineering. Based on the established and validated pyruvate-to-α-ketoisovalerate bioconversion module (comprising the als, ilvC, and ilvD catalytic elements), heterologous screening was performed for the genes encoding the last three key enzymes in the D-pantothenate biosynthesis pathway (panB, panE, and panC). It should be noted that, based on the results of the isobutanol research project, the pEZ15A vector expressing the Bsals, ilvC, and ilvD gene cluster (designated the A4 plasmid) is required to ensure sufficient carbon flux through the acetolactate pathway. Therefore, in this study, the A4 plasmid was also used to express the genes for the pyruvate-to-α-ketoisovalerate pathway (Bsals, ilvC, and ilvD) to ensure carbon flow, and the 39P plasmid was used to express the genes for the α-ketoisovalerate-to-D-pantothenate pathway (panB, panE, and panC). Co-expression of the two plasmids generated a strain capable of producing D-pantothenate, and the D-pantothenate content was measured to identify the optimal enzymes in the synthesis pathway. D-pantothenate accumulation was then gradually increased by optimizing the promoters of key enzyme genes, overexpressing genes related to the supply of the cofactor NADPH, overexpressing genes related to the supply of one-carbon units, weakening the D-pantothenate degradation pathway, and complementing the β-alanine synthesis pathway.

[0051] The technical solutions of the present invention are further described in detail below in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.

[0052] Example 1 Analysis and Screening of Hydroxymethyltransferase and Pantothenate Synthase

[0053] By screening and introducing key enzyme genes, panB and panC, into Zymomonas mobilis, the biosynthetic pathway from α-ketoisovalerate to D-pantothenate can be enhanced, thereby increasing the accumulation of the target product. The panB and panC genes screened in this invention include two endogenous genes, panB1-panC and panB2-panC, from Z. mobilis, EcpanB-EcpanC from Escherichia coli, and CgpanB-CgpanC from Corynebacterium glutamicum. These enzyme genes were amplified by PCR and inserted into a 39P vector for co-expression and screening. Simultaneously, an A4 plasmid expressing the Bsals, ilvC, and ilvD gene clusters under the inducible promoter Ptet was electroporated into wild-type Z. mobilis ZM4 to construct the DPA-0 strain as a control strain. 39P plasmids containing the panB and panC genes from these different sources were then electroporated into the DPA-0 strain to generate strains DPA-1, DPA-2, DPA-3, and DPA-4, respectively. The recombinant strain was tested in shake flask fermentation. During the fermentation process, 0.5ug / mL tetracycline was added to induce gene expression on the A4 plasmid, and 2g / L β-alanine was added exogenously as a precursor for D-pantothenic acid synthesis. Figure 1 As shown, strain DPA-2 had the highest yield, reaching 40 mg / L. PanB2 and panC, endogenous to Zymomonas mobilis, exhibited the best catalytic activity. The nucleotide sequences of genes Bsals, ilvC, ilvD, panB, panE, and panC are shown in SEQ ID NOs. 1 to 6, respectively.

[0054] Example 2 Screening and Optimization of Rate-Limiting Enzyme panB2-panC Gene Promoter Expression

[0055] By optimizing the promoter, the expression level of the target gene can be increased, thereby increasing the yield of the target product. Therefore, in order to optimize the D-pantothenic acid synthesis pathway and increase the yield of D-pantothenic acid, this study screened and optimized the panB2-panC gene expression cassettes. In addition, in previous studies of Zymomonas mobilis, a promoter system library with different strengths was constructed based on omics datasets. Therefore, four constitutive strong promoters were selected from the promoter system library for optimization and comparison, including Pgap, Pgap6M, Peno, and Ppdc. The panB2-panC gene expression cassette was inserted into the 39P vector and expressed using Pgap6M, Pgap, and Ppdc promoters, respectively, to obtain expression plasmids. The above-constructed plasmids were then electroporated into the DPA-0 strain to obtain DPA-6, DPA-7, and DPA-8 strains. These strains were tested in shake flask fermentation with the DPA-2 strain, and the fermentation results are shown in the figure below. Figure 2As shown in the figure, DPA-6 strain had the highest yield, reaching 50 mg / L. Therefore, using the Pgap6M promoter to express the panB2-panC gene expression cassette is more conducive to the synthesis of D-pantothenic acid in Z. mobilis.

