Corn ALS mutant gene and application thereof in herbicide resistance

Abstract

The invention discloses a corn ALS mutant gene and application of the corn ALS mutant gene in herbicide resistance. The invention provides a method for improving the herbicide resistance of corn, which comprises the following steps: mutating 493th nucleotides of a ZmALS1 gene and a ZmALS2 gene in a corn genome from C to G so as to improve the herbicide resistance of the corn, the nucleotide sequence of the ZmALS1 gene is shown in SEQ ID No. 1; the nucleotide sequence of the ZmALS2 gene is shown in SEQ ID No. 2. Specific sites in corn ZmALS1 and ZmALS2 serve as sgRNA recognition sites on the basis of the principle of a base editing technology, a single base replacement editing vector capable of simultaneously targeting the ZmALS1 and ZmALS2 is designed, the gene editing vector is stably transformed through agrobacterium to obtain a transgenic plant, and the resistance to herbicides is remarkably improved.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering and relates to a corn ALS mutant gene and application thereof in herbicide resistance. Background Art

[0002] In farmland ecosystems, weeds are among the most harmful organisms that harm crop growth. During crop growth, they compete with crops for light, growing space, and nutrients, severely impacting their growth and development. Furthermore, weeds spread pests and diseases and release toxic substances, leading to reduced crop yields and quality. Traditional weed control is time-consuming and labor-intensive. With technological advancements, chemical weed control has become increasingly popular. While chemical weed control is time-saving, easy to use, and reduces labor intensity, effectively controlling weeds, it also has some negative side effects. For example, when weeds coexist with crops in farmland, improper use of herbicides can cause crop damage, easily leading to the death of herbicide-sensitive crops. Furthermore, with the widespread use of ALS herbicides in agricultural production, the damage caused by herbicide residues to subsequent crops is becoming increasingly serious, with a more pronounced impact on crop yield and quality. Therefore, targeted gene editing to induce mutations in endogenous genes in crops, such as corn, without affecting their intended activity, holds great significance and has significant industrial application value.

[0003] Base editing is a precise gene editing technique that can replace specific bases without causing double-strand breaks in the DNA. It uses fusion proteins to link a DNA-binding protein with an enzyme that catalyzes base changes. For example, base editors based on the CRISPR-Cas system use guide RNA to bring the Cas protein to the target DNA sequence, forming an R-loop structure that exposes the non-targeted strand. Deaminases act on single-stranded DNA, catalyzing the deamination of specific bases. The edited bases are then stabilized in the genome through intracellular DNA repair mechanisms. Summary of the Invention

[0004] The technical problem solved by the present invention is how to improve the resistance of corn to herbicides.

[0005] In order to solve the above technical problems, the first aspect of the present invention provides a method for improving corn resistance to herbicides, comprising the following steps: mutating the 493rd nucleotide of the ZmALS1 gene and the ZmALS2 gene in the corn genome from C to G, thereby improving the corn resistance to herbicides;

[0006] The nucleotide sequence of the ZmALS1 gene includes SEQ ID No. 1;

[0007] The nucleotide sequence of the ZmALS2 gene includes SEQ ID No.2.

[0008] Specifically, the nucleotide sequence of the ZmALS1 gene is SEQ ID No. 1;

[0009] The nucleotide sequence of the ZmALS2 gene is SEQ ID No. 2.

[0010] In the above method, the improving the herbicide resistance of corn may be making the corn resistant to the herbicide;

[0011] Furthermore, the above-mentioned improvement in corn's resistance to herbicides can be reflected in that corn with the 493rd nucleotide of both ZmALS1 gene and ZmALS2 gene mutated from C to G has improved herbicide resistance, or has herbicide resistance, compared with wild-type corn with unmutated ZmALS1 gene and ZmALS2 gene.

[0012] In the method described above, the mutation is achieved through a CBE single-base editor, and the target of the CBE single-base editor is positions 486-509 of SEQ ID No.1 or positions 486-509 of SEQ ID No.2.

