SSR molecular marker primer of symplocos paniculata resource and application of SSR molecular marker primer

Abstract

The invention discloses an SSR (Simple Sequence Repeat) molecular marker primer combination of a symplocos paniculata resource and application of the SSR molecular marker primer combination, and an SSR molecular marker which can be used for identifying a symplocos paniculata germplasm resource source (provenance) is obtained by analyzing symplocos paniculata germplasm resource samples in different regions. The SSR molecular marker primer group comprises 10 pairs of primers which are high in polymorphism, stable in amplification result, high in specificity and good in universality, and the DNA digital fingerprint spectrum of the symplasm resources of the symplasm is constructed by utilizing the SSR molecular marker primer group and based on the SSR molecular marker primer group. The method has important technical guidance significance for identification of a paniculate sandalwood seed source, analysis of genetic diversity, construction of a genetic linkage map and the like, and introduction and collection of paniculate sandalwood germplasm resources, accurate identification and breeding of good varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of SSR molecular markers, and in particular relates to an SSR molecular marker primer for sandalwood resources and an application thereof. Background Art

[0002] White sandalwood ( Symplocos paniculata Thunb. Miq. is a deciduous shrub or small tree of the Asteraceae family. Also known as sandalwood, cardamom tree, tea flower, and blackberry tree, it is a deciduous shrub or small tree. White sandalwood has a well-developed root system, strong resistance to adversity, and vigorous growth. It is widely distributed in East my country, South China, Central China, North China, Jilin and Liaoning in the southwest and northeast, and Gansu and Shaanxi in the northwest. The fruit of white sandalwood is rich in oil, with a whole fruit oil content exceeding 30% and an oil yield exceeding 20%. The content of unsaturated fatty acids such as oleic acid, linoleic acid, and linolenic acid can reach up to 90%, making it an ideal biodiesel feedstock and high-quality edible oil. The white sandalwood tree has dense, white flowers and a bluish-black fruit, making it a popular ornamental plant for both flowering and fruiting. The entire plant has medicinal properties such as anti-inflammatory, softening, and regulating qi, and is used to treat inflammatory conditions such as lymphadenitis, ulcers, and gastric cancer. The leaves can also be used as medicine, with benefits such as clearing away heat and detoxifying, regulating qi and relieving pain. The leaves are high in minerals, vitamin C, and crude protein, and are highly nutritious, making them an excellent livestock feed. Therefore, white sandalwood has high ecological, edible (for oil), ornamental, medicinal, and feed value.

[0003] my country boasts abundant sandalwood resources and diverse habitats, offering enormous potential for development and utilization. To better develop and utilize sandalwood plant resources and grow the sandalwood industry, it is necessary to collect wild sandalwood germplasm resources and analyze their genetic background and developmental mechanisms. This will provide crucial insights for provenance identification, high-quality provenance screening, and introduction and cultivation of sandalwood varieties.

[0004] Simple sequence repeats (SSRs) are tandem repeats consisting of 1 to 6 nucleotide motifs, typically around 200 base pairs in length. They are widely distributed in plant genomes. SSR sequences vary in length, number of repeat units, mutation patterns, and chromosomal distribution among different species. Therefore, SSR molecular markers are becoming increasingly useful tools for analyzing genetic diversity in various plant species. The development of SSR molecular markers for plant species can provide a basis for analyzing species genetic diversity, identifying provenances, and constructing genetic linkage maps. Currently, the development of SSR molecular markers for sandalwood has not been reported. Developing a rapid and accurate method for detecting sandalwood varieties for genetic diversity analysis is crucial for the identification, conservation, effective utilization, and innovation of sandalwood germplasm resources. Summary of the Invention

[0005] The purpose of the present invention is to provide an SSR molecular marker primer for sandalwood resources, which is used for genetic structure analysis of sandalwood and provides a theoretical basis for the introduction, collection, accurate identification and molecular breeding of sandalwood germplasm resources.