[0056] Example 3 Analysis and Screening of Ketopantoate Reductase

[0057] panE, the gene encoding ketopantoate reductase, is absent from the Z. mobilis genome. This may be due to the evolutionary replacement of isoenzymes. For example, the ketoate reductoisomerase encoded by ilvC can perform the function of ketopantoate reductase. In this study, panE genes from various sources were constructed, including EcpanE from Escherichia coli, CgpanE from Corynebacterium glutamicum, BspanE from Bacillus subtilis, and BlpanE from Bacillus licheniformis. These genes were then compared with the endogenous ilvC gene from Z. mobilis and the FtpanG gene from Francisella licheniformis. Based on the panB2-panC genes identified in the previous screening step, the panB, panE, and panC genes were assembled into a single expression cassette in the order of the metabolic pathway and inserted into a 39P vector. This recombinant plasmid was electroporated into the DPA-0 strain, resulting in strains DPA-11, DPA-12, DPA-13, DPA-14, DPA-15, and DPA-16, respectively. These recombinant strains were fermented in shake flasks, and the fermentation results were as follows: Figure 3 As shown, the DPA-12 strain had the highest yield, reaching 58 mg / L. Compared with the results in Example 1, the yield of the DPA-12 strain was 18 mg / L higher than that of the DPA-2 strain, an increase of nearly 50%. That is, the introduction of ketopantoate reductase can effectively increase the production of D-pantothenic acid, and CgpanE from Corynebacterium glutamicum showed the best catalytic activity.

[0058] Example 4 Screening and Optimization of Rate-Limiting Enzyme CgpanE Gene Promoter Expression

[0059] In order to optimize the D-pantothenic acid synthesis pathway and increase the production of D-pantothenic acid, this study screened and optimized the promoter of the panE gene. In previous studies of Zymomonas mobilis, a promoter system library with different strengths was constructed based on omics datasets. Therefore, four constitutive strong promoters were selected from the promoter system library for optimization and comparison, including Peno, Ppdc, Ptuf and Pzwf. The panE genome was inserted into the 39P vector and expressed using Peno, Ppdc, Ptuf and Pzwf promoters to obtain expression plasmids. The panB2-panC gene was integrated into the 1650 site of the genome of strain DPA-0 to obtain the DPA-9 strain. The D-pantothenic acid accumulation of the DPA-9 strain was basically the same as that of the DPA-2 strain. The above plasmids were then transferred into the DPA-9 strain to obtain the DPA-17, DPA-18, DPA-19 and DPA-20 strains. These strains were subjected to shake flask fermentation tests, and the fermentation results are shown in the figure below. Figure 4 As shown in the figure, strain DPA-18 had the highest yield, reaching 70 mg / L. Therefore, using the Ppdc promoter to express the panE gene is more conducive to the synthesis of D-pantothenic acid in Z. mobilis.

[0060] Example 5: Enhancing One-Carbon Unit Supply to Increase D-Pantothenic Acid Accumulation