[0013] In the method described above, the CBE single-base editor includes an ALS-CBE single-base editing vector, which expresses nCas9 (D10A), APOBEC1 deaminase, UGI protein and sgRNA targeting the target.

[0014] In the method described above, the sgRNA is the RNA encoded by positions 10086-10182 of SEQ ID No.5.

[0015] In the method described above, the nucleotide sequence of the ALS-CBE single-base editing vector is obtained by connecting SEQ ID No. 5 and SEQ ID No. 6 in sequence (the last base of SEQ ID No. 5 is adjacent to the first base of SEQ ID No. 6).

[0016] In a second aspect, the present invention provides a biological material, which is a substance that causes the 493rd nucleotide of the ZmALS1 gene and the ZmALS2 gene in the corn genome to mutate from C to G;

[0017] The substance is specifically any one of the following:

[0018] (A1) the sgRNA described in the first aspect;

[0019] (A2) The CBE single-base editor described in the first aspect;

[0020] (A3) the ALS-CBE single-base editing vector described in the first aspect;

[0021] (A4) A recombinant bacterium containing the ALS-CBE single-base editing vector described in the first aspect.

[0022] In a third aspect, the present invention provides the use of the biomaterial described in the second aspect in any of the following:

[0023] (B1) Improve corn's resistance to herbicides;

[0024] (B2) making corn resistant to herbicides;

[0025] (B3) Develop herbicide-resistant corn varieties;

[0026] (B4) Cultivate corn varieties with high herbicide resistance.

[0027] In a fourth aspect, the present invention provides a biomaterial, which is any one of the following:

[0028] (C1) a protein with an amino acid sequence as shown in SEQ ID No. 3 or 4;

[0029] (C2) a nucleic acid molecule encoding the protein described in (C1);

[0030] (C3) An expression cassette, recombinant vector or recombinant bacterium containing the nucleic acid molecule described in (C2).

[0031] In the biological material described in the fourth aspect above, the nucleic acid molecule is obtained by mutating the 493rd nucleotide of the DNA molecule shown in SEQ ID No.1 from C to G, or by mutating the 493rd nucleotide of the DNA molecule shown in SEQ ID No.2 from C to G.

[0032] In a fifth aspect, the present invention provides use of the biomaterial according to the fourth aspect in any of the following:

[0033] (B1) Improve corn's resistance to herbicides;

[0034] (B2) making corn resistant to herbicides;

[0035] (B3) Develop herbicide-resistant corn varieties;

[0036] (B4) Cultivate corn varieties with high herbicide resistance.

[0037] Alternatively, the present invention provides a method for detecting whether the 493rd nucleotide of the ZmALS1 gene and the ZmALS2 gene in the maize genome to be tested has mutated from C to G, and the method is used in any of the following:

[0038] Alternatively, the present invention provides a method for detecting whether a maize genome to be tested contains a ZmALS1 gene mutant nucleic acid and a ZmALS2 gene mutant nucleic acid, and the method is used in any of the following applications:

[0039] The ZmALS1 gene mutant nucleic acid is obtained by mutating the 493rd nucleotide of the DNA molecule shown in SEQ ID No. 1 from C to G;

[0040] The ZmALS2 gene mutant nucleic acid is obtained by mutating the 493rd nucleotide of the DNA molecule shown in SEQ ID No. 2 from C to G;

[0041] (D1) detecting or assisting in detecting the herbicide resistance of the tested corn;

[0042] (D2) detecting or assisting in detecting whether the tested corn has herbicide resistance;

[0043] (D3) preparing a product for detecting or assisting in detecting the herbicide resistance level of the tested corn;

[0044] (D4) preparing a product for detecting or assisting in detecting whether the corn to be tested has herbicide resistance;

[0045] (D5) Cultivate highly herbicide-resistant corn;

[0046] (D6) Prepare and cultivate high herbicide-resistant corn products.

[0047] The above herbicide, specifically (ALS) herbicide.

[0048] Furthermore, the (ALS) herbicide is specifically imazapic, cypermethrin, chlorsulfuron and / or flucarbazone sodium.

