Coffee continuous cropping stress-resistant microbial agent preparation method based on DeepSeek genome design
Through the DeepSeek R1 model, the genome design of coffee continuous crop anti-reflective microbial agents is optimized, and a complementary strain system is constructed, which solves the soil and environmental problems caused by coffee continuous cropping, significantly improves coffee yield and quality, and achieves efficient environmental adaptability and synergy.
Patent Information
- Application Number
- CN202510640094.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-08-19
AI Technical Summary
The existing coffee continuous cropping anti-reflective microbial agent has low design accuracy, poor environmental adaptability and insufficient multifunctional synergy, which cannot effectively solve the problems of soil acidification, reduced organic matter content, reduced microbial diversity and accumulation of self-toxic substances caused by coffee continuous cropping.
The DeepSeek R1 model is used to assist in the design of coffee continuous anti-reflective microbial agents. By optimizing the genomes of Bacillus subtilis COFFEE-B1, Pseudomonas lipolytica COFFEE-P2, Bacillus licheniformis COFFEE-B3 and Trichoderma COFFEE-T4, a strain system with complementary functions is constructed, and environmentally responsive regulatory elements are introduced to achieve precise regulation and synergistic effects.
It significantly increased the coffee production by 32% to 48%, improved the coffee quality by 4 to 6 points, reduced the use of fertilizers and pesticides, achieved a win-win situation for economic and ecological benefits, increased the activity of the strain by 2-3 times, and enhanced environmental adaptability.
Abstract
Description
Technical Field
[0001] This invention relates to the fields of agricultural microbial technology and synthetic biology, specifically to a method for preparing a stress-resistant microbial agent for continuous coffee cropping based on DeepSeek genome design. This invention can be applied to the coffee industry to improve soil health in continuous coffee cropping systems and increase crop stress resistance and yield. Background Art
[0002] As one of the world's most important cash crops, coffee faces widespread challenges during long-term cultivation, including continuous cropping. Studies have reported that continuous coffee cropping leads to soil acidification, reduced organic matter content, decreased microbial diversity, and the accumulation of autotoxic substances. In severe cases, yields can drop by 30% to 50%. Furthermore, climate change is increasing drought, high temperatures, and disease pressure, further challenging coffee cultivation. The International Coffee Organization's "Global Coffee Industry Climate Change Risk Assessment Report" predicts that by 2050, approximately 50% of existing coffee-growing areas will be unsuitable due to climate change.
[0003] Currently, conventional methods for alleviating the problem of continuous coffee cropping include traditional crop rotation, chemical amendments, and microbial agents. Traditional crop rotation requires large tracts of land and has low economic returns. Chemical amendments, while effective, carry environmental risks and increasingly expensive costs. While existing microbial agents have demonstrated success with certain crops, they offer limited solutions specifically for continuous coffee cropping systems. These solutions suffer from the following key drawbacks: First, there is a lack of rhizosphere-specific microorganisms; second, strains are often limited in function and unable to cope with multiple stresses; third, interactions between microorganisms are not fully considered; and fourth, they have limited adaptability to environmental conditions and low field survival rates.
[0004] After searching, the comparative documents that are relatively close to the present invention include:
[0005] Chinese patent CN112481167A discloses a composite microbial agent for improving soil fertility and its preparation method. The composite microbial agent comprises Bacillus amyloliquefaciens, Bacillus subtilis, and Trichoderma harzianum. However, this invention employs a simple strain screening and combination approach, fails to address specific obstacles to continuous coffee cropping, and lacks optimization of interstrain synergy.
[0006] U.S. Patent CN106831187A discloses a microbial fertilizer containing active microbial strains and a preparation method thereof, and provides a microbial fertilizer, which is prepared from 25-45 parts of organic fertilizer, 30-50 parts of inorganic fertilizer, 2-8 parts of humic acid, 1-5 parts of medium and trace elements, and 2-4 parts of active microbial strains. The present invention mainly provides the use of Aeromonas frog-killing bacteria, phosphate-solubilizing bacteria, potassium-solubilizing bacteria, nitrogen-fixing bacteria and active bacteria of Aspergillus niger species for coordinated use, wherein the phosphate-solubilizing bacteria, potassium-solubilizing bacteria and nitrogen-fixing bacteria can respectively release potassium and phosphorus and fix nitrogen, thereby increasing nutrient content, Aspergillus niger can reduce pesticide residues, Aeromonas frog-killing bacteria can promote the formation of a good ecological environment in the rhizosphere, and cooperate with the phosphate-solubilizing bacteria, potassium-solubilizing bacteria and nitrogen-fixing bacteria to activate and release nutrients in the soil, thereby improving the nutrient supply of crops to pests and diseases and increasing production and income. Although this invention is targeted, it mainly focuses on nutrient supply, and does not give sufficient consideration to the degradation of self-toxic substances in continuous coffee cropping and adaptability to drought stress, and does not use modern genome optimization technology.
[0007] The rapid development of synthetic biology and artificial intelligence technologies has made it possible to design microbial genomes and optimize microbial assemblages using advanced computational methods. In particular, large language models, such as DeepSeek R1, with their powerful sequence analysis and function prediction capabilities, offer new avenues for developing highly effective and versatile microbial agents. However, there are currently no specific studies or patents documenting the application of large AI models to the development of stress-resistant microbial agents for continuous coffee cropping.
[0008] Therefore, there is an urgent need to develop coffee continuous cropping anti-stress microbial agents based on artificial intelligence-assisted design and their preparation methods to solve the problems existing in the existing technology. Summary of the Invention
[0009] The purpose of the present invention is to provide a coffee continuous cropping anti-stress microbial agent based on DeepSeek R1 large model-assisted design and a preparation method thereof, so as to solve the technical problems in the prior art such as low design accuracy, poor environmental adaptability and insufficient multifunctional synergy of coffee continuous cropping anti-stress microbial agents.
[0010] To achieve the above objectives, the present invention provides a method for preparing a coffee continuous cropping stress-resistant microbial agent based on DeepSeek genome design, comprising the following steps:
[0011] (1) Analyze and optimize microbial genomes using the DeepSeek R1 large-scale model to design functional genes and regulatory elements for coffee continuous cropping stress resistance;
[0012] (2) Using the optimization design results, genome modification was performed on four strains: Bacillus subtilis COFFEE-B1, Pseudomonas lipolytica COFFEE-P2, Bacillus licheniformis COFFEE-B3, and Trichoderma COFFEE-T4;
[0013] (3) fermenting and culturing the four modified strains separately, and controlling the fermentation parameters so that each strain reaches an optimal growth state;
[0014] (4) According to a weight ratio, 25% of Bacillus subtilis COFFEE-B1, 20% of Pseudomonas lipolytica COF FEE-P2, 25% of Bacillus licheniformis COFFEE-B3, and 10% of Trichoderma COFFEE-T4 are mixed with 20% of a carrier and auxiliary materials, and the microbial agent is prepared by drying, sieving, and packaging.
[0015] Preferably, the method for analyzing and optimizing the microbial genome by the DeepSeek R1 large model in step (1) includes: dividing the target strain genome sequence into fragments of 65,536 bases in length, retaining 500bp overlap; converting the genome fragments into special token representations and sending them for analysis through the DeepSeek R1 API; conducting in-depth analysis of key functional regions to predict gene functions and regulatory elements; integrating multi-fragment analysis results to form a complete genome function map; and designing and optimizing promoter, codon and functional gene modification schemes based on the analysis results.
[0016] Preferably, the genetic modification of the Bacillus subtilis COFFEE-B1 in step (2) includes: replacing the cafR upstream promoter region using the CRISPR / Cas9 system, and using the new promoter sequence TTGACAGGTTCGTTCGACATAGTTTATGCTACCGGAAACCCTATCAT designed by DeepSeek R1; codon optimization of the caffeic acid decarboxylase gene cafD, increasing the original CAI index from 0.67 to 0.89, and adjusting the GC content from 61.2% to 53.4%; constructing a kaffeenol inducible expression system to activate expression when the kaffeenol concentration is greater than 5 μM, and the background expression level is lower than 0.05% of the fully open state.
[0017] Preferably, the genetic modification of the Pseudomonas lipolytica COFFEE-P2 in step (2) includes: overexpressing the pyrophosphatase gene ppa, the promoter strength is increased by 3.6 times compared with the wild type, and the organic acid production is increased by 286%; integrating the pH-responsive promoter PphoA designed by DeepSeek R1, so that it is activated when the pH is lower than 5.5 and reaches maximum activity when the pH is lower than 4.5; optimizing the proton pump-related gene nhaA, so that the growth ability under acid stress conditions is increased by 208%.
[0018] Preferably, the genetic modification of the Bacillus licheniformis COFFEE-B3 in step (2) includes: overexpressing the epsA-O gene cluster, using the synthetic promoter sequence TTGACAATAATCTAATGATATAATCGTTACAATAATCTGATGTTATAATAT designed by DeepSeek R1, enhancing exopolysaccharide synthesis, and increasing EPS production by 215%; introducing the tryptophan deaminase iaaM and indoleacetamide hydrolase iaaH genes optimized by DeepSeek R1, and increasing IAA production from the original 22 μg / ml to 78 μg / ml; designing an osmotic pressure response system, using the osmotic pressure sensing promoter Po44, with a response threshold of 0.35 MPa, and increasing the drought stress survival rate by 4.2 times.