[0061] Hydroxymethyltransferase PanB is the rate-limiting enzyme in the D-pantothenic acid synthesis pathway. This step of the reaction is affected by the supply of one-carbon units, which are reversibly generated by 5,10-CH2-THF and serine under the catalysis of serine hydroxymethyltransferase. In this study, the key enzyme gene serA in serine synthesis and the serine hydroxymethyltransferase gene glyA were overexpressed to increase the supply of one-carbon units, thereby increasing the production of D-pantothenic acid. Based on the DPA-9 strain, the serA and glyA genes were expressed with Peno and integrated into the 0038 site of the genome using the homologous recombination method to obtain the DPA-21 strain and the DPA-22 strain. It was subjected to shake flask fermentation test with the DPA-9 strain, and the fermentation results are as follows. Figure 5 As shown, compared to the DPA-9 strain, the yield of the DPA-21 strain remained essentially unchanged, while the yield of the DPA-22 strain increased significantly, and D-pantothenic acid accumulation further increased with increasing concentrations of exogenously added serine. This suggests that simply overexpressing the serA gene, a key enzyme in serine biosynthesis, cannot provide the strain with sufficient one-carbon units; overexpressing serine hydroxymethyltransferase can increase the supply of one-carbon units to enhance D-pantothenic acid accumulation, and that with the supplementation of the substrate serine, the availability of one-carbon units increases, leading to increased D-pantothenic acid accumulation.

[0062] Example 6: Weakening the degradation pathway to enhance D-pantothenic acid accumulation

[0063] The main degradation pathway of D-pantothenic acid in prokaryotes is its conversion into coenzyme A under the catalysis of pantothenate kinase CoaA; ideally, the degradation pathway of D-pantothenic acid should be weakened rather than blocked. Therefore, in this study, based on the characteristics of the influence of start codon preference on gene expression levels, the activity of CoaA enzyme was reduced to increase D-pantothenic acid accumulation. The start codon of the coaA gene of the DPA-9 strain was replaced by the highly preferred ATG to the low-preferred GTG through homologous recombination to achieve the purpose of reducing pantothenic acid kinase activity and increasing D-pantothenic acid accumulation, thus obtaining the DPA-23 strain; it was subjected to shake flask fermentation test with the DPA-9 strain, and the fermentation results are shown in Figure 2. Figure 6 As shown, compared to the DPA-9 strain, the DPA-23 strain significantly increased its yield, with D-pantothenate accumulation reaching 60 mg / L, a 50% increase. This indicates that weakening the D-pantothenate degradation pathway can effectively increase D-pantothenate accumulation. The nucleotide sequence of the pantothenate kinase coaA gene is shown in SEQ ID NO. 7.

[0064] SEQ ID NO.7 (pantothenate kinase coaA):

[0065] atgctgctcgctattgatgccggcaatacaaatatagtttttgcgttggtcgatgggcgggaaattcgggcgcgatggcggattgctacagaaggtcggcggacagcagatgaatatgccgtttggctagtacagctaatggctatcggaggatttacacgcgaagaaattgatagtgtcgttatttgcaccgtagttccgcggacgttacataatcttgaggtcttatcggccaaatatttcggggtgaaagccttgattgccggaacgccgcctttggattgggggattgatattgatgttatcagtcctgaaacggtgggcgcggatcggttggttaatgcgttggccgcgcatcaccttcattccggccataaaatagcgattgatttcggaaccgcgacaacttttgactgggtggatgaaaaaggggcttatcgtggagggattattgccccgggtattaacctgtccttggatgccttggtcggaaaagcggctcgcttgccgcgtatcgcgatcgagataccaaaaacggacagtgtaatcggccgtagcaccgaagaaagtatgcatagcggtatctattggggatatatcgctatgattgaaggcttaaccgagaggatgaaacaggaaataggacagcctgtgactgtgatcgcgaccggtggtctggcctctctctttgcggtccatacgtctgtttttgacgtgatcgagcctgatttgactattcgagggatggcgctcctttacgaacagaaagcgccaacgaaattcactgcgcattccggtgggtttgccgcagattttagccccctgtaa

[0066] Example 7 Intracellular Cofactor NADPH Balance to Enhance D-Pantothenic Acid Accumulation