[0049] Based on the principles of base editing technology, the present invention uses specific sites in maize ZmALS1 and ZmALS2 as sgRNA recognition sites. A single-base substitution editing vector capable of simultaneously targeting ZmALS1 and ZmALS2 was designed. This gene editing vector was stably transformed with Agrobacterium to obtain transgenic plants, including a series of mutants with site-directed mutations in the target regions of maize ZmALS1 and ZmALS2. Using the wild-type receptor as a control, the mutant plants were tested in culture with the herbicides imazamox, cypermethrin, chlorsulfuron, and fluazifop-sodium. The results showed that the mutant plants had significantly improved herbicide resistance, indicating that the ALS protein encoded by the mutant gene at the P165A site of maize ALS1 and ALS2 is resistant to multiple herbicides. Application of this mutant gene in maize can significantly improve the herbicide tolerance of maize. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1Comparison of ALS protein sequences and phylogenetic tree analysis of different species.

[0051] Figure 2 Schematic diagram of the ALS-CBE single-base editing vector structure.

[0052] Figure 3 These are the target site sequencing results of homozygous transgenic maize plants with single-base mutations.

[0053] Figure 4 Detection of herbicide resistance of ALS1 / ALS2 mutant materials. DETAILED DESCRIPTION

[0054] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0055] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0056] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0057] The materials used in the embodiments of the present invention are as follows:

[0058] 1. Plant materials

[0059] The plant materials used in this study were the maize KN5585 inbred line, genetic transformation materials entrusted to Weimi Biotechnology (Jiangsu) Co., Ltd., and the progeny materials of the transformation materials.

[0060] 2. Vectors and strains

[0061] Vector: The gene editing vector maintained by our laboratory is the CUB backbone vector. The CUB backbone vector is described in "Yanmin Li, et al. Precise base editing of non-allelic acetolactate synthase genes confers sulfonylurea herbicide resistance in maize." Acta Agronomica Sinica, 2020, Vol. 3, No. 3, pp. 449-456. The public can obtain the vector from the applicant for use solely in replicating the experiments described in this invention and for no other use.

[0062] Bacterial strain: Trans1-T1 Phage Resistant Chemically Competent Cell (Beijing Quanshijin Biotechnology Co., Ltd., CD501-02).

[0063] 3. Enzymes

[0064] High-fidelity PCR enzyme KAPA HiFi HotStart Ready MixPCR Kit (Beijing Juhuatech Technology Co., Ltd., KK2602), homologous recombination enzyme HiFi DNA Assembly Master Mix (Beijing Bailingke Biotechnology Co., Ltd., E2621L), HindⅢ restriction endonuclease (Beijing Bailingke Biotechnology Co., Ltd., R0104), MauBI restriction endonuclease (Beijing Bailingke Biotechnology Co., Ltd., R0113S), etc.

[0065] 4. Test kit

[0066] QIAquick GelExtraction Kit (250) (Beijing Qiangxinborui Biotechnology Co., Ltd., 28706), AxyPrep Plasmid Extraction Kit (Axygen, AP-MN-P-250), etc.

[0067] Example 1. Preparation of maize ALS mutants

[0068] 1. Acquisition of the ALS gene in maize

[0069] Through the comparison of ALS protein sequences and phylogenetic tree analysis of different species ( Figure 1 ) and obtained two maize homologous genes, ZmALS1 (Gene ID: Zm00001d016572, Sequence 1) and ZmALS2 (Gene ID: Zm00001d050567, Sequence 2). The nucleotide sequence of gene ZmALS1 in the genome is Sequence 1, and the nucleotide sequence of gene ZmALS2 in the genome is Sequence 2.

[0070] 2. Obtaining ALS mutation sites in maize and constructing plant expression vectors

[0071] The following nucleotide sequence segments of the maize ALS1 and ALS2 genes (5'-caggtgccgcgacgcatgattgg-3', positions 487-509 of SEQ ID 1 or 487-509 of SEQ ID 2) were selected as target sites, respectively. CRISPR / Cas9-mediated precision editing was used for base editing.