[0006] To achieve the above object, the present invention provides the following technical solutions: The present invention first provides an SSR molecular marker primer set for identifying sandalwood varieties, the primer set comprising the following 10 pairs of primers: SP005 upstream primer: TTAACTTCCCACGTCTCCCC; Downstream primer: TGTTGAATGAGAGTGGACCTCA; SP007 upstream primer: ACACACACGGCTGAAGAACA; Downstream primer: TCCCAATCAATCATCCCCGC; SP008 upstream primer: GCCACTCCACGTATTCACCA; Downstream primer: CTCCAACAGCATCAGGAGCA; SP012 upstream primer: GTGAACAAGCCTTGTAAGCACA; Downstream primer: GAAGGCATTTCTCCTTTGGCA; SP016 upstream primer: TGCACTCATAAAGCCCCACA; Downstream primer: GCCCCGCCAAAAATTAAGCA; SP020 upstream primer: GACTTCATCGGCGTTTTCGT; Downstream primer: AGGGTTTGTTGGGTTCGTGT; SP021 upstream primer: TGAGGGATTTCGGCAACTCC; Downstream primer: TAACCTGAACGCTCACTAGC; SP024 upstream primer: ACAACAAACACATATTCAACTGGGA; Downstream primer: CTCCTCGTGTTCTTGGAGGG; SP026 upstream primer: CCAAGCCGTCAAAAGTGCTC; Downstream primer: TTACTCCGCTGCAACAACGT; SP028 upstream primer: TGGAAGAACAACATCATTTCAAATACA; Downstream primer: GCCTAGGCAATTAACTGCTAGT; Application of the above-mentioned sandalwood SSR molecular marker primers in genetic analysis of sandalwood germplasm resources.

[0007] Furthermore, the application of SSR molecular marker primers of sandalwood resources in the genetic analysis of sandalwood germplasm resources includes the following steps: (1) Extracting DNA from samples to be analyzed: Collect young leaves of white sandalwood (leaves from seedlings or adult plants, or tissues or organs such as stems from seedlings or adult plants) and extract genomic DNA; (2) Design and screen primers for SSR molecular markers based on the transcriptome data of S. alba; (3) Synthesis of specific fluorescent primers: screening and synthesizing the 10 pairs of SSR primers; (4) PCR amplification: using fluorescent PCR reaction to perform PCR amplification on the DNA in step (1) using the 10 pairs of SSR primers; (5) Genetic analysis: The observed number of alleles, effective number of alleles, Shannon index, polymorphism information index, observed heterozygosity, expected heterozygosity and inbreeding coefficient were calculated, and cluster analysis was performed using the non-weighted group average method based on Nei genetic distance to construct a dendrogram of genetic distance cluster analysis.

[0008] Application of the above-mentioned sandalwood SSR molecular marker primers in constructing the DNA digital fingerprint map of sandalwood germplasm resources.

[0009] Furthermore, the application of SSR molecular marker primers of sandalwood resources in constructing a DNA digital fingerprint of sandalwood germplasm resources includes the following steps: (1) Extracting DNA from samples to be analyzed: Collect young leaves of white sandalwood (leaves from seedlings or adult plants, or tissues or organs such as stems from seedlings or adult plants) and extract genomic DNA; (2) Synthesis of specific fluorescent primers: screening and synthesizing the 10 pairs of SSR primers; (3) PCR amplification: using the fluorescent PCR reaction to perform PCR amplification on the DNA in step (1) using the 10 pairs of SSR primers to obtain PCR amplification products; (4) Electrophoresis detection: The PCR amplification product obtained in step (3) is subjected to capillary electrophoresis detection; (5) Based on the test results of step (4), a DNA digital fingerprint of the sandalwood germplasm resources is formed.

[0010] The present invention provides the use of the above-mentioned SSR molecular marker primer set in identifying different sandalwood tree provenances and Alumnus species.

[0011] The present invention provides a method for identifying the provenance of white sandalwood trees, comprising the following steps: a. Extract genomic DNA from sandalwood materials; b. Using the DNA obtained in step a as a template, perform PCR amplification using the 10 pairs of primers described in claim 3, and perform capillary electrophoresis analysis on the amplified fragments; c. Comparing the characteristic fingerprints of the sample to be tested and the reference variety, or using the cluster analysis dendrogram described in claim 3 to determine the genetic relationship between the sample to be tested and the reference variety.

