KASP molecular marker closely linked with wheat drought resistance related gene TaRPL36-8, primer and application

Abstract

The invention relates to the technical field of molecular marker development and molecular marker assisted breeding, and particularly discloses a KASP molecular marker closely linked with a wheat drought resistance related gene TaRPL36-8, a primer and application, the nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO.1, and T / C polymorphism exists at the 201bp position of the sequence. By detecting the KASP molecular marker, the drought-resistant variety of wheat is identified, and technical support is provided for wheat breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker development and molecular marker-assisted breeding, and in particular to a KASP molecular marker tightly linked to a wheat drought resistance-related gene TaRPL36-8, primers and applications thereof. Background Art

[0002] Wheat (Triticum aestivum L.) is the staple food for approximately 40% of the world's population. Cultivated primarily in arid and semi-arid regions worldwide, it is one of the crops most vulnerable to adverse environmental stresses. Drought stress has become one of the major abiotic stress factors limiting efficient wheat production. Therefore, understanding the molecular mechanisms of wheat drought stress response and cultivating high-yielding, stable, and drought-tolerant varieties are crucial for addressing climate change, ensuring population growth, and ensuring food security.

[0003] Drought resistance in wheat is a typical quantitative trait controlled by multiple genes. Breeders use quantitative trait loci (QTL) mapping to genetically dissect loci that control wheat yield and agronomic and physiological traits under drought stress. To date, numerous QTLs associated with drought tolerance have been mapped. However, these findings are often influenced by factors such as experimental environment, mapping population material, molecular marker type, and statistical methods. Meta quantitative traits and loci (MQTL) analysis is an effective method for integrating QTL information from different genetic backgrounds and narrowing the QTL interval to obtain consistent MQTLs.

[0004] Marker-assisted selection (MAS) breeding is an effective method for accelerating wheat breeding, enabling precise and efficient improvement of individual traits. With the continuous development of high-throughput sequencing technology, single nucleotide polymorphism (SNP) data has been widely used in the development and application of molecular markers due to its high density, high throughput, and ease of automated analysis.

[0005] Therefore, it is necessary to develop new molecular markers related to wheat drought resistance to provide technical support for wheat breeding. Summary of the Invention

[0006] To develop a new molecular marker related to wheat drought resistance, this paper provides a molecular marker, primers, and applications for the wheat drought resistance gene TaRPL36-8. By detecting the KASP molecular marker, this paper identifies drought-resistant wheat varieties, providing technical support for wheat breeding.

[0007] The present invention provides a KASP molecular marker tightly linked to the wheat drought resistance-related gene TaRPL36-8. The marker is based on the MQTL related to wheat drought resistance on chromosome 5B, and a SNP site is detected at 44658904bp. The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.1, and a T / C polymorphism exists at the 201bp of the sequence.

[0008] The present invention identifies drought-resistant wheat varieties by detecting KASP molecular markers, thereby providing technical support for wheat breeding.

[0009] The present invention also provides primers for amplifying the KASP molecular marker tightly linked to the wheat drought resistance-related gene TaRPL36-8, comprising a specific forward primer KASP-TaRPL36-8-F1 shown in SEQ ID NO.2, a specific forward primer KASP-TaRPL36-8-F2 shown in SEQ ID NO.3, and a common reverse primer KASP-TaRPL36-8-R shown in SEQ ID NO.4.

[0010] The present invention also provides a method for identifying drought resistance of wheat, comprising the following steps:

[0011] Using the primers to perform PCR amplification on the extracted wheat DNA to obtain a PCR product;

[0012] The samples were genotyped according to the relative fluorescence values, and the drought resistance of wheat was determined based on the typing results;

[0013] The judgment criteria are: if the PCR amplification product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule shown in SEQ ID NO.5, the genotype of the wheat SNP marker to be tested is TT, and the wheat variety is determined to be drought-resistant wheat; if the PCR amplification product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule shown in SEQ ID NO.6, the genotype of the wheat SNP marker to be tested is CC, and the wheat variety is determined to be drought-sensitive wheat.