[0072] The ALS-CBE single-base editing vector was constructed based on the CUB vector of our research group and modified into a CBE single-base editor suitable for corn.

[0073] The ALS-CBE single-base editing vector was modified as follows: (1) Cas9 protein was mutated to nCas9(D10A); (2) APOBEC1 was attached to the N-terminus of nCas9(D10A); and (3) UGI was attached to the C-terminus of nCas9(D10A), with a linker peptide between the two. The nCas9(D10A) protein promoter is the maize Ubiquitin gene promoter. The sgRNA promoter is ZmU6-2, a highly efficient RNA polymerase promoter identified and screened from maize.

[0074] Elements of the ALS-CBE single-base editing vector (such as Figure 2 The present invention relates to a novel Cas9 vector (shown in FIG) comprising: UGI nCas9 (D10A), a connecting peptide, APOBEC1, a maize Ubiquitin gene promoter, sgRNA, and the sgRNA promoter ZmU6-2.

[0075] The nucleotide sequence of the ALS-CBE single-base editing vector is obtained by sequentially concatenating SEQ ID No. 5 and SEQ ID No. 6. Among them, positions 9689-10017 of SEQ ID No. 5 are the ZmU6-2 promoter, positions 10086-10182 are the coding sequence of the sgRNA (wherein positions 10085-10107 are the coding sequence of the target binding region in the sgRNA), and positions 10202-12198 are the maize Ubiquitin gene promoter.

[0076] In SEQ ID No. 6, positions 135-821 are the gene encoding APOBEC1 deaminase; positions 870-4970 are the gene encoding nCas9 (D10A), positions 4971-4982 are the gene encoding the connecting peptide, positions 4983-5231 are the gene encoding UGI, and positions 5326-5578 are the NOS terminator.

[0077] 3. Genetic transformation of maize embryos

[0078] The ALS-CBE single-base editing vector obtained in step 2 was introduced into the Agrobacterium tumefaciens EHA105 strain; embryo infection, co-cultivation, callus induction, seedling differentiation, and rooting induction were performed to obtain positively transformed seedlings. The specific steps are as follows:

[0079] Agrobacterium-mediated genetic transformation of maize

[0080] (1) Treatment of receptor materials

[0081] Seeds of the maize inbred line KN5585 were soaked in water at 37°C for 4 hours, then germinated in a 28°C dish for 48 hours. The germinated seeds were then placed in a pot of nutrient soil and cultured. Ten days after pollination, immature embryos were selected for callus induction. Young maize ears were sterilized with 75% (volume fraction) ethanol for 10 minutes on a workbench, rinsed with sterile water, and air-dried. The kernels were then cut in half with a scalpel, and the immature embryos were separated with tweezers and placed in sterile water until ready for use.

[0082] (2) Callus induction and subculture

[0083] Place the young embryos on N6 medium (BINDER, AA958) and culture in the dark at 28°C for one week. Cut the vigorously growing and brightly colored callus into small pieces and place them on N6 medium for further culture. Subculture once every two weeks to maintain the callus in good condition and select the well-growing callus for later use.

[0084] (3) Agrobacterium infection

[0085] Take out the preserved Agrobacterium (which has been introduced with the ALS-CBE single base editing vector), inoculate and shake the bacteria, and wait for the OD 600 The value was about 0.8, and the cells were collected by centrifugation at 5000 r / min for 10 min. The cells were suspended in infection buffer (1 L infection buffer was prepared by mixing 4 g of N6 medium basal salt containing N6 vitamins, 2 mg 2,4-D, 100 mg inositol, 0.7 g L-proline, 68.4 g sucrose, 36 g glucose, 1 mL of 10 mg / mL AgNO3, 1 mL of 100 mol / L As and water, pH 5.2) to make the OD 600 The value was about 0.5, and then oscillated at 28°C and 150 rpm for 0.5 h to obtain the infection solution. The well-growing callus selected in (2) was immersed in the infection buffer for 1 h, then transferred to the infection solution containing Agrobacterium and immersed for 15 min, and dried to obtain the infected callus.