[0012] Furthermore, in step b, the PCR amplification system is as follows: dNTP (mix) (5 μM) 0.5 μL, Taq Buffer 10× (with MgCl2) 2.5 μL, Taq enzyme (5 U / μL) 0.2 μL, genomic DNA (approximately 20-50 ng) 1.0 μL, upstream primer (concentration 10 μmol / μL) 0.5 μL, downstream primer (concentration 10 μmol / μL) 0.5 μL, and ddH2 added to a total volume of 25 μL. The PCR amplification program is as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, gradient annealing at 60-0.5°C for 30 s, and extension at 72°C for 30 s, for 10 cycles; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, for cycles 6-8, for 30 cycles; and extension at 72°C for 10 min.

[0013] Compared with the prior art, the present invention has the following advantages: The present invention uses 10 pairs of fluorescent SSR primers and constructs fingerprints, which can not only quickly and efficiently identify sandalwood at the molecular level, but also be used to evaluate genetic diversity, reveal the genetic diversity characteristics and population genetic differentiation structure of sandalwood germplasm resources, clarify the variety of unknown germplasm resources, and provide a reference for the identification of sandalwood germplasm resources. It provides a theoretical basis for introduction, collection, precise identification and molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a genetic differentiation analysis diagram among populations in Example 3 of the present invention. DETAILED DESCRIPTION

[0015] The technical solution of the present invention is further explained through the examples, but the technical solution of the present invention is not limited in any form by the examples. Example 1 Design and screening of SSR primers for sandalwood resources (1) DNA was extracted from young leaves of white sandalwood (leaves of seedlings or adult plants, or tissues or organs such as stems of seedlings or adult plants); (2) Primer design and screening of SSR loci of white sandalwood Based on the transcriptome sequencing results from our laboratory, primers were designed using Premier 5.0 software. Preliminary analysis and screening of these primers resulted in 30 primer pairs for polymorphism PCR amplification. The 5' ends of these 30 primer pairs were labeled with 6-FAM (7 pairs), HEX (7 pairs), ROX (7 pairs), and NED (9 pairs). (Fluorescent primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.) One sample from each of four populations of S. altissima (Leigong Mountain, Fanjing Mountain, and Liupanshui (Wumeng Mountain Area) in Guizhou Province, and one from Qingdao, Shandong Province, was selected. PCR amplification was performed under dark conditions using a PCR system. PCR products were sent to Shanghai Sangon Biotechnology Co., Ltd. for capillary electrophoresis analysis using an ABI 3730XL sequencer. Genotypes for all samples were determined based on the size and pattern data (peak scanner) provided by the company. Initial screening and isolation using fluorescent capillary electrophoresis yielded 10 primer pairs with high polymorphism and stable amplification, which were subsequently used for capillary electrophoresis analysis of the entire sample. Primer sequences are shown in Table 1.

[0016] Table 1 SSR primers Primer number Repeat type FORWARD PRIMER1 (5'-3') REVERSE PRIMER1 (5'-3') size (bp) SP005 (TC)22 TTAACTTCCCACGTCTCCCC TGTTGAATGAGAGTGGACCTCA 142 SP007 (GA)15 ACACACACGGCTGAAGAACA TCCCAATCAATCATCCCCGC 144 SP008 (TC)11 GCCACTCCACGTATTCACCA CTCCAACAGCATCAGGAGCA 144 SP012 (TG)15 GTGAACAAGCCTTGTAAGCACAGAAGGCATTTCTCCTTTGGCA 170 SP016 (CA)13 TGCACTCATAAAGCCCCACA GCCCCGCCAAAAATTAAGCA 184 SP020 (AG)22 GACTTCATCGGCGTTTTCGT AGGGTTTGTTGGGTTCGTGT 215 SP021 (CT)18 TGAGGGATTTCGGCAACTCC TAACCTGAACGCTCACTAGC 230 SP024 (TC)14 ACAACAAACACATATTCAACTGGGA CTCCTCGTGTTCTTGGAGGG 257 SP026 (GT)15 CCAAGCCGTCAAAAGTGCTCTTACTCCGCTGCAACAACGT 257 SP028 (GA)23 TGGAAGAACAACATCATTTCAAATACA GCCTAGGCAATTAACTGCTAGT 274