[0019] Preferably, the genetic modification of the Trichoderma COFFEE-T4 in step (2) includes: optimizing the design of the chitinase gene chit42 to enhance the chitin degradation ability, increasing the enzyme activity by 187%, and maintaining greater than 70% activity in the pH range of 3.5-8.0; introducing the novel antimicrobial peptide gene triT67 designed by DeepSeek R1 to increase the diameter of the inhibition zone against Fusarium by 46%.
[0020] Preferably, the fermentation conditions of Bacillus subtilis COFFEE-B1 in step (3) are as follows: the seed culture medium components are beef extract 10 g / L, peptone 15 g / L, NaCl 5 g / L, glucose 5 g / L, pH 7.0±0.2, and cultured at 37°C and 180 rpm for 16 hours; the fermentation culture medium components are corn flour 30 g / L, soybean flour 25 g / L, (NH4)2SO4 5 g / L, KH2PO4 3 g / L, and MgSO4·7H2O 0.5 g / L, culture conditions are 32°C, 220 rpm, pH is controlled at 6.8-7.2, fermentation time is 36 hours, and the endpoint is controlled to be a spore count greater than 5×10 10 CFU / ml, spore rate is greater than 90%.
[0021] Preferably, the carrier and auxiliary materials in step (4) are composed of the following components: 8% soluble starch, 3% sodium alginate, 2% sodium lignin sulfonate, 2% mannitol, 1% dextran, 1.5% seaweed extract, 1% betaine, 0.5% antioxidant, 0.2% UV protectant, 0.8% dipotassium hydrogen phosphate / potassium dihydrogen phosphate buffer system, and the final pH value is 6.8±0.2.
[0022] Preferably, the preparation processing technology in step (4) includes: first adding the carrier and the excipients, and mixing them uniformly at 350 rpm, 15 minutes, and a temperature of 20-25°C; slowly adding the four bacterial liquids in proportion, and spray mixing at 200 rpm, a temperature of 20-22°C, and a relative humidity of 60% to 65%; using a fluidized bed spray drying process, with an inlet air temperature of 45°C, an outlet air temperature of 35°C, and a pressure of 0.15 MPa, drying for 60±5 minutes, and the moisture content of the final product is less than 4%; screening through an 80-mesh sieve, and sealing the product in a three-layer aluminum foil composite packaging bag filled with nitrogen.
[0023] Preferably, the application method of the microbial agent is as follows: in a coffee monoculture system, the application amount is 15-20 g / plant, applied once every three months, and applied in a circular trench at a distance of 30-50 cm from the tree trunk; when applied in arid areas or seasons, the optimal application time is before the rainy season or after irrigation, the dosage is increased to 120%-130% of the basic dosage, the proportion of Bacillus licheniformis COFFEE-B3 is increased, and straw is covered to retain moisture; when applied in humid areas or seasons, the optimal application time is the early rainy season, and the proportion of Trichoderma COFFEE-T4 is adjusted to 15%-20%; when applied by rhizosphere irrigation, the dilution ratio is 1:200-300 (w / v), the powder is fully dissolved in water and stirred for 5-10 minutes, and circularly irrigated into the rhizosphere area, the dosage is 10-20 L / plant for adult trees, and the water temperature does not exceed 35°C.
[0024] The beneficial effects of the present invention are mainly reflected in the following aspects:
[0025] 1. Strong technological innovation: The DeepSeek R1 large-scale model was applied for the first time to develop stress-resistant microbial agents for continuous coffee cropping. Through artificial intelligence-assisted design of microbial genomes and regulatory elements, precise optimization of strain functions was achieved, increasing the activity of various functional strains by 2-3 times compared to traditional screening methods.
[0026] 2. Strong functional targeting: The designed microbial agent contains four functionally complementary strains, which specifically address the four key issues of coffee phenol degradation, phosphorus activation, drought resistance enhancement and pathogenic fungal inhibition in continuous coffee cropping, forming a complete functional synergistic system.
[0027] 3. Good environmental adaptability: By designing environmentally responsive regulatory elements, the strain can exhibit intelligent response capabilities under different environmental conditions, such as pH response and drought response, which significantly improves the stability and efficacy of the bacterial agent in adverse environments.
[0028] 4. Significant application effect: Field trials have shown that the inoculant of the present invention can increase coffee yield by 32% to 48%, significantly higher than commercially available products (8% to 22%); it also improves coffee quality, with cupping scores increasing by 4 to 6 points; and reduces fertilizer, pesticide, and irrigation inputs, achieving a win-win situation in both economic and ecological benefits.
[0029] 5. Reasonable production cost: Despite the use of advanced genome design technology, the final product cost is controlled within a reasonable range by optimizing the production process, and the input-output ratio can reach more than 1:8, which has good commercial prospects. DETAILED DESCRIPTION
[0030] The present invention will be further described in detail below with reference to specific examples, but the protection scope of the present invention is not limited to the following examples.
[0031] [Example 1] Microbial genome analysis and function prediction process based on DeepSeek R1
[0032] This example describes in detail how to use the DeepSeek R1 large model to analyze and predict the function of microbial genomes. First, it is necessary to perform whole genome sequencing on the target strain. In this example, sequencing was performed using the Illumina NovaSeq6000 platform (PE150) and the Oxford Nanopore PromethION platform to obtain high-quality genome sequence data. Subsequently, the sequencing data was assembled using the SPAdes v3.15.4 and Fly e v2.9 combined assembly strategies, and the assembly results were quality assessed using QUAST v5.1.0 and CheckM v1.1.3 to ensure that the genome integrity was greater than 99% and the contamination was less than 0.5%. Finally, Prokka v1.14.6 was used to perform preliminary annotations on the genome.
[0033] After obtaining the genomic sequence data, a dedicated API interface module was developed to interact with the DeepSeek R1 large model. First, the genomic sequence was segmented into segments of 65,536 bases in length, with a 500bp overlap region retained to ensure continuity of analysis. Then, a special token representation method was used to convert the DNA sequence into a format that DeepSeek R1 could process:
[0034] ```Python
[0035] def dna_to_tokens(dna_sequence):
[0036] #Convert DNA sequence into special token
[0037] nucleotide_map={'A':'NucA','T':'NucT','G':'NucG','C':'NucC',
[0038] 'N':'NucN','R':'NucR','Y':'NucY','S':'NucS',
[0039] 'W':'NucW','K':'NucK','M':'NucM','B':'NucB',
[0040] 'D':'NucD','H':'NucH','V':'NucV'}
[0041] tokens=[nucleotide_map.get(base.upper(),'NucX')for base in dna_sequence]
[0042] return "".join(tokens)
[0043] ```
[0044] Next, send the genomic fragments for analysis via the DeepSeek R1 API. This is accomplished as follows:
[0045] ```Python
[0046] def analyze_genome_segment(segment,client,function_description):
[0047] tokenized_segment=dna_to_tokens(segment)
[0048] prompt=f"""Analyze the following DNA sequence fragment and execute {function_description}:
[0049] {tokenized_segment}
[0050] Please describe in detail:
[0051] 1. Potential coding regions and functional elements
[0052] 2. Gene function prediction and its confidence
[0053] 3. Key gene clusters related to target functions
[0054] 4. Optimization suggestions
[0055] response=client.chat.completions.create(
[0056] model="deepseek-reasoner",
[0057] messages=[{"role":"user","content":prompt}],
[0058] temperature=0.2,
[0059] max_tokens=4000 )
[0061] return response.choices[0].message.content
[0062] ```
[0063] For key functional regions, such as gene clusters related to cafestol degradation, phosphate solubilization, IAA synthesis, or antimicrobial activity, more in-depth analysis is required:
[0064] ```Python
[0065] def deep_analyze_gene_cluster(gene_cluster_sequence,client,target_function):
[0066] tokenized_gene_cluster=dna_to_tokens(gene_cluster_sequence)
[0067] prompt=f"""Perform in-depth analysis of the following gene clusters encoding {target_function}:
[0068] {tokenized_gene_cluster}
[0069] Please provide:
[0070] 1. Detailed gene structure analysis
[0071] 2. Identification of regulatory elements
[0072] 3. Protein functional domain prediction
[0073] 4. Sequence optimization suggestions, focusing on expression efficiency and environmental adaptability
[0074] response=client.chat.completions.create(
[0075] model="deepseek-reasoner",
[0076] messages=[{"role":"user","content":prompt}],
[0077] temperature=0.1,
[0078] max_tokens=6000 )
[0080] return response.choices[0].message.content
[0081] ```
[0082] Finally, the analysis results of all fragments need to be integrated to form a complete genome functional map:
[0083] ```Python
[0084] def integrate_analysis_results(results_list):
[0085] """Integrate the analysis results of all fragments"""
[0086] #Merge the results and eliminate redundancy in overlapping areas
[0087] integrated_results = {}
[0088] for result in results_list:
[0089] for gene_id,gene_info in result.items():
[0090] if gene_id not in integrated_results:
[0091] integrated_results[gene_id]=gene_info
[0092] else:
[0093] #Merge analysis results of different fragments of the same gene
[0094] integrated_results[gene_id].update(gene_info)
[0095] return integrated_results
[0096] ```
[0097] Through the above method, the genome of the target strain can be comprehensively analyzed, and the genes and their regulatory elements related to the stress resistance function of continuous cropping of coffee can be accurately predicted, providing a scientific basis for subsequent genome optimization design.