[0067] In the D-pantothenic acid biosynthesis pathway, the synthesis of 1 mol of D-pantothenic acid requires 2 mol of NADPH. NADPH is continuously consumed in reactions catalyzed by ketoate reductoisomerase and ketopantoate reductase, resulting in intracellular redox imbalance. Therefore, adjusting the intracellular redox balance can effectively improve D-pantothenic acid biosynthesis. The genes ppnK and zwf encode NAD+ kinase and glucose-6-phosphate dehydrogenase, respectively. NAD+ catalyzes the conversion of NAD+ to NADP+, ultimately facilitating the conversion of NADH to NADPH. Glucose-6-phosphate dehydrogenase participates in the conversion of glucose-6-phosphate to ribose-5-phosphate and converts NADP+ to NADPH. Therefore, overexpressing the ppnK and zwf genes, respectively, was chosen to enhance D-pantothenic acid accumulation through cofactor balancing. Based on the DPA-9 strain, the CgpanE gene was integrated into the genomic locus 0038 by homologous recombination to generate the DPA-26 strain. In addition, the ppnK and zwf genes were overexpressed at the 0038 locus of the genome after the CgpanE gene using RBS to obtain DPA-27 and DPA-28 strains. They were tested with DPA-26 strains in shake flask fermentation. The fermentation results are shown in Figure 2. Figure 7 As shown, compared to strain DPA-26, only strain DPA-28 showed a significant increase in yield, by approximately 85%. Overexpressing the endogenous glucose-6-phosphate dehydrogenase in Z. mobilis enhances NADPH supply and balances intracellular redox capacity, effectively increasing D-pantothenic acid production. The nucleotide sequence of the glucose-6-phosphate dehydrogenase gene zwf is shown in SEQ ID NO. 8; the nucleotide sequence of the heterologous aspartate decarboxylase gene panD is shown in SEQ ID NO. 9.

[0068]

[0069] SEQ ID NO. 9 (aspartate decarboxylase panD from Corynebacterium glutamicum): atgctgcgcaccatcctcggaagtaagattcaccgagctactgtcactcaagctgatctagattatgttggctctgtaaccatcgacgccgacctggttcacgccgccggattgatcgaaggcgaaaaagttgccatcgtagacatcaccaacggcgctcgtctggaaacttatgtcattgtgggcgacgcc ggaacgggcaatatttgcatcaatggtgccgctgcacaccttattaatcctggcgatcttgtgatcatcatgagctaccttcaggcaactgatgcggaagctaaggcgt atgagccaaagattgtgcacgtggacgccgacaaccgcatcgttgcgctcggcaacgatcttgcggaagcgctacctggatccgggcttttgacgtcgagaagcatttag

[0070] Example 8 Combining different strategies to increase D-pantothenic acid production

[0071] In order to further increase the yield of the target product, a variety of effective modular strategies can be combined to maximize the product yield. In this study, modular strategies that effectively increase the accumulation of D-pantothenic acid, such as key enzyme gene screening, promoter screening optimization, cofactor NADPH supply, one-carbon unit supply and degradation pathway weakening, have been completed. These strategies are now integrated into the ZM4 background strain in turn to obtain DPA-A1, DPA-A2, DPA-A3, DPA-A4, and DPA-A5 strains. The construction strategies of each strain are shown in Table 1 below. Fermentation results are shown in Table 1. Figure 8 As shown, with the integration of these effective strategies, the accumulation of D-pantothenic acid gradually increased, from no product accumulation in the ZM4 strain at the beginning to 160 mg / LD-pantothenic acid in the DPA-A5 strain.

[0072] Table 1 Strain construction strategy

[0073] strain DPA-A1 DPA-A2 DPA-A3 DPA-A4 DPA-A5 PanBC + + + + + PanE + + + + coaA + + + glyA + + zwf +

[0074] Example 9 Completion of the β-alanine pathway to synthesize D-pantothenic acid