[0017] In this experiment, the PCR amplification system for primer screening and subsequent related experiments was as follows: 0.5 μL of dNTP (mix) (5 μM), 2.5 μL of Taq Buffer 10× (with MgCl2), 0.2 μL of Taq enzyme (5 U / μL), 1.0 μL of genomic DNA (approximately 20-50 ng), 0.5 μL of upstream primer (concentration 10 μmol / μL), 0.5 μL of downstream primer (concentration 10 μmol / μL), and ddH2 added to a total volume of 25 μL. The PCR amplification program was as follows: initial denaturation at 95°C for 5 min; 10 cycles of denaturation at 94°C for 30 s, gradient annealing at 60-0.5°C for 30 s, and extension at 72°C for 30 s; 30 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, cycles 6-8, and extension at 72°C for 10 min.

[0018] Example 2 Application of SSR Molecular Marker Primers of Sandalwood Resources in Genetic Analysis of Sandalwood Germplasm Resources Ten pairs of fluorescent SSR primers were selected for sandalwood resources and used to detect SSR genotypes in 112 sandalwood samples (Table 2: Sandalwood resource information) by capillary electrophoresis. Genetic diversity parameters associated with each primer pair, including the Shannon information index (I), number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), and expected heterozygosity (He), were calculated using GenAIex software. Polymorphic information content (PIC) was calculated using the formula of Milbourne et al. (1997).

[0019] Table 2 Sandalwood resource information

[0020] As shown in Table 3, the information and genetic diversity parameters of the ten pairs of SSR primers for sandalwood were as follows: the number of alleles (Na) of polymorphic sites contained in the ten pairs of primers ranged from 12 to 29, with an average of 19.8; the average number of effective alleles (Ne) of each SSR marker was 10.9, ranging from 6.3951 to 16.9628; the average Shannon diversity index (I) was 2.5598, ranging from 2.2198 to 3.0114; the average observed heterozygosity (Ho) was 0.7482, ranging from 0.5893 to 0.9286, and the average expected heterozygosity (He) was 0.9031, ranging from 0.8495 to 0.9453; the average polymorphic information content (PIC) of each SSR marker was 0.8909, ranging from 0.8251 to 0.9295. When the PIC is greater than 0.5, it indicates that the site is highly polymorphic, indicating that the 10 pairs of primers described in the invention are highly polymorphic.

[0021] Table 3 Information of 10 SSR primer pairs and genetic diversity parameters of Dalbergia odorata

[0022] 112 test samples were obtained from wild sandalwood germplasm resources in Guizhou Province and five other provinces in China (Table 2). Among them, 23 samples (15 collected from Taijiang County of Leigong Mountain, Guizhou and 8 collected from Leishan County) were obtained during the collection and survey of sandalwood resources in Leigong Mountain, Guizhou; 3 samples were collected from Zhujiashan District of Weng'an County, Qiannan Prefecture, Guizhou; 10 samples were collected from Fanjing Mountain, Guizhou; 6 samples were collected from Weining County, Guizhou; 21 samples were collected from Niangniang Mountain (10 samples) and Guolang Village (11 samples) in Panzhou City, Liupanshui, Guizhou; 8 samples were obtained during the collection and survey of sandalwood resources in Yingshan County, Hubei; 10 samples were obtained during the collection and survey of sandalwood resources in Dawei Mountain, Hunan; 15 samples were obtained during the collection and survey of sandalwood resources in Laoshan, Qingdao, Shandong; 8 samples were obtained from Erdao District, Tonghua, Jilin Province in Northeast China; and the remaining 8 samples were obtained during the collection and survey of sandalwood resources in Gaoqiao (3 samples) and Liziyuan Farm (5 samples) in Xiaolongshan National Nature Reserve, Gansu.