[0014] The present invention also provides an application of the KASP molecular marker or the primer in wheat assisted breeding.

[0015] Furthermore, by detecting wheat genotypes, drought-resistant wheat varieties are screened as subsequent breeding materials;

[0016] If the genotype is TT, it is drought-resistant wheat; if the genotype is CC, it is drought-sensitive wheat.

[0017] The present invention also provides an application of the KASP molecular marker and the primer in identifying drought-resistant wheat varieties, wherein the application comprises the following steps:

[0018] Wheat DNA is extracted, and PCR amplification is performed using the primers to obtain a PCR amplification product; the genotype is determined by detecting the fluorescent signal of the PCR amplification product. If the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in SEQ ID NO.5 in the sequence listing, the genotype of the wheat SNP marker to be tested is TT, and the wheat variety is determined to be drought-resistant wheat; if the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in SEQ ID NO.6 in the sequence listing, the genotype of the wheat SNP marker to be tested is CC, and the wheat variety is determined to be drought-sensitive wheat.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention provides a KASP molecular marker tightly linked to the wheat drought resistance-associated gene TaRPL36-8. The marker, KASP-TaRPL36-8, was developed targeting a single nucleotide polymorphism (SNP) site in the promoter region of the ribosomal protein L36 gene TaRPL36-8. Developed based on KASP technology, this marker enables high-throughput detection of base 44,658,904 on chromosome 5B of the wheat genome. Genotyping and phenotypic association analysis using 277 wheat germplasm resources from different ecological regions in my country showed that the KASP-TaRPL36-8 marker can classify different wheat varieties into two genotypes: haplotype TaRPL36-8-HapⅠ and haplotype TaRPL36-8-HapⅡ. The genotype of haplotype TaRPL36-8-HapⅠ is TT, while the genotype of haplotype TaRPL36-8-HapⅡ is CC. Among them, there are 186 wheat varieties with haplotype TaRPL36-8-HapⅠ and 91 wheat varieties with haplotype TaRPL36-8-HapⅡ. Combining the phenotypic data of drought resistance survival rate of 277 materials at the seedling stage, an association analysis was conducted on the materials of the two genotypes. It was found that the drought survival rate of wheat materials carrying the TT genotype was significantly higher than that of materials carrying the CC genotype (P<0.01). The above results indicate that TaRPL36-8 is closely related to wheat drought stress, and the genotype TT is an excellent drought-resistant haplotype. In the process of wheat drought-resistant breeding, the KASP-TaRPL36-8 molecular marker provided by this patent can efficiently detect and track the TaRPL36-8 gene in wheat varieties / lines, effectively improving the accuracy of wheat drought-resistant genotype identification, which is of great significance to wheat drought-resistant molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 qRT-PCR analysis of wheat TaRPL36-8 gene under PEG-6000 treatment.

[0023] Figure 2 for the genetic structure, sequence polymorphism, KASP marker development, and drought tolerance association analysis of TaRPL36-8;

[0024] In the figure, a shows the distribution of SNPs sites in the promoter region of the TaRPL36-8 gene, TaRPL36-8-HapⅠ represents haplotype I, and TaRPL36-8-HapⅡ represents haplotype II;

[0025] b is a scatterplot cluster diagram of KASP genotyping of wheat germplasm resources TaRPL36-8 in different wheat regions of my country;

[0026] c Difference analysis of drought survival rate traits among different genotypes of TaRPL36-8 wheat germplasm resources; **P<0.01.

[0027] Figure 3 is the spatiotemporal distribution of TaRPL36-8 haplotype;

[0028] Wherein, a is the frequency distribution of TaRPL36-8 allele variation among varieties from different regions;

[0029] b Frequency distribution of TaRPL36-8 allele variation in varieties from different eras. DETAILED DESCRIPTION

[0030] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0031] Example 1: qRT-PCR analysis of wheat drought resistance-related gene TaRPL36-8.