[0086] (4) Co-culture and recovery culture

[0087] The infected callus was placed in a co-culture medium (1 L co-culture medium was prepared by mixing 4 g of N6 medium basal salts containing N6 vitamins, 2 mg 2,4-D, 30 g sucrose, 8 g agar, 1 mL of 10 mg / mL AgNO3, 1 mL of 100 mol / L As, 3 mL of 100 mg / mL L-cysteine and water, pH 5.8), cultured at 20°C for 3 days, transferred to a recovery medium (1 L recovery medium was prepared by mixing 4 g of N6 medium basal salts containing N6 vitamins, 2 mg 2,4-D, 0.7 g L-proline, 30 g sucrose, 0.5 g MES, 4 g phytagel, 1 mL of 10 mg / mL AgNO3, 1 mL of 250 mg / mL cephalosporin and water, pH 5.8) and cultured for 10 days. The positive callus was then selected by adding glufosinate-ammonium recovery medium.

[0088] (5) Differentiation, redifferentiation, rooting, and seedling hardening

[0089] The positive callus tissue was transferred to an embryoid induction medium (1L embryoid induction medium was prepared by mixing 4.43g of MS medium basal salts (containing inositol) containing MS vitamins, 0.25mg 2,4-D, 30g sucrose, 5mg 6-BA, 4g plant gel, 1mL of Cefo with a concentration of 250mg / mL and water, pH5.8), cultured in the dark for 2 weeks, and then transferred to a differentiation medium (1L differentiation medium was prepared by mixing 4.43g of MS medium basal salts (containing inositol) containing MS vitamins, 30g sucrose, 4g plant gel, 1mL of Cefo with a concentration of 250mg / mL and water, pH5.8), and transferred to a rooting medium (1L rooting medium was prepared by mixing 2.215g 1 / 2MS, 30g sucrose, 51.55mg MS vitamins, obtained by mixing 4g of plant gel and water, pH 5.8) took root, grew to a certain height, exposed to air for 3 days, and transplanted.

[0090] (6) Bar test strips to screen positive plants

[0091] Take a plant leaf of about 3 cm, put it into a tube and grind it thoroughly, add 500 μl of buffer, and insert it into a Bar test strip (Shanghai Youlong Biotechnology Co., Ltd., catalog number: EnviroLogix AS03). The plant with a positive band is the T0 transgenic positive transformant.

[0092] 4. Obtaining and analyzing maize ALS mutants

[0093] T0 transgenic positive transformants obtained through Agrobacterium-mediated genetic transformation of maize immature embryos (described in 3 above) were used. Leaf DNA was extracted and the target site sequences were amplified (primer sequences: ALS1-F518TCCGACATCCTCGTCGAGGCTC, ALS1-R518CTCATGGGCGTGTCCCAGGCC, ALS2-F518GC CGACATCCTCGTCGAGTCCC, ALS2-R518CTCATGGGCTTGTCCCAGACA). Sanger sequencing was performed. Transgenic maize containing a positive T0 generation single-base mutation was identified when compared to the sequence of the ZmALS1 gene (SEQ ID No. 1) or ZmALS2 gene (SEQ ID No. 2) in wild-type maize KN5585.

[0094] T0 is test-crossed to obtain the T1 generation, which is then further self-crossed until the T3 generation of homozygous transgenic maize plants with single base mutations are obtained, that is, ALS1 / ALS2 mutant materials with no transgenic element insertion and homozygous mutation sites.

[0095] Genomic DNA from leaves of T3 generation single-base mutation transgenic maize homozygous plants was extracted and PCR amplified using primers ALS1-F518TCCGACATCCTCGTCGAGGCTC and ALS1-R518CTCATGGGCGTGTCCCAGGCC, as well as primers ALS2-F518GCCGACATCCTCGTCGAGTCCC and ALS2-R518CTCATGGGCTTGTCCCAGACA, to obtain two PCR products for sequencing.