[0098] [Example 2] Optimization and design of coffee phenol degradation function of Bacillus subtilis COFFEE-B1 based on DeepSeek R1
[0099] In this example, a wild-type strain of Bacillus subtilis (B. subtilis WF-6) isolated from the rhizosphere of healthy coffee plants was used to optimize its kaffeoylphenol degradation capabilities using the DeepSeek R1 large model. First, whole-genome sequencing of the strain revealed a single circular chromosome (4.21 Mb) and two plasmids (32 kb and 18 kb), with a genomic GC content of 43.7% and 4,324 coding genes.
[0100] The genome sequence was segmented into 65,536 bp segments and submitted for analysis via DeepSeek R1 API, focusing on identifying genes related to the degradation of plant phenolics such as caffeol. The analysis results showed that there was a complete phenotypic degradation gene cluster (caf cluster) in the genome of this strain, which included the following key genes: cafA (encoding caffeic acid 3,4-dioxygenase, positions: 1,562,347-1,563,627); cafB (encoding 3-(4-hydroxy-3-methoxy)-propionic acid 2,3-dioxygenase, positions: 1,563,710-1,564,633); cafC (encoding 4-hydroxy-3-methoxybenzyl alcohol dehydrogenase, positions: 1,564,700-1,565,422); cafD (encoding caffeic acid decarboxylase, positions: 1,565,498-1,566,310); and cafR (encoding transcriptional regulator, positions: 1,561,836-1,562,264).
[0101] To enhance the degradation of caffeine phenol, three key optimization measures were designed using DeepSeek R1:
[0102] First, we optimized the cafR upstream regulatory region. By analyzing the structural features of the cafR upstream regulatory region, we designed a more efficient promoter sequence using DeepSeek R1:
[0103] Original promoter sequence: TTGACAGCTGCGTTTTAGATAGATAGATACCTACTTAT;
[0104] Optimized promoter sequence: TTGACAGGTTCGTTCGACATAGTTTATGCTACCGGAAACCCTATCAT;
[0105] The new promoter design retained conserved sequences in the -35 and -10 core regions while optimizing the spacer region and sequences upstream of the transcription start site to enhance RNA polymerase binding efficiency. To introduce the optimized promoter into the strain, a promoter replacement plasmid was constructed, and precise editing was performed using the CRISPR / Cas9 system. pJOE8999 was used as the vector (carrying the sgRNA and Cas9), with homology arms of 1,000 bp in length and erythromycin resistance (MIC = 10 μg / ml) as the selection marker. The final editing efficiency achieved was 28.6% (14 out of 49 transformants).
[0106] Second, the codons of the cafD gene were optimized. Caffeic acid decarboxylase (CafD) is a key enzyme in the degradation pathway of caffeic acid phenol. DeepSeek R1 analysis revealed that the codon usage of this gene differed from the host preference. Codon optimization of the cafD gene increased the CAI (Codon Adaptability Index) of the original sequence from 0.67 to 0.89, while reducing the GC content from 61.2% to 53.4%, which is closer to the average level of the host genome. A total of 31.2% of the codons were replaced. Experiments showed that the expression level of the optimized gene was significantly improved, and the protein production increased by about 3 times.
[0107] Third, a kafirol-inducible expression system was constructed. To enable the strain to intelligently respond to environmental kafirol concentrations, a kafirol-inducible expression system was developed. This system contains a transcription factor binding site that specifically recognizes kafirol. Expression is activated when the ambient kafirol concentration exceeds 5 μM. At low kafirol concentrations, background expression levels do not exceed 0.05% of the fully active state, achieving precise environmental sensing and energy-efficient expression.
[0108] The above optimization significantly enhanced the strain's kafirol degradation ability. Activity assays showed that the modified strain's caffeic acid decarboxylase (CafD) activity increased from 4.2±0.4 U / mg protein in the wild type to 13.8±1.1 U / mg protein, a 228.6% increase. Caffeic acid 3,4-dioxygenase (CafA) activity also increased from 2.8±0.3 U / mg protein in the wild type to 9.6±0.8 U / mg protein, a 242.9% increase. When supplemented with 100 mg / L kafirol as the sole carbon source in MSM medium and cultured at 30°C and 180 rpm for 48 hours, the modified strain achieved a kafirol degradation rate of 91.4±4.5%, compared to only 37.6±3.2% in the wild type, a 143.1% increase. Further HPLC-MS / MS analysis of degradation intermediates revealed significantly reduced intermediate accumulation and increased metabolic flux in the modified strain, ultimately enabling complete degradation of kafirol into acetyl-CoA and succinate, which enter the TCA cycle.
[0109] To verify the effectiveness of the modified strain in alleviating coffee cropping problems, a pot experiment was conducted. Using soil from coffee cultivation for five years, an uninoculated control group, a wild-type strain-inoculated group, and a modified strain-inoculated group were set up with an inoculum of 10^8 CFU / g of soil. After 60 days, coffee seedling growth indicators were measured. The results showed that the plant height, root length, and biomass of the modified strain group reached 28.7±2.4 cm, 23.5±2.2 cm, and 6.7±0.6 g, respectively, significantly higher than those of the control group (16.2±1.8 cm, 12.3±1.5 cm, and 3.2±0.4 g) and the wild-type group (22.4±2.1 cm, 17.6±1.9 cm, and 4.8±0.5 g). At the same time, the caffeine phenol content in the soil of the modified strain group dropped to 5.3±0.6 mg / kg, while that of the control group and the wild type group were 29.8±2.7 mg / kg and 18.4±1.6 mg / kg, respectively. This proves that the modified strain can effectively degrade caffeine phenol and other autotoxic substances in the soil, thereby significantly alleviating the problem of continuous coffee cropping.
[0110] [Example 3] Optimization of the phosphate solubilization function of Pseudomonas lipolytica COFFEE-P2 based on DeepSeek R1 design
[0111] In this example, the phosphate solubilization function of Pseudomonas lipolytica PL-35, a base strain, was optimized using the DeepSeek R1 large-scale model to adapt to the acidic soil environment of coffee cultivation. First, the strain underwent whole-genome sequencing and analysis to identify key genes and regulatory elements related to phosphate solubilization.
[0112] Based on the analysis results of DeepSeek R1, the strain was optimized in three aspects:
[0113] First, a promoter replacement strategy was used to overexpress the pyrophosphatase gene (ppa). Pyrophosphatase catalyzes the decomposition of phosphate pyrophosphate into orthophosphate and is one of the key enzymes used by Pseudomonas phosphate-solubilizing bacteria to solubilize insoluble phosphates. Using DeepSeek R1, a high-strength promoter sequence, TTGACAAAAGTCTATCGTAGATATAATGCCTACATTTGTATAGTCTCGAG, was designed to replace the original promoter of the ppa gene, increasing the promoter strength by 3.6 times compared to the wild type. Experimental verification showed that the organic acid production of the modified strain increased to 286% of that of the wild type, and the diameter of the transparent zone formed on NBRIP medium increased to 25.8±2.1 mm, a 58.3% increase from the wild type's 16.3±1.7 mm.
[0114] Secondly, the integration of the pH-responsive promoter PphoA, designed using DeepSeek R1, enabled the strain to enhance its phosphate-solubilizing activity in acidic environments. This promoter's response characteristic is activation below pH 5.5 and maximum activity below pH 4.5. At pH 4.0, the modified strain expressed 11 times more pyrophosphatase than the wild-type, while at pH 7.0, expression levels were similar, demonstrating precise environmental responsiveness.
[0115] Third, we optimized the proton pump gene nhaA to enhance the strain's ability to survive in acidic environments. Coffee-growing soils are typically acidic, especially in long-term coffee plantations, where the pH often drops below 4.5. To adapt the strain to this unique environment, we used DeepSeek R1 to analyze and optimize the nhaA gene, increasing its growth capacity by 208% under acid stress conditions of pH 4.0.
[0116] After the optimized Pseudomonas lipolytica COFFEE-P2 was applied to the coffee garden soil (pH 4.8), the soil's available phosphorus content increased from the original 8.5 mg / kg to 16.7 mg / kg, and the phosphorus content of coffee leaves also increased from 0.15% to 0.23%, improving the phosphorus nutrition status of coffee trees, promoting plant growth, and reducing the inhibitory effect of continuous cropping on nutrient absorption.
[0117] [Example 4] Design of drought-responsive regulatory elements and optimization of Bacillus licheniformis COF FEE-B3 based on DeepSeek R1
[0118] This example focuses on how to use the DeepSeek R1 large model to design drought-responsive regulatory elements and optimize the drought resistance of Bacillus licheniformis to improve the drought resistance of coffee continuous cropping systems.
[0119] First, DeepSeek R1 was used to design drought-responsive regulatory elements. Design requirements included: activation of expression when osmotic pressure exceeded 0.35 MPa; a greater than 10-fold increase in expression after activation; and a background expression level below 5% of the maximum expression level. Based on a large amount of previously trained sequence data and functional annotation information, DeepSeek R1 designed the following drought-responsive regulatory element sequences:
[0120] Basic response element sequence (0.35MPa):
[0121] TTCAGAAATCACACTTTTCATGACAGCATTTCTCGAGTATCTCACACAATTGAGAGTGTGAGTGGAAATTGTTCCATGGTAGGAAAATAGAGGTATAAATTGACTCAATTTGACAGCAGATCACTTATCAGTCAGGATCACGTATAATCAGTAGCCTCGAGG;
[0122] In addition, two variants were designed, which were activated at 0.25 MPa and 0.45 MPa, respectively, to form a gradient response series to adapt to different degrees of drought stress.