[0032] Wheat seeds of uniform grain size were selected, disinfected with 1.5% sodium hypochlorite, and planted in culture dishes. After germination, the wheat was transferred to a hydroponic box and cultured in an artificial climate chamber with Hoagland nutrient solution. The culture conditions were set to 16 hours of light / 8 hours of darkness, a temperature of 22±2°C, and a relative humidity of 65%. When the wheat seedlings reached the three-leaf stage, they were treated with 20% PEG-6000. The first true leaf of the wheat was cut at 0h, 1h, 3h, 6h, 12h, and 24h of treatment, and it was quickly frozen in liquid nitrogen. After sampling, it was stored in a -80°C refrigerator. Total RNA from the collected wheat samples was extracted using the Plant Tissue RNA Rapid Extraction Kit (DP452, Tiangen Biochemical Technology Co., Ltd.), and the RNA concentration was measured using an ultramicrophotometer. cDNA was obtained by reverse transcription using the FastKing cDNA First-Strand Synthesis Kit (KR116, Tiangen Biochemical Technology Co., Ltd.). FastReal rapid fluorescence quantitative PCR premix reagent (FP217, Tiangen Biochemical Technology Co., Ltd.) was used to detect the relative expression changes of TaRPL36-8 under PEG-6000 treatment, with wheat TaActin as the internal reference gene.

[0033] The PCR reaction volume was 20 μL, consisting of 10 μL FastReal qPCR PreMix (SYBR Green), 0.6 μL each of the forward and reverse primers, 2 μL cDNA, and 6.8 μL ddH₂O. PCR conditions were 95°C for 2 min, followed by 40 cycles of 95°C for 5 s, 58°C for 10 s, and 72°C for 15 s (fluorescence collection).

[0034] The primers used for qRT-PCR are shown in Table 1. -ΔΔCT The relative expression level of TaRPL36-8 was evaluated by the calculation method, and all samples were divided into 3 biological replicates.

[0035] Table 1 qRT-PCR primer information

[0036]

[0037] The results are as follows Figure 1 As shown in the figure, qRT-PCR analysis found that the expression level was significantly downregulated after PEG-6000 treatment, indicating that the TaRPL36-8 gene may play an important role in drought stress.

[0038] Example 2: Development of molecular markers for the wheat drought resistance-related gene TaRPL36-8.

[0039] Based on the analysis of 1769 hexaploid wheat resequencing data from the Wheat Genome Variation Union Database (http: / / wheat.cau.edu.cn / WheatUnion / ), three SNP variation sites were found in the promoter region of the TaRPL36-8 gene, located at -36 (T / C), -449 (C / T), and -820 (T / C), respectively. Figure 2 A KASP marker was developed for the SNP at -820 bp in the promoter region. The KASP marker was validated using 277 wheat accessions, resulting in 186 wheat accessions with the haplotype TaRPL36-8-HapⅠ and 91 wheat accessions with the haplotype TaRPL36-8-HapⅡ. Figure 2 As shown in b.

[0040] The KASP molecular marker for the wheat drought resistance-related gene TaRPL36-8 in this example is located in the promoter region at -820p from the start codon and is named KASP-TaRPL36-8. The nucleotide sequence of the KASP marker is shown in SEQ ID NO.1.

[0041] SEQ ID NO.1:

[0042] CGCACATAACAAGAAAAGGAAGGGTGACGCTGGATCCCCCTGCCCTAGTCCTCTCGAGGGGTGGAAGACCGGGAGGAGCTCCCCATTCACCTTCACCGTGAATCTGACCGAAGTCACACACGTCATGATCAATTCAATAAAATTGTGACTGAACCCAAGTCGCTGCATCACTGCTTCCAAGTAATGCCATTCCACACGATY ATACGCTTTCATCATATCGAGCTTCACCGCACACGTGTAGTTTTTGCCCTTTCTTTTTTCTTCATTGTGTGCACACTCTCAAAAGCCACTAGAACGTTATCAGTAATATTACGTCCGGGTACAAAGGCACTTTGTTCTTCTCCCACTATCACATTCATCCACACCTTCAGCCTGTTTGTCACCATCTTGAATGCGATCT. Among them, the degenerate base Y at the 201st bp of the sequence is T or C.