[0096] The sequencing results of the two PCR products of the T3 generation single base mutation transgenic maize homozygous plants are as follows: Figure 3 As shown:

[0097] Compared with the ZmALS1 gene sequence in the wild-type material KN5585, it was found that the regions corresponding to the ZmALS1 gene on the two homologous chromosomes in the T3 generation single base mutation transgenic maize homozygous plants underwent the following changes: the C at the 7th position of the target site mutated to G (i.e., the 493rd base of SEQ ID No.1 mutated from C to G), resulting in a single base mutation in the gene and obtaining the mutant protein ZmALS1. P165A ;

[0098] Compared with the ZmALS1 gene sequence in the wild-type material KN5585, it was found that the regions corresponding to the ZmALS2 genes on the two homologous chromosomes in the T3 generation single base mutation transgenic maize homozygous plants underwent the following changes: the C at the 7th position of the target site mutated to G (i.e., the 493rd base of SEQ ID No. 2 mutated from C to G), resulting in a single base mutation in the gene and obtaining the mutant protein ZmALS2. P165A ;

[0099] The T3 generation single base mutation transgenic maize homozygous plants were named ALS1 / ALS2 maize mutants.

[0100] The only difference between the ALS1 mutant material and the wild-type material KN5585 is that the 493rd base of the ZmALS1 gene (SEQ ID No.1) in the genome of the wild-type material KN5585 is mutated from C to G, and the 493rd base of the ZmALS2 gene (SEQ ID No.2) in the genome of the wild-type material KN5585 is mutated from C to G. The rest of the sequences remain unchanged.

[0101] mutant protein ZmALS1 P165A The amino acid sequence is shown in SEQ ID No. 3, and compared with the amino acid before mutation, the 493rd amino acid is mutated from proline (P) to alanine (A).

[0102] mutant protein ZmALS2 P165A The amino acid sequence is shown in SEQ ID No. 4, and compared with the amino acid before mutation, the 493rd amino acid is mutated from proline (P) to alanine (A).

[0103] Example 2: Herbicide resistance testing of ALS1 and ALS2 mutant materials

[0104] Wild-type maize KN5585 (denoted as W in the figure) and the ALS1 / ALS2 maize mutant obtained in Example 1 (denoted as M in the figure) were sampled 20-25 days after self-pollination. The embryos were stripped, the ears were disinfected, and the immature embryos were isolated and incubated with herbicides. The entire process required operation in a sterile environment to strictly prevent contamination. The culture medium used was MS medium supplemented with different herbicides. The stripped maize immature embryos were placed on MS medium supplemented with different herbicides and cultured. During the culture, the surface of the culture medium was required to contact the medium to facilitate nutrient absorption. After 6 days, the results were observed and photographed. MS medium without herbicide addition served as the control (CK).

[0105] The results of plant growth under different concentration gradients of different herbicides are as follows Figure 4 As shown: Compared with the control group, methyl imazapic at a concentration of 0.1×10 -2 mg / L to 3.2×10-2 mg / L, the wild type (left) showed obvious growth inhibition, while the ALS1 / ALS2 maize mutant (right) may show higher resistance, especially at higher concentrations; compared with the control group, oxysulfone from 0.3×10 -3 mg / L to 45×10 -3 mg / L, the higher the concentration, the more obvious the effect on plant growth. The wild type growth was inhibited, but the ALS1 / ALS2 corn mutant showed obvious resistance. Compared with the control group, chlorsulfuron -2 When the concentration of ALS1 / ALS2 corn mutants increased to 30 mg / L, the ALS1 / ALS2 corn mutants may be expressed at low concentrations (such as 0.3×10 -2 mg / L) showed similar performance to the wild type, but showed significantly stronger resistance at high concentrations (such as 30 mg / L). Compared with the control group, flucarbazone sodium: from 0.8×10 -2 From mg / L to 1.3 mg / L, the growth state of plants gradually deteriorated, which was manifested by a decrease in plant height.

[0106] These results indicate that the ALS1 / ALS2 maize mutant exhibits greater resistance to the listed herbicides (imazapic, cypermethrin, chlorsulfuron, and flucarbazone sodium) than wild-type maize, especially at higher concentrations. This suggests that the ALS1 / ALS2 maize mutant may have acquired resistance to these herbicides through genetic mutation and could be used as a herbicide-tolerant maize.