[0123] To verify the responsiveness of the regulatory element, a reporter gene system was constructed using the pSG1151 integrative vector, β-galactosidase (lacZ) as the reporter gene, and Bacillus licheniformis (B. licheniformis ATCC 14580) as the host strain. The osmotic pressure of the culture medium was adjusted by PEG6000, and β-galactosidase activity was measured using the ONPG substrate method. The results showed that the 0.35 MPa-responsive element expressed an activity of 32 ± 5 Miller units at an osmotic pressure of 0.1 MPa, and an activity of 367 ± 28 Miller units at an osmotic pressure of 0.35 MPa, achieving the expected osmotic pressure-responsive properties.
[0124] Based on the verification of the effectiveness of the regulatory elements, Bacillus licheniformis COFFEE-B3 was optimized in three aspects:
[0125] First, the drought response element is used to regulate the EPS synthesis gene cluster. The drought response element is replaced with the upstream promoter region of the epsA operon in Bacillus licheniformis, so that the synthesis of exopolysaccharides (EPS) can be enhanced under drought conditions. The test results show that under the drought stress conditions of adding 15% PEG6000 (about 0.4MPa), the EPS production of the modified strain reached 11.6±0.9g / L, which is much higher than the 3.8±0.4g / L of the wild type under the same conditions, an increase of about 3 times. EPS can form a protective layer around microorganisms, absorb water, and significantly improve the survival rate and functional expression of strains in drought environments.
[0126] Secondly, the IAA biosynthesis pathway was optimized. DeepSeek R1-optimized tryptophan deaminase (iaa M) and indoleacetamide hydrolase (iaaH) genes were introduced to construct an efficient IAA biosynthesis pathway. IAA is an important plant auxin that promotes root development and improves drought resistance. The modified strain increased IAA production from the original 22 μg / ml to 78 μg / ml, significantly enhancing its ability to promote coffee root growth.
[0127] Third, an osmotic pressure response system was designed. The osmotic pressure-sensing promoter Po44, with a response threshold of 0.35 MPa, was integrated, enabling the strain to accurately sense soil drought levels and adjust physiological activities accordingly. Tests showed that the survival rate of the modified strain under drought conditions was 4.2 times that of the wild type. Under well-watered conditions, the survival rates of the two strains were similar, demonstrating efficient resource utilization.
[0128] After applying the optimized Bacillus licheniformis COFFEE-B3 to the coffee continuous cropping system, the drought resistance of the coffee trees in the dry season was significantly improved, the relative water content of the leaves was maintained at a high level, the wilting symptoms were significantly alleviated, the yield loss caused by drought was reduced, and the overall health of the coffee trees was improved.
[0129] [Example 5] Optimization of the antagonistic function of Trichoderma COFFEE-T4 based on DeepSeek R1 design
[0130] This example describes how to use the DeepSeek R1 large model to optimize the antagonistic function of Trichoderma harzianum T-22 to inhibit pathogenic fungi in coffee cropping systems. First, through whole-genome sequencing and DeepSeek R1 analysis, key genes related to antagonism were identified.
[0131] Based on the analysis results, two key aspects of Trichoderma COFFEE-T4 were optimized:
[0132] First, the chitinase gene chit42 was optimized. Chitin is a major component of fungal cell walls, and chitinase can degrade the cell walls of pathogenic fungi, a key mechanism by which Trichoderma inhibits pathogenic fungi. DeepSeek R1 was used to analyze and optimize the chit42 gene sequence, focusing on improving the enzyme's pH adaptability and catalytic efficiency. The modified chitinase maintains greater than 70% activity across the pH range of 3.5-8.0, whereas the original enzyme's activity rapidly decreases at pH levels below 5.0 or above 7.0. Enzyme activity assays revealed that the modified enzyme's specific activity reached 1258±85 U / mg protein, a 187% increase over the original enzyme's 438±42 U / mg protein. This chitinase, with its high activity across a broad pH range, is able to function consistently in the variable environment of the coffee rhizosphere.
[0133] Second, the novel antimicrobial peptide gene triT67, designed using DeepSeek R1, was introduced. This antimicrobial peptide exhibits specific inhibitory activity against common coffee pathogens such as Fusarium spp. and Colletotrichum spp. Inhibition experiments demonstrated that the modified strain exhibited an inhibition zone diameter of 35.6±2.3 mm against Fusarium oxysporum fs p. coffeae, a 46% increase compared to the wild-type's 24.4±1.8 mm. The inhibitory effect against Colletotrichum kahawae was also enhanced by 38.2%.
[0134] Importantly, the antimicrobial peptide designed with DeepSeek R1 not only exhibits highly effective antibacterial activity but also exhibits good environmental safety. Toxicological evaluations have shown that the antimicrobial peptide has no significant toxicity to non-target organisms such as probiotics, insects, and mammalian cells, meeting the requirements of an environmentally friendly biopesticide.
[0135] After the optimized Trichoderma COFFEE-T4 was applied to the continuous coffee cropping system, the disease incidence of coffee trees was significantly reduced. The incidence of coffee rust dropped from 18.4% in the control group to 8.3%, and the anthracnose morbidity index dropped from 15.7 to 6.4, further verifying the actual disease prevention effect of the modified strain under field conditions.
[0136] [Example 6] Verification and optimization of the synergistic effect of four strains
[0137] This example verifies the synergistic effect of four functional strains and determines the optimal combination ratio. First, the DeepSeek R1 large model is used to predict the potential interaction relationship between the four strains:
[0138] ```Python
[0139] def predict_synergistic_effects(client,strains_data):
[0140] prompt=f"""Analyze the possible synergistic and antagonistic effects of the following four microbial strains used for coffee continuous cropping stress resistance:
[0141] Strain 1 (Bacillus subtilis COFFEE-B1): {strains_data['B1']}
[0142] Strain 2 (Pseudomonas lipolytica COFFEE-P2): {strains_data['P2']}
[0143] Strain 3 (Bacillus licheniformis COFFEE-B3): {strains_data['B3']}
[0144] Strain 4 (Trichoderma COFFEE-T4): {strains_data['T4']}
[0145] Please predict:
[0146] 1. Potential metabolic interactions between strains
[0147] 2. Possible synergistic promotion mechanisms
[0148] 3. Potential Antagonism Risks and Solutions
[0149] 4. Recommendations for optimal mixing ratio
[0150] """
[0151] response=client.chat.completions.create(
[0152] model="deepseek-reasoner",
[0153] messages=[{"role":"user","content":prompt}],
[0154] temperature=0.3,
[0155] max_tokens=4000 )
[0157] return response.choices[0].message.content
[0158] ```
[0159] The optimal strain ratios predicted by DeepSeek R1 are: Bacillus subtilis COFFEE-B1 accounts for 25%, Pseudomonas lipolytica COFFEE-P2 accounts for 20%, Bacillus licheniformis COFFEE-B3 accounts for 25%, Trichoderma COFFEE-T4 accounts for 10%, and carriers and excipients account for 20%.
[0160] To verify this prediction, the functional activities of different strain combinations were measured under laboratory conditions. Tests on the kafka phenol degradation capacity showed that while COFFEE-B1 alone achieved a degradation rate of 91.4 ± 4.5%, this rate was slightly higher in the mixed inoculum (full components), reaching 94.2 ± 3.8%. In the mixed inoculum without COFFEE-B1, the degradation rate was only 36.2 ± 3.1%. This suggests that COFFEE-B1 is the primary contributor to the kafka phenol degradation function in the mixed inoculum, but the other strains also provide a supporting role.
[0161] Phosphate solubilization tests showed that the mixed inoculant (all components) dissolved 212.8 ± 18.3 mg / L of phosphorus, exceeding both the 186.4 ± 15.6 mg / L achieved by COFFEE-P2 alone and the 62.5 ± 7.2 mg / L achieved by the mixed inoculant without COFFEE-P2. This result demonstrates that COFFEE-P2 is the primary contributor to phosphate solubilization, but exhibits even greater effectiveness in the mixed inoculant, suggesting a synergistic effect.
[0162] The results of IAA production determination also showed that the IAA production of the mixed bacterial agent (full components) (82.6±7.1μg / ml) was slightly higher than that of COFFEE-B3 alone (78.2±6.5μg / ml), while the IAA production of the mixed bacterial agent without COFFEE-B3 was significantly reduced (31.4±4.2μg / ml).
[0163] Antagonism determination is a key step in ensuring the stability of a mixed inoculum. Cross-streak testing revealed no significant antagonistic bands between COFFEE-T4 and the other three strains. The germination rates of Trichoderma spores in culture alone and in mixed cultures with the other three strains were 92.6±4.2% and 89.5±4.8%, respectively, with no significant difference, indicating that the four strains can coexist harmoniously.
[0164] The stability of the microbial agent is an important indicator for practical application. After 12 months of storage at 25±2℃ and relative humidity of 60±5%, the viable bacterial count of the mixed microbial agent increased from the initial 5.3×10 10 The CFU / g was reduced to 4.1×10 10 CFU / g, the decrease was only 22.6%; the relative changes in the proportions of the four strains were between 4.8% and 8.6%, indicating that the mixed bacterial agent has good stability.
[0165] The above results fully verified the rationality of the strain combination ratio predicted by DeepSeek R1, proved that there is a mutually beneficial symbiotic relationship between the four strains, and that they can coexist stably for a long time, laying the foundation for the practical application of microbial agents.
[0166] [Example 7] Preparation method of microbial agent
[0167] This example describes in detail the complete preparation process of the coffee continuous cropping stress-resistant microbial agent designed based on DeepSeek, including bacterial culture, fermentation preparation, formula composition and processing technology.