[0023] Example 3 Genetic cluster analysis to verify the effectiveness of SSR primers The present invention used the 10 pairs of SSR molecular markers to perform cluster analysis on 112 samples using MEGA5.1 software ( Figure 1), the effectiveness of the 10 pairs of polymorphic SSR primers developed were tested, and with the genetic distance of 0.60 as the interval value, 112 sandalwood resources were clustered into three groups. Among them, the first group had a total of 47 germplasm resources, including sandalwood varieties from Leigongshan District, Zhujiashan District, and Wumengshan District of Liupanshui City in Guizhou Province; the second group had a total of 42 resources from Hubei, Hunan, Gansu Province and Fanjingshan and Weining County of Guizhou Province; the third group had a total of 23 resources from Tonghua, Jilin Province in Northeast China and Qingdao, Shandong Province. At a genetic distance of 0.4, the first cluster can be divided into two subgroups: sandalwood accessions from Taijiang, Leishan, and Weng'an counties in Leigong Mountain, Guizhou, cluster together, and sandalwood accessions from Panzhou City, Liupanshui, cluster together. The second cluster can be divided into four subgroups: sandalwood accessions from Hubei and Hunan, Fanjing Mountain, Guizhou, and Gansu and Weining, Guizhou, cluster together. The third cluster can be divided into two subgroups: sandalwood accessions from Shandong and Jilin, each clustering together. Accessions from the same sampling site cluster together. Genetic cluster analysis results show clear genetic differentiation among sandalwood populations, demonstrating that the 10 pairs of SSR molecular marker primers can effectively cluster individuals of the same provenance and distinguish populations from different sources. This confirms the effectiveness of the developed polymorphic SSR primers and that genetic cluster analysis can be used for provenance identification, demonstrating the high quality, effectiveness, and practicality of the 10 pairs of polymorphic SSR primers.

[0024] Table 4 Analysis of genetic distance (upper triangle) and genetic differentiation coefficient (lower triangle) between populations

[0025] The upper angle in the table above indicates genetic identity, and the lower angle indicates genetic distance. Genetic distance (D) and genetic identity (I) are indicators of genetic relationships from the perspective of similarity and opposition, respectively. Geographic genetic distance reflects the closeness of the relationship between populations; the smaller the genetic distance, the higher the genetic identity. PopGen 32 software was used to calculate the genetic similarity coefficient and genetic distance between samples from the 12 sandalwood distribution areas. Among the 12 distribution area samples, genetic identity ranged from 0.1476 to 0.6021, with an average of 0.3105. The highest genetic identity was 0.6021 between "ST-9" and "ST-10," indicating a close relationship. The lowest genetic identity was 0.1476 between "ST-7" and "ST-10," indicating significant genetic divergence. Nei's genetic distance ranged from 0.5074 to 1.9132, with an average of 1.2001. The genetic distance between "ST-9" and "ST-10" was the closest, at 0.5074, indicating a small degree of genetic differentiation and a close relationship between the two. The genetic distance between "ST-7" and "ST-10" was the farthest, at 1.9132, indicating a large degree of genetic differentiation and a distant relationship between the two, which was consistent with the genetic correlation data.

[0026] Example 5 Application of SSR Molecular Marker Primers of Sandalwood Resources in Constructing DNA Digital Fingerprint of Sandalwood Germplasm Resources Construction of DNA fingerprint Using GeneMarker V2.2.0, we read 112 samples of sandalwood germplasm using 10 primer pairs. We obtained the allele fragment sizes at different loci and the corresponding capillary electrophoresis patterns. We then read the allele fragment length values sequentially according to the different allele loci. Letters were used to represent the allele fragment size. Each letter represents the integer portion of the allele fragment size number in the original data table. Identical numbers represent homozygosity, while different numbers represent heterozygosity. The different allelic variations at the corresponding loci of different sandalwood samples were recorded. The recording method is as follows: The recorded results for different loci are separated by a " / " and recorded in the order of loci SSR12, SSR16, SSR20, SSR21, SSR24, SSR26, SSR28, SSR5, SSR7, and SSR8, thus obtaining the "molecular ID card" code for sandalwood.

[0027] Table 5 shows fingerprints (showing representative individuals from 12 sandalwood distribution groups). The results show that sandalwood from 112 distribution groups can be accurately distinguished using the SSR primer combination provided by the present invention, indicating that it is sufficient to correctly distinguish all sandalwood materials.