[0107] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A method for improving corn's resistance to herbicides, comprising the following steps: mutating nucleotide 493 of both the ZmALS1 gene and the ZmALS2 gene in the corn genome from C to G, thereby improving corn's resistance to herbicides; The nucleotide sequence of the ZmALS1 gene includes SEQ ID No. 1; The nucleotide sequence of the ZmALS2 gene includes SEQ ID No.

2.

2. The method according to claim 1, wherein: The mutation is achieved through a CBE single-base editor, and the target of the CBE single-base editor is positions 486-509 of SEQ ID No.1 or positions 486-509 of SEQ ID No.

2.

3. The method according to claim 2, wherein: The CBE single-base editor includes an ALS-CBE single-base editing vector, which expresses nCas9 (D10A), APOBEC1 deaminase, UGI protein and sgRNA targeting the target.

4. The method according to claim 2 or 3, characterized in that: The sgRNA is the RNA encoded by positions 10086-10182 of SEQ ID No.

5.

5. The method according to claim 3 or 4, characterized in that: The nucleotide sequence of the ALS-CBE single-base editing vector is obtained by sequentially connecting SEQ ID No. 5 and SEQ ID No. 6 end to end.

6. Biological material, which is a substance that causes the 493rd nucleotide of the ZmALS1 gene and the ZmALS2 gene in the maize genome to mutate from C to G; The substance is specifically any one of the following: (A1) the sgRNA according to claim 4; (A2) The CBE single-base editor described in any one of claims 2-5; (A3) The ALS-CBE single-base editing vector described in any one of claims 3-5; (A4) A recombinant bacterium containing the ALS-CBE single-base editing vector described in any one of claims 3-5.

7. Use of the biomaterial according to claim 6 in any of the following: (B1) Improve corn's resistance to herbicides; (B2) making corn resistant to herbicides; (B3) Develop herbicide-resistant corn varieties; (B4) Cultivate corn varieties with high herbicide resistance.

8. Biological material, any of the following: (C1) a protein with an amino acid sequence as shown in SEQ ID No. 3 or 4; (C2) a nucleic acid molecule encoding the protein described in (C1); (C3) An expression cassette, recombinant vector or recombinant bacterium containing the nucleic acid molecule described in (C2).

9. The biomaterial according to claim 8, characterized in that: The nucleic acid molecule is obtained by mutating the 493rd nucleotide of the DNA molecule shown in SEQ ID No. 1 from C to G, or by mutating the 493rd nucleotide of the DNA molecule shown in SEQ ID No. 2 from C to G.

10. Use of the biomaterial according to claim 8 or 9 in any of the following: (B1) Improve corn's resistance to herbicides; (B2) making corn resistant to herbicides; (B3) Develop herbicide-resistant corn varieties; (B4) Cultivate high herbicide-resistant corn varieties; Or, use of a substance for detecting whether the 493rd nucleotide of the ZmALS1 gene and the ZmALS2 gene in the maize genome to be tested has mutated from C to G in any of the following: Or use of a substance for detecting whether a maize genome to be tested contains ZmALS1 gene mutant nucleic acid and ZmALS2 gene mutant nucleic acid in any of the following: The ZmALS1 gene mutant nucleic acid is obtained by mutating the 493rd nucleotide of the DNA molecule shown in SEQ ID No. 1 from C to G; The ZmALS2 gene mutant nucleic acid is obtained by mutating the 493rd nucleotide of the DNA molecule shown in SEQ ID No. 2 from C to G; (D1) detecting or assisting in detecting the herbicide resistance of the tested corn; (D2) detecting or assisting in detecting whether the tested corn has herbicide resistance; (D3) preparing a product for detecting or assisting in detecting the herbicide resistance level of the tested corn; (D4) preparing a product for detecting or assisting in detecting whether the corn to be tested has herbicide resistance; (D5) Cultivate highly herbicide-resistant corn; (D6) Prepare and cultivate high herbicide-resistant corn products.

Images