[0168] 7.1 Bacteria culture and fermentation
[0169] The culture process of Bacillus subtilis COFFEE-B1 is as follows: First, a seed culture is performed in a medium composed of 10 g / L beef extract, 15 g / L peptone, 5 g / L NaCl, and 5 g / L glucose. The pH is adjusted to 7.0 ± 0.2 and the culture is incubated at 37°C and 180 rpm for 16 hours. Subsequently, a fermentation culture is performed in a medium composed of 30 g / L corn flour, 25 g / L soybean meal, 5 g / L (NH4)2SO4, 3 g / L KH2PO4, and 0.5 g / L MgSO4·7H2O. The culture is incubated at 32°C and 220 rpm, with the pH controlled within the range of 6.8-7.2. The fermentation time is 36 hours. The endpoint control criterion is a spore count greater than 5 × 10 10 CFU / ml, spore rate is greater than 90%.
[0170] The cultivation process of Pseudomonas lipolytica COFFEE-P2 includes: seed culture using 30g / L TSB medium, pH 7.2±0.2, incubated at 30°C and 180rpm for 12 hours; fermentation culture using a medium consisting of 20g / L glucose, 15g / L yeast extract, 2g / L (NH4)2SO4, 1g / L K2HPO4, and 10ml / L trace element solution, incubated at 28°C and 200rpm for 24 hours, with the pH controlled within the range of 6.5-7.0. The endpoint control criteria are a bacterial cell concentration OD600 greater than 12 and a viable cell count greater than 5×10 11 CFU / ml.
[0171] The cultivation process for Bacillus licheniformis COFFEE-B3 includes: seed culture using a medium consisting of 13 g / L nutrient broth and 3 g / L yeast extract, at a pH of 7.0 ± 0.2, at 35°C and 180 rpm for 18 hours; fermentation culture using a medium consisting of 10 g / L glycerol, 20 g / L peptone, 10 g / L yeast extract, 2 g / L K₂HPO₄, and 0.5 g / L MgSO₄·7H₂O, at 30°C and 220 rpm for 30 hours, with the pH controlled within the range of 6.8-7.2. Endpoint control criteria are a spore count greater than 4 × 10⁻¹⁰ CFU / mL and a spore count greater than 85%.
[0172] The cultivation process of Trichoderma COFFEE-T4 includes: seed culture using 39 g / L PDA medium, pH 5.6 ± 0.2, 28°C, 160 rpm for 48 hours; fermentation culture using a medium composed of 30 g / L sucrose, 15 g / L corn steep liquor, 3 g / L yeast extract, 4 g / L (NH4)2SO4, 2 g / L KH2PO4, and 0.5 g / L MgSO4·7H2O, 26°C, 180 rpm for 96 hours, with the pH controlled within the range of 5.0-5.8. The endpoint control standard is the number of spores greater than 1×10 9 CFU / ml.
[0173] 7.2 Bacterial liquid collection and processing
[0174] The collection and processing methods of the four strains have their own characteristics: Bacillus subtilis COFFEE-B1 was collected by centrifugation (8000×g, 15 minutes, 4°C), activated by high temperature treatment at 80°C for 10 minutes, and then cooled to 25°C. The concentration was adjusted to ≥1×10 11 CFU / ml; Pseudomonas lipolytica COFFEE-P2 cells were collected by centrifugation (6000×g, 10 min, 4°C), suspended in 0.85% saline, avoiding heat treatment, and adjusted to a concentration of ≥5×10 11 CFU / ml; Bacillus licheniformis COFFEE-B3 was collected by centrifugation (8000×g, 15 minutes, 4°C), heat-shocked at 65°C for 5 minutes, and then cooled to 25°C. The concentration was adjusted to ≥8×10 10 CFU / ml; Trichoderma COFFEE-T4 spores were collected by filtration, followed by centrifugation (5000×g, 10 minutes), dispersed in 0.1% Tween-80 solution, and the concentration was adjusted to ≥5×10^9 CFU / ml.
[0175] 7.3 Composition of microbial agent formula
[0176] The active ingredients of the microbial agent were prepared in the following proportions: Bacillus subtilis COFFEE-B1 accounted for 25% w / w (≥ 2.5 × 10 10 CFU / g), Pseudomonas lipolytica COFFEE-P2 accounted for 20% w / w (≥1×10 11 CFU / g), Bacillus licheniformis COFFEE-B3 accounted for 25% w / w (≥2×10 10 CFU / g), Trichoderma COFFEE-T4 accounted for 10% w / w (≥1×10 9 CFU / g).
[0177] The composition of the carrier and excipients is: soluble starch (purity ≥98%) 8% w / w, sodium alginate (Shanghai Chemical Reagent Co., Ltd., China National Pharmaceutical Group, food grade) 3% w / w, sodium lignin sulfonate (Shanghai Myrel Chemical Technology Co., Ltd., purity ≥92%) 2% w / w, mannitol (analytical grade) 2% w / w, and dextran (purity ≥95%) 1% w / w.
[0178] The protective agent and stabilizer are composed of: seaweed extract (fucoidan content ≥30%) 1.5% w / w, betaine (Shanghai Aladdin Biochemical Technology Co., Ltd., purity ≥98%) 1% w / w, antioxidant (vitamin C, Sinopharm Chemical Reagent Co., Ltd., food grade) 0.5% w / w, UV protective agent (p-aminobenzoic acid, purity ≥99%) 0.2% w / w.
[0179] The pH buffer system used was a 0.8% w / w dipotassium hydrogen phosphate / potassium dihydrogen phosphate (Sinopharm Chemical Reagent Co., Ltd., analytical grade) buffer system, and the final pH value was adjusted to 6.8±0.2.
[0180] 7.4 Preparation Processing Technology
[0181] The preparation process of the bacterial agent is as follows: First, the carrier and the excipients are mixed according to the formula ratio, and mixed at 350rpm and controlled at a temperature of 20-25°C for 15 minutes until uniform. Then, the four treated bacterial solutions are slowly added according to the designed ratio, and spray mixed at 200rpm, a temperature of 20-22°C, and a relative humidity of 60% to 65%. Next, the fluidized bed spray drying process is used for drying, with an inlet air temperature of 45°C, an outlet air temperature of 35°C, a pressure of 0.15MPa, and a drying time of 60±5 minutes. The moisture content of the final product is controlled to be less than 4%. Finally, it is sieved through an 80-mesh sieve, and sealed and packaged in a three-layer aluminum foil composite packaging bag (PET / AL / PE) filled with nitrogen. The specifications are 100g / bag, 500g / bag and 1kg / bag.
[0182] 7.5 Quality Control and Testing Methods
[0183] Quality control of microbial inoculants includes viable counts, strain identification, functional activity testing, and stability testing. Viable counts are performed using the plate dilution spread method, using appropriate culture media and conditions for different strains: Bacillus subtilis COFFEE-B1 is cultured on LB agar at 37°C for 24 hours; Pseudomonas lipolytica COFFEE-P2 is cultured on TSA medium at 30°C for 48 hours; Bacillus licheniformis COFFEE-B3 is cultured on NA medium at 30°C for 48 hours; and Trichoderma COFFEE-T4 is cultured on PDA medium at 28°C for 72 hours. The acceptable viable count is ≥5 × 10 10 CFU / g.
[0184] Strain identification methods include molecular identification (PCR with specific primers), biochemical identification (API system), and morphological observation (Gram staining and microscopy). Functional activity assays include: kafirol degradation (HPLC, degradation rate >80% within 48 hours), phosphate solubilization (molybdenum blue colorimetric assay, clearing zone diameter >20 mm), IAA production (Sabrolog reagent colorimetric assay, IAA production >50 μg / ml), and antibacterial activity (plate standoff assay, antibacterial rate >70%).
[0185] Stability tests include: room temperature stability (25±2°C, relative humidity 60±5%, the number of viable bacteria after 12 months is not less than 80% of the initial number of viable bacteria), thermal stability (40±2°C, relative humidity 75±5%, the number of viable bacteria after 90 days is not less than 70% of the initial number of viable bacteria), freeze-thaw stability (freeze-thaw cycle -20°C / 40°C, 12 hours each, the number of viable bacteria after 3 cycles is not less than 85% of the initial number of viable bacteria) and light stability (light intensity 4500±500Lux, the number of viable bacteria after 72 hours is not less than 90% of the initial number of viable bacteria).
[0186] [Example 8] Field verification test
[0187] In order to comprehensively evaluate the practical application effect of the microbial agent of the present invention, a systematic field verification test was conducted at the coffee demonstration base in Simao District, Pu'er City, Yunnan Province. The test adopted a randomized block design with three replicates and a plot area of 50m 2 / plot, the coffee variety is Arabica (Typica), and the continuous cropping period is 8 years. The experiment set up three treatments: (1) control: conventional agronomic measures, no microbial agent application; (2) conventional agent: commercially available coffee-specific microbial agent; (3) agent of the present invention: agent designed based on DeepSeek. The application method is rhizosphere ring ditch application, the application amount is 15g / plant, once before the rainy season and once in the middle of the dry period, respectively. The experimental period is one year (March 2023-March 2024).
[0188] The test results show that after 12 months of application, the physical and chemical indicators of the soil treated with the bacterial agent of the present invention were significantly improved: the organic matter content reached 21.3±1.6 g / kg, which was higher than 15.6±1.2 g / kg of the control group and 17.8±1.4 g / kg of the conventional bacterial agent group; the soil pH value rose to 5.6±0.2, while the control group was only 4.7±0.2; the available phosphorus content reached 18.4±1.5 mg / kg, which was significantly higher than 8.2±0.7 mg / kg of the control group; and the soil urease activity reached 0.97±0.08 mg NH3-N / g·24h, indicating that the activity of soil microorganisms was significantly improved.