[0043] The KASP marker primers include primer KASP-TaRPL36-8-F1, primer KASP-TaRPL36-8-F2 and common primer KASP-TTaRPL36-8-R, which were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The information of the KASP marker primers is shown in Table 2.

[0044] Table 2 KASP marker development primer information

[0045]

[0046] Example 3: Determination of genotype using molecular markers of wheat drought resistance-related gene TaRPL36-8.

[0047] 1. Wheat genomic DNA extraction

[0048] Genomic DNA from leaves of wheat seedlings at the two-leaf, one-heart stage was extracted using the CTAB method. The DNA concentration and quality were detected using NanoDrop2000 and 1% agarose gel electrophoresis. An A260 / A280 ratio of around 1.8 indicated that the sample quality was qualified.

[0049] 2. KASP marker amplification and detection

[0050] A two-step PCR reaction system is used: DNA denaturation at a higher temperature followed by annealing and extension at the same lower temperature. PCR amplification can be performed on any suitable PCR amplification instrument. The 4μL PCR reaction system contains 2μL of KASP Master Mix (2×), 1μL of SNP Primer Mix (4×), and 1μL of DNA.

[0051] The PCR amplification system was as follows: (1) 94°C, 15 min; (2) 94°C, 20 s; 61°C to 55°C, decreasing by 0.6°C per cycle; 10 cycles in total; (4) 94°C, 20 s; 55°C, 45 s, 35 cycles in total. After the PCR amplification cycles were completed, the fluorescence value was read using the OMEGA SNP typing instrument. In this method, SNP site detection uses the fluorophores FAM (excitation light 485 nm, emission light 520 nm) and VIC (excitation light 535 nm, emission light 556 nm) to distinguish between two isogenic loci. The passive reference dye ROX (excitation light 575 nm, emission light 610 nm) was used to correct the signal difference between wells due to reaction volume error.

[0052] 3. Data Analysis

[0053] Data were analyzed using the genotype caller software KlusterCaller, with VIC and FAM data plotted on the x-axis and y-axis, respectively. VIC and FAM values for each reaction well were corrected using the values for the passive reference dye (ROX)-specific wells, and the fluorescence values were normalized to obtain relative fluorescence values for VIC and FAM for each PCR reaction well. Samples were clustered based on relative fluorescence values, and genotypes were further determined based on sample clusters and fluorescence patterns.

[0054] 4. Judgment criteria

[0055] The genotype is determined by detecting the fluorescent signal of the PCR amplification product. If the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in the sequence listing SEQ ID NO.5, the genotype of the wheat SNP marker to be tested is TT; if the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in the sequence listing SEQ ID NO.6, the genotype of the wheat SNP marker to be tested is CC.

[0056] SEQ ID NO.5:

[0057] AATCTGACCGAAGTCACACACGTCATGATCAATTCAATAAAATTGTGACTGAACCCAAGTCGCTGCATCACTGCTTCCAAGTAATGCCATTCCACACGAT T ATACGCTTTCATCATATCGAGCTTCACCGCACACGTGTAGTTTTTGCCCTTCTTTTTCTTCTCATTGTGTGCACACTCTCAAAAGCCACTAGAACGTTA.

[0058] SEQ ID NO.6:

[0059] AATCTGACCGAAGTCACACACGTCATGATCAATTCAATAAAATTGTGACTGAACCCAAGTCGCTGCATCACTGCTTCCAAGTAATGCCATTCCACACGAT C ATACGCTTTCATCATATCGAGCTTCACCGCACACGTGTAGTTTTTGCCCTTCTTTTTCTTCTCATTGTGTGCACACTCTCAAAAGCCACTAGAACGTTA.

[0060] The underlines in SEQ ID NO.5 and SEQ ID NO.6 represent SNP sites.

[0061] Example 4: Application of the wheat drought resistance-related molecular marker KASP-TaRPL36-8.