[0075] Pantothenic acid and β-alanine are two important precursors for the synthesis of D-pantothenic acid. However, Zymomonas mobilis is a β-alanine-deficient strain. Therefore, this study introduced and screened heterologous panD genes from Escherichia coli and Corynebacterium glutamicum in Zymomonas mobilis. Based on the DPA-A5 strain, the EcpanD and CgpanD genes were expressed by Peno and integrated into the 0038 site of the genome by homologous recombination to obtain the DPA-A8 strain and the DPA-A9 strain; these two strains were subjected to shake flask fermentation tests under two different conditions: no exogenous addition and normal addition of β-alanine. The fermentation results are shown in the figure. Figure 9 As shown, even without the addition of β-alanine, the strain can accumulate a certain concentration of D-pantothenic acid; the addition of β-alanine further increases the concentration, with the DPA-A9 strain reaching the highest concentration to date, approximately 220 mg / L. The heterologous panD gene was successfully introduced into Zymomonas mobilis, leading to D-pantothenic acid accumulation. The CgpanD gene from Corynebacterium glutamicum exhibited even greater activity.

[0076] Example 10 Construction, Optimization Process and Product Detection of the Highest Yield Strain DPA-A9

[0077] 1. Plasmid construction

[0078] In this example, the construction and optimization process of the highest-yielding strain, DPA-A9, is described in detail. Plasmid and strain construction uses DPA-2 as an example. First, a D-pantothenate biosynthesis pathway was established in ZM4. The inducible promoter Ptet was used to drive the tandem expression of the three genes, Bsals, ilvC, and ilvD, to create an operon. This operon was then constructed into plasmid pEZ15A to generate plasmid A4. The panB and panC genes were inserted into the 39P vector for co-expression. The target fragment amplification primers included:

[0079] TY-panB2-F:tttaagaaaggtttcgatatgtcagccatcccttcttctaataagc

[0080] TY-(RBS2)-panB2-R:tttctcctctttaatttaagatttggcctgtagatgttgtcttct

[0081] TY-(RBS2)-panC-F:attaaagaggagaaattgctcgttatcataccatagccga

[0082] TY-panC-R:gcagcggccgctactagtttagagcgctttctccttgggc

[0083] The panB-panC DNA fragments were ligated into a single fragment using overlap PCR. This fragment was then transformed into competent E. coli DH5α cells using the Gibson assembly method with the 39P vector backbone. Positive clones on the plates were verified by PCR, and the plasmids were extracted after overnight culture (plasmid extraction followed the standard protocol of a plasmid extraction kit). To improve electroporation efficiency, the plasmids from the target E. coli DH5α strain were extracted and transformed into competent demethylated E. coli trans110 cells. Positive clones on the plates were verified by PCR, and the plasmids were extracted after overnight culture.

[0084] To construct the plasmid, mix the fragment and vector in a 3:1 ratio. After preparing the reaction system according to the table below, incubate on ice for 5 minutes. Then, add competent cells and perform chemical transformation. Screen using spectinomycin-resistant plates (100 μg / mL). Single colonies are picked and verified by PCR using appropriate primers. The PCR amplification program is as follows: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 55°C for 10 seconds, and extension at 72°C for 80 seconds, for a total of 30 cycles. Band sizes consistent with expectations are verified by sequencing.

[0085]