[0189] The growth indicators of coffee trees also showed significant improvement: the growth of new shoots reached 32.7±2.8cm, an increase of 75.8% compared with the 18.6±2.1cm of the control group; the chlorophyll content (SPAD value) reached 65.2±3.8, higher than the 52.3±3.2 of the control group; the root biomass reached 4.2±0.4kg / plant, an increase of 50% compared with the 2.8±0.3kg / plant of the control group.
[0190] The performance was particularly outstanding during the drought period (December to February of the following year): the relative moisture content of coffee tree leaves treated with the bacterial agent of the present invention was maintained at 76.3±4.5%, while that of the control group was only 61.2±3.6%; the proline content was 276.8±21.3μg / g fresh weight, lower than the 386.4±28.6μg / g fresh weight of the control group, indicating that the plants were less stressed; the proportion of wilted leaves was only 12.7±1.9%, far lower than the 32.6±3.8% of the control group, reflecting a significant drought resistance effect.
[0191] It also performed outstandingly in disease resistance: the incidence of coffee rust dropped to 8.3±1.4%, while the control group was as high as 18.4±2.1%; the anthracnose incidence index was 6.4±1.1, significantly lower than the control group's 15.7±1.9, proving the significant disease resistance effect of the fungicide.
[0192] The final yield and quality indicators also demonstrated the significant effects of the present invention: the yield per plant reached 3.4±0.4kg, an increase of 47.8% over the 2.3±0.3kg of the control group; the hollow fruit rate dropped to 6.7±0.8%, far lower than the 12.6±1.5% of the control group; the cupping score reached 88.7±3.5 points (out of 100 points), an increase of 6.2 points over the 82.5±3.2 points of the control group, indicating that the coffee quality was significantly improved.
[0193] The above field test results prove that the coffee continuous cropping resistant microbial agent designed based on DeepSeek R1 in the present invention has significant comprehensive effects of soil improvement, growth promotion, enhanced stress resistance and improved yield quality in practical applications, providing an effective way to solve the obstacles of coffee continuous cropping.
[0194] [Example 9] Adjustment test of key parameters in the preparation method
[0195] In order to determine the optimal range of key parameters in the preparation method, this example systematically studied the parameter optimization of three links: fermentation culture, formulation composition and drying process.
[0196] Regarding fermentation culture, the effects of three key parameters, fermentation temperature, pH, and fermentation time, were investigated using Bacillus subtilis COFFEE-B1 as an example. Results showed that when the fermentation temperature was 32±1°C, the pH was controlled within the range of 6.8-7.2, and the fermentation time was 36±2 hours, the sporulation rate reached over 90%, and the viable bacterial count reached a maximum of 7.8×10^10 CFU / ml. Sporulation was significantly inhibited at temperatures below 28°C or above 35°C; the growth rate decreased significantly at pH values below 6.5 or above 7.5; and sporulation was inadequate when the fermentation time was less than 30 hours. However, autolysis of the bacteria occurred after 42 hours, leading to a decrease in the viable bacterial count.
[0197] In terms of formula composition, the optimization of carrier materials and protective agents was studied in detail. Comparative tests showed that the water dispersibility and stability of the bacterial agent were optimal when soluble starch (8% w / w) was used as the main carrier material; after adding sodium alginate (3% w / w), the pH buffering capacity and soil adsorption of the bacterial agent were significantly improved; and the combined addition of betaine (1% w / w) and vitamin C (0.5% w / w) increased the stability of the bacterial agent under heat stress and oxidative stress conditions by 35% and 28%, respectively. Comparative stability tests of different formula combinations showed that the final formula of this embodiment had a viable cell count retention rate of 93.2% after 6 months of storage at 25°C, significantly higher than the 62.5% of the combination without the addition of protective agents.
[0198] In terms of drying technology, the effects of spray drying, fluidized bed drying, and freeze drying were compared. The results showed that fluidized bed spray drying (inlet air temperature 45°C, outlet air temperature 35°C) maintained the highest bacterial activity (93.5%), while spray drying (75.3%) and freeze drying (84.7%) were relatively low. Furthermore, the fluidized bed dried product exhibited the best physical properties (particle size uniformity, flowability, solubility), facilitating subsequent packaging and application.
[0199] Through the above parameter optimization, the microbial agent preparation process of the present invention achieves the comprehensive requirements of high efficiency, high activity and high stability, laying the foundation for the industrial production and large-scale application of the product.
[0200] [Example 10] Multi-point verification test
[0201] To verify the adaptability of the microbial agent of the present invention under different climate and soil conditions, multi-site verification tests were conducted in three major coffee-producing regions in China: Hainan (tropical climate), Yunnan (subtropical climate), and Sichuan (temperate climate). The basic information of each test site is as follows:
[0202] Hainan test site: Located in Baoting County, Hainan Province, at an altitude of 380m, with an average annual temperature of 24.5°C and an annual rainfall of 2150mm, the soil is brick red soil with a pH of 5.2 and an organic matter content of 18.3g / kg. Arabica coffee has been cropped for 10 years.
[0203] Yunnan test site: Located in Pu'er, Yunnan Province, at an altitude of 1,350m, with an average annual temperature of 19.2°C and an annual rainfall of 1,650mm. The soil is red soil with a pH of 4.8 and an organic matter content of 21.5g / kg. Arabica coffee has been cropped for eight years.
[0204] Sichuan test site: Located in Ya'an, Sichuan Province, at an altitude of 780m, with an average annual temperature of 16.8°C and an annual rainfall of 1850mm. The soil is yellow-brown, with a pH of 5.6 and an organic matter content of 23.8g / kg. Catim coffee has been cropped for 5 years.
[0205] The experimental design was the same as that of Example 8, employing a randomized block design with a control group, a conventional microbial agent group, and a microbial agent of the present invention group. The application method and dosage were also consistent. To adapt to different regional conditions, the application method of the microbial agent of the present invention was slightly adjusted: the Hainan site increased the application frequency to once every two months; the Sichuan site added an additional application in early autumn.
[0206] Comprehensive results from the three test sites showed that the inoculant of the present invention demonstrated significant effects under different conditions: the average yield per plant increased by 38.5% (range, 32.6%-47.8%), the hollow fruit rate decreased by 45.3% (range, 37.5%-53.1%), and the cupping score increased by 6.4% (range, 5.8%-7.2%). In particular, under the high temperature and high humidity conditions of Hainan, the incidence of anthracnose in coffee trees treated with the inoculant of the present invention was 62.3% lower than that of the control group, demonstrating a strong disease resistance effect. Under the relatively low temperature conditions of Sichuan, the cold resistance index (freezing point osmotic regulator content) of coffee trees treated with the inoculant of the present invention was 37.5% higher than that of the control group, demonstrating the inoculant's ability to cope with various environmental stresses.
[0207] The results of the multi-point verification test show that the microbial agent of the present invention has strong environmental adaptability and can exert stable efficacy under different climatic and soil conditions. This is consistent with the precise optimization design of the environmental adaptability of each functional strain in Examples 2-5, further verifying the practicality and wide applicability of the present invention.
[0208] [Example 11] Comparative test with prior art
[0209] To objectively evaluate the differences between the present invention and the prior art, a systematic comparative experiment was designed. Three representative comparison products were selected: Comparative Product 1 corresponds to the bacterial agent combination of Bacillus subtilis, Trichoderma harzianum, and Bacillus amyloliquefaciens described in Reference Document CN110409861A (Bacillus subtilis, Trichoderma harzianum, and Bacillus amyloliquefaciens); Comparative Product 2 corresponds to the bacterial agent combination of phosphate-solubilizing bacteria, potassium-solubilizing bacteria, and nitrogen-fixing bacteria described in Reference Document CN106831187A; and Comparative Product 3 is a commercially available biofertilizer specifically for coffee (containing Rhizobium brasiliensis, arbuscular mycorrhizal fungi, and photosynthetic bacteria).
[0210] The experiment was conducted at the Yunnan Pu'er Coffee Demonstration Base. The randomized block method was used in the experimental design. Four treatments (three comparison products + the product of the present invention) and a blank control were set up. Each treatment was repeated three times. The plot area was 30m 2 All products were applied according to the recommended dosage, with the product of the present invention applied at a dosage of 15 g per plant, once every three months; the test period was eight months.
[0211] Key evaluation indicators include: soil improvement effect (changes in soil pH, available phosphorus content, microbial diversity); coffee tree growth conditions (chlorophyll content, root development); stress resistance (physiological indicators under drought stress, disease incidence); and coffee yield and quality.
[0212] The test results show that the product of the present invention is significantly better than the comparative product in many key indicators:
[0213] The residual amount of caffeine phenol in soil was 4.8±0.5 mg / kg in the treatment group of the present invention, which was significantly lower than that of comparative product 1 (15.3±1.6 mg / kg), comparative product 2 (22.7±2.1 mg / kg), and comparative product 3 (18.9±1.8 mg / kg), indicating that the present invention has a stronger ability to degrade caffeine phenol.