[0062] 1. Identification of drought resistance of wheat seedlings using molecular marker KASP-TaRPL36-8

[0063] A drought survival test was conducted using 277 wheat germplasm accessions. Planting methods and seedling drought resistance assessment were conducted in accordance with the Technical Specification for Identification and Evaluation of Wheat Drought Resistance (GB / T 21127-2007). Fifty seeds of uniform size and full grains were selected from each variety / line and sown in plastic boxes (60 cm × 40 cm × 15 cm) filled with 10 cm of soil. The soil water holding capacity was maintained at 85% ± 5%, and the incubation temperature was maintained at 20°C ± 5°C throughout the seedling stage. Three replicates were used. Water was withheld from the seedlings at the three-leaf stage, initiating the first drought stress treatment. When the soil water content dropped to 20%–15% of field capacity, the first soil rewatering treatment was performed. The soil water holding capacity after rewatering was 80% ± 5%. Five days after rewatering, the number of surviving seedlings was counted, with survival indicated by leaves turning bright green. After the first rewatering, water was stopped and a second drought stress test was conducted. The stress method and plant survival evaluation criteria were the same as for the first stress test. The drought survival rates of seedlings of different varieties / lines were calculated based on the national standard (GB / T 21127-2007) for seedling drought resistance assessment.

[0064] Table 3 Information of 277 wheat materials

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073] 2. Using the KASP-TaRPL36-8 molecular marker in Example 2 and the method provided in Example 3, the TaRPL36-8 genotypes of wheat germplasm resources in different ecological zones were analyzed. The typing results are as follows: Figure 2 The single factor variance analysis method of SPSS22.0 software was used to analyze whether there were significant differences in the drought resistance survival rate of wheat with different genotypes. The specific data are shown in Table 4 and Figure 2 c.

[0074] Table 4 Association analysis between drought survival rates of two haplotypes of TaRPL36-8 gene

[0075]

[0076] Note: ** indicates significant difference at the 0.01 level.

[0077] To examine whether the two haplotypes of the TaRPL36-8 gene are associated with drought stress, an association analysis was conducted on the drought survival rates of 277 wheat accessions. The results showed that under drought stress, the drought survival rate of TaRPL36-8-HapI was significantly higher than that of TaRPL36-8-HapII (P < 0.01). These results suggest that TaRPL36-8 may be closely associated with drought stress in wheat, and that TaRPL36-8-HapI is an excellent haplotype for drought tolerance.

[0078] Example 5: Application of wheat haplotype TaRPL36-8-HapI in wheat breeding.

[0079] In the process of crop breeding, breeders will give priority to selecting superior alleles or haplotypes. In order to investigate whether the superior haplotype of TaRPL36-8 gene is positively selected in the wheat breeding process, the geographical distribution of two haplotypes of TaRPL36-8 gene was evaluated using 216 wheat varieties from 8 wheat-growing regions in China. The results are as follows: Figure 3 a and Table 5. Varieties containing both haplotypes in each province were counted if the total number of varieties containing both haplotypes was greater than or equal to 5; provinces with less than 5 were excluded from the count. The ratio of the two haplotypes in different provinces was calculated. The TT genotype, compared to the CC genotype, predominates in the distribution of major wheat-growing regions in my country (e.g., Shandong, Beijing, Jiangsu, Henan, and Hebei). Information was obtained from the "First Industry Approved Variety Information Query" and Zhuang Qiaosheng's "Chinese Wheat Variety Improvement and Pedigree Analysis."

[0080] Table 5 Distribution frequency of TaRPL36-8 haplotype varieties in my country

[0081]

[0082] The results showed that the distribution frequencies of haplotype TaRPL36-8-HapI in eight wheat-growing areas were 88.24% (Shandong), 81.82% (Beijing), 80.00% (Jiangsu), 68.00% (Hebei), 66.00% (Shanxi), 64.00% (Henan), 61.11% (Shaanxi) and 61.00% (Gansu), respectively. Haplotype TaRPL36-8-HapI accounts for a larger proportion in my country than haplotype TaRPL36-8-HapII, and this type of drought-resistant germplasm has been widely used in breeding.

[0083] The 181 wheat varieties were divided into five groups according to their breeding years, with each group consisting of five time points: Pre-1970s, 1970s-1980s, 1980s-1990s, 1990s-2000s, and Post-2000s, to observe the changing trend of TaRPL36-8 haplotypes over the breeding years. The results are as follows: Figure 3 b and Table 6.