[0028] Table 5 Fingerprint

[0029] The above embodiments are intended only to illustrate the technical solutions of the present invention and are not intended to limit the same. The technical solutions described in the above embodiments may be modified, or some of the technical features therein may be replaced with equivalents. This is obvious to those skilled in the art and does not deviate the essence of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An SSR molecular marker primer for sandalwood resources, characterized in that: The primers include the following primer pairs: SP005 upstream primer: TTAACTTCCCACGTCTCCCC; Downstream primer: TGTTGAATGAGAGTGGACCTCA; SP007 upstream primer: ACACACACGGCTGAAGAACA; Downstream primer: TCCCAATCAATCATCCCCGC; SP008 upstream primer: GCCACTCCACGTATTCACCA; Downstream primer: CTCCAACAGCATCAGGAGCA; SP012 upstream primer: GTGAACAAGCCTTGTAAGCACA; Downstream primer: GAAGGCATTTCTCCTTTGGCA; SP016 upstream primer: TGCACTCATAAAGCCCCACA; Downstream primer: GCCCCGCCAAAAATTAAGCA; SP020 upstream primer: GACTTCATCGGCGTTTTCGT; Downstream primer: AGGGTTTGTTGGGTTCGTGT; SP021 upstream primer: TGAGGGATTTCGGCAACTCC; Downstream primer: TAACCTGAACGCTCACTAGC; SP024 upstream primer: ACAACAAACACATATTCAACTGGGA; Downstream primer: CTCCTCGTGTTCTTGGAGGG; SP026 upstream primer: CCAAGCCGTCAAAAGTGCTC; Downstream primer: TTACTCCGCTGCAACAACGT; SP028 upstream primer: TGGAAGAACAACATCATTTCAAATACA; Downstream primer: GCCTAGGCAATTAACTGCTAGT.

2. Use of the SSR molecular marker primers of sandalwood resources according to claim 1 in provenance identification, genetic diversity analysis or genetic linkage map construction of sandalwood germplasm resources.

3. The use according to claim 2, characterized in that The following steps are involved: (1) Extract DNA from samples to be analyzed; (2) Design and screen primers for SSR molecular markers based on the transcriptome data of S. alba; (3) Synthesis of specific fluorescent primers: screening and synthesizing the 10 pairs of SSR primers; (4) PCR amplification: using the fluorescent PCR reaction to perform PCR amplification on the DNA in step (1) using the 10 pairs of SSR primers; (5) Genetic analysis: The observed number of alleles, effective number of alleles, Shannon index, polymorphism information index, observed heterozygosity, expected heterozygosity and inbreeding coefficient were calculated, and cluster analysis was performed using the non-weighted group average method based on Nei genetic distance to construct a dendrogram of genetic distance cluster analysis.

4. Use of the SSR molecular marker primers of the sandalwood resource according to claim 1 in identifying different sandalwood species and Alum species.

5. Use of the SSR molecular marker primers of the sandalwood resource according to claim 1 in constructing a DNA digital fingerprint of sandalwood germplasm resources.

6. A method for identifying sandalwood species, characterized in that: The following steps are included: a. Extract genomic DNA from sandalwood materials; b. Using the DNA obtained in step a as a template, performing PCR amplification according to the steps of claim 3, and performing capillary electrophoresis analysis on the amplified fragments; c. Comparing the characteristic fingerprints of the sample to be tested and the reference variety, or using the cluster analysis dendrogram described in claim 3 to determine the genetic relationship between the sample to be tested and the reference variety.

7. The method for identifying sandalwood varieties according to claim 6, characterized in that: In the step b, the PCR amplification system is as follows: dNTP (mix) (5 μM) 0.5 μL, Taq Buffer 10× (with MgCl2) 2.5 μL, Taq enzyme (5 U / μL) 0.2 μL, genomic DNA (about 20-50 ng) 1.0 μL, upstream primer (concentration 10 μmol / μL) 0.5 μL, downstream primer (concentration 10 μmol / μL) 0.5 μL, and ddH2 added to a total volume of 25 μL. The PCR amplification program is as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, gradient annealing at 60-0.5°C for 30 s, extension at 72°C for 30 s, and 10 cycles; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, cycles 6-8, and 30 cycles; extension at 72°C for 10 min.

Images