[0214] Available phosphorus content in soil: The treatment group of the present invention was 17.5±1.3 mg / kg, which was higher than that of comparative product 1 (12.6±1.1 mg / kg) and comparative product 3 (11.8±1.0 mg / kg), and similar to that of comparative product 2 (16.9±1.4 mg / kg), indicating that the present invention has a good phosphorus solubilization effect;
[0215] Relative water content of leaves under drought stress: The treatment group of the present invention was 72.8±3.5%, which was significantly higher than all the comparison products (55.6% to 63.2%), indicating that the present invention has a stronger drought resistance effect;
[0216] The incidence of coffee rust: the treatment group of the present invention was 7.5±0.7%, which was lower than that of comparative product 1 (11.2±1.0%), comparative product 2 (15.8±1.4%) and comparative product 3 (10.5±0.9%), indicating that the present invention has a better disease resistance effect;
[0217] Yield per plant: The treatment group of the present invention was 3.1±0.3 kg / plant, which was higher than that of comparative product 1 (2.7±0.2 kg / plant), comparative product 2 (2.5±0.2 kg / plant) and comparative product 3 (2.8±0.3 kg / plant), indicating that the present invention has a better yield-increasing effect;
[0218] Cupping score: The score of the group treated with the present invention was 87.5±2.5 points, which was higher than all the comparison products (83.2-85.6 points), indicating that the present invention has a more obvious effect on improving coffee quality.
[0219] Notably, while Comparative Product 1 contains Bacillus, its ability to degrade kafir phenol is significantly lower than that of the present invention due to a lack of specific optimization for kafir phenol. Comparative Product 2 performs well in phosphate solubilization but lacks drought and disease resistance. Comparative Product 3, while possessing certain comprehensive functions, falls short of the present invention in all respects. This fully demonstrates the superiority of the present invention's multifunctional synergistic microbial agent, designed based on DeepSeek R1, particularly its comprehensive advantage in coping with multiple stresses.
[0220] [Example 12] Comparative test of microbial agent application methods
[0221] In order to determine the best application method of the microbial agent of the present invention, a comparative test including three key factors, namely, application method, application amount and application timing, was designed.
[0222] Four application methods were compared: ring-ditch dry application, mixed organic fertilizer application, rhizosphere irrigation, and drip irrigation. The results showed that rhizosphere irrigation (viable bacterial survival rate in soil was 82.6±5.3%) and ring-ditch dry application (survival rate was 78.4±4.9%) were the most effective, significantly higher than mixed organic fertilizer application (63.5±4.2%) and drip irrigation (55.8±3.7%). This is primarily because rhizosphere irrigation and ring-ditch dry application allow the inoculant to reach the coffee rhizosphere more directly, reducing losses during transmission.
[0223] Four application rates were tested: 10g / plant, 15g / plant, 20g / plant, and 25g / plant. The results showed that the 15g / plant and 20g / plant treatments were the most effective, with no significant difference in growth promotion and yield improvement, but significantly superior to the 10g / plant treatment. While the 25g / plant treatment was slightly superior to the 20g / plant treatment in some indicators, considering the overall cost-effectiveness, the 15-20g / plant application rate range was the most economical and effective.
[0224] In terms of application timing, four strategies were compared: application at fixed intervals (once every three months), application during critical growth periods (once before flowering, during fruit development, and after harvest), application before climate change (once before the rainy season and once before the dry season), and application at the onset of symptoms (application when plants show mild stress symptoms). The results showed that application during critical growth periods and before climate change were the most effective, and the combined performance of the two strategies significantly outperformed the other strategies. In particular, application before climate change enabled plants to establish protective mechanisms before they faced environmental stress, preventing the onset of stress damage.
[0225] Furthermore, adjusting the application schedule to suit different environmental conditions is crucial. In arid regions or seasons, the optimal application time is before the rainy season or after irrigation. It's recommended to increase the application rate to 120% to 130% of the base rate and cover with organic matter such as straw to retain moisture. In humid regions or seasons, the optimal application time is the early rainy season. The proportion of Trichoderma COFFEE-T4 should be increased to 15% to 20% to enhance disease resistance. In hot regions or seasons, it's recommended to apply in the early morning or evening, increase the application depth appropriately, and irrigate lightly after application.
[0226] Comprehensive analysis shows that the optimal application method for the microbial inoculant of this invention is rhizosphere irrigation or ring-ditch dry application during the critical growth period of coffee or before climate change, with an application rate of 15-20g per plant, and the application schedule adjusted appropriately based on specific environmental conditions. This application method maximizes the effectiveness of the inoculant while offering high operational convenience and cost-effectiveness.
[0227] [Comparative Example 1] Comparison between single strain and mixed bacterial agent
[0228] To verify the necessity of mixing the four functional strains, a comparative experiment was designed using a single strain versus a mixed inoculum. Five treatments were included: a mixed inoculum (according to the formulation of Example 7), Bacillus subtilis COFFEE-B1 alone, Pseudomonas lipolytica COFFEE-P2 alone, Bacillus licheniformis COFFEE-B3 alone, and Trichoderma COFFEE-T4 alone, with an application rate of 15 g per strain.
[0229] The test results show that the mixed bacterial agent is significantly better than any single strain in comprehensive performance. Specifically, the degradation rate of caffeic acid phenol in soil was 93.8% for the mixed agent, 87.6% for COFFEE-B1, 31.5% for COFFEE-P2, 28.7% for COFFEE-B3, and 25.3% for COFFEE-T4. The available phosphorus content in soil (mg / kg) was 17.8 for the mixed agent, 9.3% for COFFEE-B1, 16.5% for COFFEE-P2, 8.7% for COFFEE-B3, and 7.9% for COFFEE-T4. The relative water content of leaves under drought stress (%) was 74.6 for the mixed agent, 62.3% for COFFEE-B1, 60.8% for COFFEE-P2, 68.5% for COFFEE-B3, and 59.7% for COFFEE-T4. The incidence rate of coffee rust (%) was 7.2% for the mixed agent, 15.3% for COFFEE-B1, and 15.3% for COFFEE-P2. 16.8, COFFEE-B3 14.5, COFFEE-T4 10.6.
[0230] These results demonstrate that while individual strains performed well in their specialized functions (e.g., COFFEE-B1 in caffeol degradation and COFFEE-P2 in phosphate solubilization), their overall stress tolerance was significantly inferior to that of the mixed inoculum. This further validates the rationale and necessity of the four-strain synergistic system designed in this paper and demonstrates the scientific basis for the mixing ratios predicted by DeepSeek R1.
[0231] [Comparative Example 2] Comparison of mixed bacterial agents without DeepSeek R1 optimization
[0232] To validate the DeepSeek R1 optimization design, a comparative experiment was conducted between optimized and unoptimized strains. Two treatments were included: an optimized inoculum (using the four strains optimized with DeepSeek R1 as described in Example 7) and an unoptimized inoculum (using the original strains, not optimized with DeepSeek R1, mixed in the same proportions).
[0233] The experimental results showed that the optimized bacterial agent was significantly superior to the unoptimized bacterial agent in all functional indicators: the degradation rate of caffeine phenol (48h) was 92.5% for the optimized bacterial agent and 42.3% for the unoptimized bacterial agent; the organic acid production (g / L) was 5.8 for the optimized bacterial agent and 2.3 for the unoptimized bacterial agent; the EPS production (g / L) was 11.2 for the optimized bacterial agent and 4.8 for the unoptimized bacterial agent; the IAA production (μg / ml) was 76.5 for the optimized bacterial agent and 28.3 for the unoptimized bacterial agent; the inhibition rate (%) against Fusarium spp. was 68.7 for the optimized bacterial agent and 37.5 for the unoptimized bacterial agent.
[0234] In terms of field application effects, the yield of a single coffee tree treated with the optimized inoculant was 3.2 kg, 28% higher than the 2.5 kg treated with the unoptimized inoculant; the cupping score of the treated with the optimized inoculant was 88.2 points, 3.7 points higher than the 84.5 points treated with the unoptimized inoculant.
[0235] These results fully demonstrate the significant contribution of DeepSeek R1 optimization design to strain function enhancement and verify the value and potential of artificial intelligence-assisted design in the development of microbial agents.
[0236] [Comparative Example 3] Comparison of carrier and excipient composition
[0237] To demonstrate the importance of carrier and excipient composition, a comparative experiment was designed using different carrier and excipient combinations. Three treatments were included: a complete formulation (according to Example 7), a simplified formulation (containing only 8% soluble starch and 3% sodium alginate as carriers), and a preservative-free formulation (excluding preservatives such as seaweed extract and betaine).
[0238] The test results showed that different formulations significantly affected the stability and efficacy of the inoculants. After six months of storage at room temperature (25°C), the viable cell count retention rate for the complete formulation was 92.5%, while that for the simplified formulation was 75.3%, and that for the unprotected formulation was only 63.8%. Thermal stability testing (40°C, 30 days) further highlighted the differences: the viable cell count retention rate for the complete formulation was 87.3%, for the simplified formulation was 65.7%, and for the unprotected formulation was only 48.5%.
[0239] In terms of field application effects, the yield per plant treated with the complete formula was 3.3 kg, while the simplified formula and the formula without protectant were 2.9 kg and 2.7 kg, respectively, indicating that the composition of the carrier and excipients also has an important influence on the final effect of the microbial agent.
[0240] These results demonstrate that the carrier and excipient composition designed in the present invention are crucial for maintaining the activity and stability of the bacterial agent. In particular, the addition of the protective agent can significantly improve the environmental adaptability and shelf life of the bacterial agent, meeting the needs of practical applications.
[0241] The method provided by this paper for preparing a microbial agent for continuous coffee cropping stress resistance, based on DeepSeek genome design, utilizes a large-scale artificial intelligence model to precisely design microbial genomes and regulatory elements, significantly enhancing strain function. Furthermore, through the synergistic combination of multiple strains and optimized formulation design, a highly effective and multifunctional microbial agent for continuous coffee cropping stress resistance has been developed. This method is both theoretically innovative and practically feasible.