[0084] Table 6 Distribution frequency of the superior haplotype TaRPL36-8-HapI in varieties from different eras

[0085]

[0086] Results showed that TaRPL36-8-HapI was absent from varieties approved before 1970. However, its frequency increased dramatically from 0 to 56.52% between the 1970s and 1980s, reaching a peak of 81.58% between the 1980s and 1990s. It then decreased slightly to 72.3% between the 1990s and 2000s, but remained at 73.53% after 2000. The frequency of the haplotype TaRPL36-8-HapII exhibited an opposite trend. These results suggest that the superior haplotype TaRPL36-8-HapI has been positively selected during wheat breeding.

[0087] Example 6: TaRPL36-8 haplotype and its association with drought survival rate.

[0088] 1. Test materials and phenotypic identification

[0089] A drought survival test was conducted using a natural population of 277 wheat varieties / lines from the research team. Drought resistance at the seedling stage was assessed using a potted culture method (seedling repeated drought survival method), following the requirements of the Technical Specification for the Identification and Evaluation of Wheat Drought Resistance (GB / T 21127-2007). Fifty uniformly sized, plump seeds of each variety were sown in a plastic box (60 cm × 40 cm × 15 cm) filled with 10 cm of soil, with three replicates. The first drought stress treatment was applied when the seedlings reached the three-leaf stage. When the soil moisture content dropped to 20% of the field capacity, the soil was rehydrated for the first time, with the field capacity after rehydration being 80% ± 5%. Five days after rehydration, the number of surviving seedlings was assessed, with survival indicated by leaves turning bright green. Then, the second drought treatment was carried out, and the relative soil moisture content dropped to 20% again. All the wheat seedlings wilted permanently. Rehydration brought the relative soil moisture content back to 80%±5%. The survival rate of wheat seedlings was investigated 5 days after rehydration.

[0090] 2. Genotype identification and haplotype analysis of wheat TaRPL36-8

[0091] The TaRPL36-8 gene variant sites in different wheat materials were obtained using the resequencing data of 1769 hexaploid wheat samples in the WheatUnion database (http: / / wheat.cau.edu.cn / WheatUnion / ). The genotypes were downloaded using the variant information query module, with the upstream and downstream extension lengths set to 2000 bp. The results are shown in Figure 2. Figure 2 a. Three SNP sites were found in the promoter region of TaRPL36-8 gene, and there were two haplotypes, namely TaRPL36-8-HapI and TaRPL36-8-HapII.

[0092] 3. Association analysis between the development of molecular markers for the wheat TaRPL36-8 gene and drought resistance survival rate

[0093] Based on the development of molecular markers based on the SNP (T / C) site at -820b in the promoter region of the TaRPL36-8 gene, 277 wheat materials were tested to distinguish the two haplotypes TaRPL36-8-HapI and TaRPL36-8-HapII, and to separate the varieties of the two haplotypes ( Figure 2 b).

[0094] Using the correlation analysis of drought survival rates of 277 natural wheat populations, the research team found that Figure 2c. Under drought stress, wheat accessions carrying the TaRPL36-8-HapI haplotype (TT genotype) had significantly higher drought survival rates than those carrying the TaRPL36-8-HapII haplotype (CC genotype) (P < 0.01). These results suggest that TaRPL36-8 may be closely associated with drought stress in wheat and that TaRPL36-8-HapI represents an excellent allele variant for drought tolerance.

[0095] 4. Spatial and temporal distribution characteristics of wheat TaRPL36-8 haplotype

[0096] To investigate the geographic distribution of different haplotypes of TaRPL36-8, 216 wheat accessions were used to evaluate the distribution of TaRPL36-8-HapI and TaRPL36-8-HapII in eight wheat-growing regions of China. The frequencies of haplotype TaRPL36-8-HapI in the eight provinces were 88.24% (Shandong), 81.82% (Beijing), 80.00% (Jiangsu), 68.00% (Hebei), 66.00% (Shanxi), 64.00% (Henan), 61.11% (Shaanxi), and 61.00% (Gansu). Figure 3 a), the above results indicate that the drought-resistant haplotype TaRPL36-8-HapI has been positively selected by breeders in the history of wheat breeding in my country.