[0086] 2. Construct the recombinant plasmid into the target Zymomonas mobilis

[0087] (1) Preparation of competent Zymomonas mobilis strain

[0088] Use an inoculation loop to pick an appropriate amount of Zymomonas mobilis ZM4 glycerol bacteria and streak it on an RMG5 solid medium (RMG5: 50 g / L glucose, 10 g / L yeast extract, 2 g / L KH2PO4, 3 g / L agar) plate, and invert and culture at 30°C for 2 to 3 days to activate; pick the activated single colony and transfer it to about 10 mL of RMG5 (RMG5: 50 g / L glucose, 10 g / L yeast extract, 2 g / LKH2PO4) liquid medium, and culture it at 30°C until the mid-logarithmic phase to use as seed liquid; transfer the seed liquid to a 50 mL centrifuge tube containing 40 mL of RMG5 liquid medium, and control the initial OD between 0.025 and 0.03. The cells were cultured at 30°C until the OD was between 0.4 and 0.6; the centrifuge tube containing the bacterial solution was centrifuged at 4000 rpm / min for 10 min to collect the bacteria and discard the supernatant; 40 mL of pre-cooled sterile water was added to the centrifuge tube to resuspend the washed bacteria, mixed evenly, and centrifuged at 4000 rpm / min for 10 min to discard the supernatant; 40 mL of pre-cooled 10% glycerol was added to the centrifuge tube to resuspend the washed bacteria, mixed evenly, centrifuged at 4000 rpm / min for 10 min to discard the supernatant, and this step was repeated once; 1% (volume ratio) of pre-cooled 10% glycerol was added to resuspend the bacteria, mixed slowly and evenly, and then aliquoted on ice, each 50 μL was dispensed into a sterile 1.5 mL centrifuge tube, quick-frozen in liquid nitrogen, and stored at -80°C.

[0089] (2) Transform the recombinant plasmid into the target Zymomonas mobilis competent cells

[0090] Thaw Zymomonas mobilis ZM4 competent cells on ice. Transfer 50 μL of the culture to an electroporation cuvette and add 1 μg of plasmid (A4 plasmid followed by 39P plasmid). Electroporation conditions are 1600 V, 25 μF, and 200 Ω. After electroporation, thaw the cells in RMG5 liquid medium in a 30°C incubator. Spread 100 μL of the culture, recovered after 4-6 hours, onto a 100 μg / mL spectinomycin-resistant plate and incubate at 30°C for 2 days.

[0091] After colonies have grown, the recombinant strains were tested by colony PCR. The PCR amplification program was set as follows: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 55°C annealing for 10 s, and 72°C extension (set at 10 s / kb according to the fragment length) for a total of 30 cycles; after the cycle reaction, the temperature was maintained at 72°C for 3 min. The reaction system was as follows:

[0092]

[0093] The correct positive clones were activated in RMG5 (containing 100 μg / mL spectinomycin) medium and maintained in 60% glycerol.

[0094] 3. Homologous recombination genomic integration

[0095] By setting up two homologous arms on the pUC homologous recombination plasmid, and the combined action of a resistance gene (for easy recombinant screening) and a specific sequence (the gene sequence to be integrated) between the homologous arms, editing of the target gene can be achieved. Homology arm design: Recommended length: 1000bp (GC content ~50%, completely matching the target site); Primer design: Avoid secondary structure, Tm value ≥ 60°C. Transform into competent E. coli DH5α cells via Gibson assembly, PCR verification of positive clones on the plate, and extraction of the plasmid after overnight culture (plasmid extraction follows the standard procedures of the plasmid extraction kit). According to the above method, the homologous recombination plasmid is electroporated into the strain to achieve editing.

[0096] 4. Strain shake flask fermentation test

[0097] Aseptically inoculate 5 μL of glycerol stock culture onto RMG solid medium supplemented with the appropriate antibiotic using the streak method. Activate the culture in a 30°C inverted incubator for 48-72 hours. Aseptically select a single colony with typical morphology and inoculate it into 2 mL of RMG5 liquid medium. Primary amplification is performed in a 30°C shaking incubator (250 rpm). When the strain reaches mid-logarithmic growth, harvest the cells by centrifugation at 8,000 rpm for 2 minutes. Add the appropriate volume of culture to 40 mL of RMG5 medium supplemented with the appropriate tetracycline concentration (0.5 μg / mL) and 2 g / L β-alanine, achieving an initial OD600 of approximately 0.1. Incubate the culture in triplicate at 30°C in a shaker at 100 rpm. After 48 hours, sample the culture and centrifuge at 12,000 rpm for 2 minutes. Collect the supernatant. Filter the supernatant through a 0.22 μm filter into a 2 mL EP tube and store at -80°C until needed.