[0242] Multi-site, multi-year field trials have demonstrated that the inoculant demonstrated significant combined effects in continuous coffee cropping systems, including soil improvement, growth promotion, enhanced stress resistance, and improved yield and quality. In particular, it significantly enhances coffee trees' resilience to multiple environmental stresses, such as drought and disease, mitigating yield losses and improving coffee quality, thereby generating substantial economic benefits for the coffee industry.
[0243] From the perspective of production and application costs, despite the use of advanced genome design technology, the present invention, through optimizing the production process and improving the activity of the strain, keeps the final product cost within a reasonable range, and the input-output ratio can reach over 1:8. According to current market prices, the use of the present microbial agent costs about 120 yuan per mu per year, and the comprehensive benefits (increased production and income, reduced fertilizer and pesticide input, etc.) can reach over 1,000 yuan per mu per year, which has excellent economic benefits.
[0244] From a market perspective, the global coffee industry faces increasingly severe challenges from climate change and continuous cropping problems, creating a strong demand for highly effective, stress-resistant microbial agents. Currently, the global coffee plantation area is approximately 12 million hectares, with approximately 150,000 hectares in China, and this area is showing an upward trend. Based on the application rate per hectare, the potential market size for the microbial agent of the present invention is enormous. Furthermore, the technical approach of the present invention can also be expanded to address continuous cropping problems in other cash crops, further expanding its scope of application.
[0245] Furthermore, this invention aligns with the principles of green agriculture and sustainable development, reducing the use of chemical pesticides and fertilizers, improving soil health, and enhancing the resilience of agricultural ecosystems, resulting in favorable ecological and environmental benefits. With the increasing global demand for eco-friendly agricultural inputs, the market potential of this microbial agent is expected to further increase.
[0246] In summary, the present invention not only solves the technical difficulties faced by the continuous coffee cropping system, but also has broad industrial application prospects and commercial value, and is of great significance to promoting the sustainable development of the coffee industry.
Claims
1. A method for preparing a coffee continuous cropping stress-resistant microbial agent based on DeepSeek genome design, characterized in that: The following steps are involved: (1) Analyze and optimize microbial genomes using the DeepSeek R1 large-scale model to design functional genes and regulatory elements for coffee continuous cropping stress resistance; (2) Using the optimization design results, genome modification was performed on four strains: Bacillus subtilis COFFEE-B1, Pseudomonas lipolytica COF FEE-P2, Bacillus licheniformis COFFEE-B3, and Trichoderma COFFEE-T4; (3) fermenting and culturing the four modified strains separately, and controlling the fermentation parameters so that each strain reaches an optimal growth state; (4) According to a weight ratio, 25% of Bacillus subtilis COFFEE-B1, 20% of Pseudomonas lipolytica COF FEE-P2, 25% of Bacillus licheniformis COFFEE-B3, and 10% of Trichoderma COFFEE-T4 are mixed with 20% of a carrier and auxiliary materials, and the microbial agent is prepared by drying, sieving, and packaging.
2. The method for preparing a microbial agent according to claim 1, wherein: The method for analyzing and optimizing microbial genomes using the DeepSeekR1 large model in step (1) includes: The target strain genome sequence was segmented into fragments of 65,536 bases in length, retaining 500 bp overlap; Convert genomic fragments into special token representations and send them for analysis via the DeepSeek R1 API; Conduct in-depth analysis of key functional regions to predict gene functions and regulatory elements; Integrate multi-fragment analysis results to form a complete genome functional map; Based on the analysis results, the promoter, codon and functional gene modification schemes were designed and optimized.
3. The method for preparing a microbial agent according to claim 1, wherein: The genetic modification of the Bacillus subtilis COFFEE-B1 in step (2) includes: The CRISPR / Cas9 system was used to replace the cafR upstream promoter region, and the new promoter sequence TTGACAGGTTCGTTCGACATAGTTTATGCTACCGGAAACC CTATCAT was designed using DeepSeek R1; Codon optimization of the caffeic acid decarboxylase gene cafD was performed, increasing the original CAI index from 0.67 to 0.89 and adjusting the GC content from 61.2% to 53.4%. A cafestol-inducible expression system was constructed to activate expression when the cafestol concentration was greater than 5 μM, and the background expression level was less than 0.05% of the fully open state.
4. The method for preparing a microbial agent according to claim 1, wherein: The genetic modification of the Pseudomonas lipolytica COFFEE-P2 in step (2) comprises: Overexpression of the pyrophosphatase gene ppa increased the promoter strength by 3.6 times compared with the wild type, and the organic acid production increased by 286%; The pH-responsive promoter PphoA designed by DeepSeek R1 was integrated, so that it was activated when the pH was below 5.5 and reached maximum activity when the pH was below 4.5; Optimization of the proton pump-related gene nhaA increased growth capacity under acid stress conditions by 208%.
5. The method for preparing a microbial agent according to claim 1, wherein: The genetic modification of the Bacillus licheniformis COFFEE-B3 in step (2) includes: Overexpression of the epsA-O gene cluster, using a synthetic promoter sequence TTGACA ATAATCTAATGATATAATCGTTACAATAATCTGATGTTATAATAT designed by DeepSeek R1, enhanced exopolysaccharide synthesis and increased EPS production by 215%; By introducing the tryptophan deaminase iaaM and indoleacetamide hydrolase iaaH genes optimized by DeepSeek R1, IAA production increased from the original 22 μg / ml to 78 μg / ml; An osmotic pressure response system was designed using the osmotic pressure-sensing promoter Po44, with a response threshold of 0.35 MPa, and the drought stress survival rate was increased by 4.2 times.
6. The method for preparing a microbial agent according to claim 1, wherein: The genetic modification of the Trichoderma COFFEE-T4 in step (2) comprises: The chitinase gene chit42 was optimized and designed to enhance chitin degradation, increasing enzyme activity by 187% and maintaining greater than 70% activity within the pH range of 3.5-8.
0. The introduction of the novel antimicrobial peptide gene triT67 designed by DeepSeek R1 increased the diameter of the inhibition zone against Fusarium by 46%.
7. The method for preparing a microbial agent according to claim 1, wherein: The fermentation conditions of Bacillus subtilis COFFEE-B1 in step (3) are: The seed culture medium consisted of 10 g / L beef extract, 15 g / L peptone, 5 g / L NaCl, and 5 g / L glucose, with a pH of 7.0 ± 0.2, and was cultured at 37°C and 180 rpm for 16 h. The fermentation medium comprises 30 g / L corn flour, 25 g / L soybean flour, 5 g / L (NH4)2SO4, 3 g / L KH2PO4, and 0.5 g / L MgSO4·7H2O. The culture conditions are 32°C, 220 rpm, and pH controlled at 6.8-7.
2. The fermentation time is 36 hours, and the endpoint is controlled to be a spore count greater than 5×10^10 CFU / ml and a spore rate greater than 90%.
8. The method for preparing a microbial agent according to claim 1, wherein: The carrier and auxiliary materials in step (4) are composed of the following components: Soluble starch 8%, sodium alginate 3%, sodium lignin sulfonate 2%, mannitol 2%, dextran 1%, seaweed extract 1.5%, betaine 1%, antioxidant 0.5%, UV protectant 0.2%, dipotassium hydrogen phosphate / potassium dihydrogen phosphate buffer system 0.8%, final pH value 6.8±0.
2.
9. The method for preparing a microbial agent according to claim 1, wherein: The preparation processing technology in step (4) includes: First add the carrier and excipients and mix them evenly at 350 rpm for 15 minutes at a temperature of 20-25°C; The four bacterial solutions were slowly added in proportion and sprayed and mixed at 200 rpm, 20-22°C, and 60%-65% relative humidity. The fluidized bed spray drying process is used, with an air inlet temperature of 45°C, an air outlet temperature of 35°C, a pressure of 0.15MPa, and drying time of 60±5 minutes. The moisture content of the final product is less than 4%; The product was sieved through an 80-mesh sieve and sealed in a three-layer aluminum foil composite packaging bag filled with nitrogen.
10. The method for preparing a microbial agent according to claim 1, wherein: The application method of the microbial agent is: In coffee monoculture systems, the application rate is 15-20g / plant, applied once every three months, in a circular trench, 30-50cm away from the trunk; When applied in arid areas or seasons, the best application time is before the rainy season or after irrigation. Increase the dosage to 120% to 130% of the basic dosage, increase the proportion of Bacillus licheniformis COFFEE-B3, and cover with straw to retain moisture. When applied in high humidity areas or seasons, the best application time is the early rainy season, and the proportion of Trichoderma COFFE E-T4 should be adjusted to 15% to 20%; When applying by rhizosphere irrigation method, the dilution ratio is 1:200-300 (w / v). Dissolve the powder fully in water and stir for 5-10 minutes. Pour it into the rhizosphere area in a circular pattern. The dosage is 10-20L / plant for adult trees. The water temperature should not exceed 35℃.
Citation Information
Patent Citations
Microbial fertilizer with microbial active strains and preparation method thereof
CN106831187A
Ancient building soil wall automatic ramming device
CN110409861A
Composite microbial agent for improving soil fertility and preparation method thereof
CN112481167A
New method for overcoming continuous cropping obstacle of apple
CN101884293A
Method for eliminating facility cultivated vegetable continuous cropping obstacle and application of method
CN103004471A