[0097] To observe the changing trends of different haplotypes of TaRPL36-8 over the breeding years, the present invention divided 181 wheat varieties into five groups based on the breeding years, with each group consisting of 10 years. From before 1970 to after 2000, the proportion of the drought-resistant haplotype TaRPL36-8-HapI gradually increased from 0 to 73.53%, while the proportion of the haplotype TaRPL36-8-HapII decreased from 100% to 26.47% ( Figure 3 b). The above results indicate that breeders have selected the superior haplotype TaRPL36-8-HapI, which is significantly associated with wheat drought resistance, during the molecular breeding of wheat drought resistance, providing a theoretical basis for molecular marker-assisted selection breeding.

[0098] Therefore, the molecular marker KASP-TaRPL36-8 developed for the TaRPL36-8 gene in the present invention can be used to screen the excellent haplotype TaRPL36-8-HapI of the TaRPL36-8 gene in different wheat germplasms. This molecular marker and the screened excellent haplotype can be applied to future molecular breeding work.

[0099] Although preferred embodiments of the present invention have been described, additional changes and modifications to these embodiments may occur to those skilled in the art once the basic inventive concepts become known.

[0100] Obviously, those skilled in the art may make various modifications and variations to the present invention without departing from the spirit and scope of the present invention. Thus, if such modifications and variations fall within the scope of the claims and their equivalents, the present invention is intended to include such modifications and variations.

Claims

1. A KASP molecular marker tightly linked to the wheat drought resistance-related gene TaRPL36-8, characterized in that: The KASP molecular marker nucleotide sequence is shown in SEQ ID NO. 1, and the 201 bp position of the sequence is a T / C polymorphism.

2. A primer for amplifying the KASP molecular marker tightly linked to the wheat drought resistance-related gene TaRPL36-8 according to claim 1, characterized in that: It includes a specific forward primer KASP-TaRPL36-8-F1 shown in SEQ ID NO.2, a specific forward primer KASP-TaRPL36-8-F2 shown in SEQ ID NO.3, and a common reverse primer KASP-TaRPL36-8-R shown in SEQ ID NO.

4.

3. A method for identifying drought resistance of wheat, characterized in that: The steps include: Performing PCR amplification on the wheat DNA to be tested using the primers in claim 2 to obtain a PCR product; The samples were genotyped according to the relative fluorescence values, and the drought resistance of wheat was determined based on the typing results; The judgment criteria are: if the PCR amplification product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule shown in SEQ ID NO.5, the genotype of the wheat SNP marker to be tested is TT, and the wheat variety is determined to be drought-resistant wheat; if the PCR amplification product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule shown in SEQ ID NO.6, the genotype of the wheat SNP marker to be tested is CC, and the wheat variety is determined to be drought-sensitive wheat.

4. Use of the KASP molecular marker according to claim 1 or the primer according to claim 2 in wheat assisted breeding.

5. The use according to claim 4, characterized in that By testing wheat genotypes, drought-resistant wheat varieties can be selected as subsequent breeding materials; If the genotype is TT, it is drought-resistant wheat; if the genotype is CC, it is drought-sensitive wheat.

6. Use of the KASP molecular marker according to claim 1 or the primer according to claim 2 in identifying drought-resistant wheat varieties, characterized in that: The application comprises the following steps: Wheat DNA is extracted, and PCR amplification is performed using the primers to obtain a PCR amplification product; the genotype is determined by detecting the fluorescent signal of the PCR amplification product. If the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in SEQ ID NO.5 in the sequence listing, the genotype of the wheat SNP marker to be tested is TT, and the wheat variety is determined to be drought-resistant wheat; if the PCR amplification product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule as shown in SEQ ID NO.6 in the sequence listing, the genotype of the wheat SNP marker to be tested is CC, and the wheat variety is determined to be drought-sensitive wheat.

Images