[0098] 5. HPLC detection of fermentation products

[0099] Agilent ZORBAX XDB-C18 (4.6 × 250 mm 5 μm) column was used, and the mobile phase was ultrapure water containing 0.1% phosphoric acid and 5% acetonitrile (V 超纯水 :V 磷酸 :V 乙腈 =949:1:50), elution conditions were isocratic elution, column temperature 30°C, flow rate 0.9 mL / min, time 15 min, detection wavelength 200 nm. The product D-pantothenic acid was detected at around 8 min.

[0100] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Those skilled in the art will readily appreciate that the present invention is susceptible to various modifications and variations. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of the present invention.

Claims

1. A recombinant strain of Zymomonas mobilis for producing D-pantothenic acid, characterized in that: The genome of the recombinant strain is integrated with the hydroxymethyltransferase gene panB, the ketopantoate reductase gene panE, and the pantothenate synthase gene panC; the recombinant strain is also transformed with an expression plasmid containing the acetolactate synthase gene Bsals, the ketoacid reductoisomerase gene ilvC, and the dihydroxyacid dehydratase gene ilvD; The nucleotide sequences of the gene Bsals, gene ilvC, gene ilvD, gene panB, gene panE and gene panC are shown in SEQ ID NO.1 to SEQ ID NO.6, respectively.

2. The recombinant strain according to claim 1, characterized in that The gene Bsals, gene ilvC and gene ilvD are expressed through a pEZ15A vector to obtain a plasmid A4, which is expressed using an inducible promoter Ptet.

3. The recombinant strain according to claim 1, characterized in that The genes panB and panC are derived from any one of panB1-panC endogenous to Zymomonas mobilis, panB2-panC endogenous to Zymomonas mobilis, EcpanB-EcpanC of Escherichia coli, and CgpanB-CgpanC of Corynebacterium glutamicum.

4. The recombinant strain according to claim 3, characterized in that The genes panB and panC are derived from panB2-panC endogenous to Zymomonas mobilis.

5. The recombinant strain according to claim 1, characterized in that The gene panE is derived from any one of EcpanE of Escherichia coli, CgpanE of Corynebacterium glutamicum, BspanE of Bacillus subtilis, and BlpanE of Bacillus licheniformis.

6. The recombinant strain according to claim 5, characterized in that The gene panE is derived from CgpanE of Corynebacterium glutamicum.

7. The recombinant strain according to claim 1, characterized in that The recombinant strain also includes over-expression of phosphoglycerate dehydrogenase gene serA, a key enzyme in serine synthesis, and over-expression of serine hydroxymethyltransferase gene glyA.

8. The recombinant strain according to claim 1, characterized in that The recombinant strain further comprises weakening the expression of the pantothenate kinase coaA gene in the D-pantothenic acid degradation pathway; Overexpression of the endogenous glucose-6-phosphate dehydrogenase gene zwf of Zymomonas mobilis; The heterologous aspartate decarboxylase gene panD from Corynebacterium glutamicum was introduced.

9. A method for constructing a recombinant strain of Zymomonas mobilis for producing D-pantothenic acid as claimed in claim 1, characterized in that: The following steps are involved: S1, construct expression plasmid; S2. transforming the expression plasmid into Zymomonas mobilis to obtain transformants; S3. Construct editing plasmids and homologous recombination plasmids, and integrate the screened genes and strategies into the relevant sites of the Zymomonas mobilis genome.

10. Use of the recombinant strain according to claim 1 in producing D-pantothenic acid.

Citation Information

Patent Citations

  • Genetic engineering bacteria capable of producing pantothenic acid at high yield without addition of beta-alanine, construction and application of genetic engineering bacteria

    CN109913398A

  • Zymomonas mobilis recombination strain producing isobutanol, construction method and application thereof

    CN110358720A

  • Genetically engineered bacterium of high-yield D-pantothenic acid, construction method and application

    CN114276972A

Cited By

  • Engineering bacterium for producing D-pantothenic acid as well as construction method and application of engineering bacterium

    CN121874001A