Quadruple real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primer probe combination for detecting African swine fever virus and application

Abstract

The invention discloses a quadruple real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primer probe combination for detecting African swine fever virus and application. The primer probe combination comprises a first primer probe combination, a second primer probe combination, a third primer probe combination and a fourth first primer probe combination, the primer probe is capable of specifically targeting ASFV p72 gene, CD2v-I gene, CD2v-II gene and I177L gene, and the detection kit developed based on the primer probe combination can rapidly diagnose African swine fever virus and identify CD2v gene I and II type and CD2v and I177L gene deleted strains. The kit has extremely high sensitivity, the lowest detection limit can reach 8 copies / mu L, it is ensured that trace virus DNA can be detected, and missing detection is avoided.

Description

Technical Field

[0001] The present invention relates to the technical field of in vitro nucleic acid detection, and specifically to a quadruple real-time fluorescence quantitative PCR primer probe combination and application for detecting African swine fever virus. Background Art

[0002] African swine fever (ASF) is a highly contagious disease caused by the African swine fever virus (ASFV), primarily affecting domestic pigs and wild boars. ASFV, a member of the Assurviridae family, is a large, double-stranded DNA virus with a complex genome and a unique envelope structure. Its pathogenicity is extremely high, resulting in a near-100% mortality rate, causing significant economic losses to the global swine industry. Since its introduction into China in 2018, virulent genotype II strains (such as Pig / HLJ / 18) have been the predominant strains. After 2021, genotype I strains have become prevalent, with a variety of variants occurring, including gene deletion strains and naturally occurring variants. The diversity and variability of ASFV strains have reduced the effectiveness of current prevention and control measures. Therefore, enhanced monitoring and research of different strains is necessary to timely understand the mutation trends of the virus and develop effective prevention and control strategies.

[0003] Currently, pathogen detection for ASFV remains the primary measure for effective surveillance and timely elimination of infection sources. The p72 gene, which exhibits high sequence conservation across different ASFV genotypes, offers unique advantages in virus typing and phylogenetic analysis, making it a key target gene for rapid ASFV diagnosis and epidemiological investigations. With the emergence of ASFV variants, genes such as CD2v, MGF, and I177L have also gained significant attention. For example, the US Department of Agriculture is researching an ASFV-Δ6G gene-deleted vaccine (containing MGF and CD2v), and Vietnam has approved the ASFV-G-ΔI177L vaccine, which has entered the application phase. Therefore, while strictly preventing the introduction of vaccine viruses, we must also develop and implement response strategies and make differential diagnoses. Summary of the Invention

[0004] Based on the use of gene-deleted vaccines and the increasing complexity of prevalent ASFV strains, the present invention addresses the shortcomings of existing detection methods, which use a single target or can only distinguish one or two gene-deleted strains, and cannot effectively distinguish wild strains from more vaccine strains. A quadruple real-time fluorescent quantitative PCR primer-probe combination and application for detecting African swine fever virus are provided. This primer-probe combination and kit are capable of detecting and distinguishing African swine fever virus, with the p72 gene as a full-coverage target gene for ASFV detection, CD2v as a target gene for distinguishing genes CD2v-I, CD2v-II, and gene-deleted strains, and I177L as a target gene for gene-deleted strains. The quadruple African swine fever virus fluorescent quantitative PCR detection method established by the present invention provides an important tool for ASFV detection and early warning and forecasting of epidemics.

[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows: The present invention provides a quadruple real-time fluorescent quantitative PCR primer-probe combination for detecting African swine fever virus, wherein the primer-probe combination comprises a first primer-probe combination, a second primer-probe combination, a third primer-probe combination and a fourth first primer-probe combination; Wherein, the first primer probe combination is as follows: The ASFVp72 gene-specific forward primer sequence p72-F is shown in SEQ ID NO. 1; The ASFVp72 gene-specific reverse primer sequence p72-R is shown in SEQ ID NO. 2; The sequence of the ASFVp72 gene probe, p72-P, is shown in SEQ ID NO. 3; The second primer-probe combination is as follows: The ASFV type I CD2v gene-specific forward primer sequence, CD2V-F, is shown in SEQ ID NO. 4; The ASFV type I CD2v gene-specific reverse primer sequence CD2V-R is shown in SEQ ID NO. 5; The sequence of the ASFV type I CD2v gene probe, CD2V-Ⅰ-P, is shown in SEQ ID NO. 6; The third primer-probe combination is as follows: The ASFV type II CD2v gene-specific forward primer sequence CD2V-F is shown in SEQ ID NO. 4; The ASFV type II CD2v gene-specific reverse primer sequence CD2V-R is shown in SEQ ID NO. 5; The sequence of the ASFV type II CD2v gene probe, CD2V-II-P, is shown in SEQ ID NO. 7; The fourth primer-probe combination is as follows: The ASFV I177L gene-specific forward primer sequence I177L-F is shown in SEQ ID NO. 8; The ASFV I177L gene-specific reverse primer sequence I177L-R is shown in SEQ ID NO.9; The sequence of the ASFV I177L gene probe I177L-P is shown in SEQ ID NO.10.

[0006] Furthermore, the fluorescent groups at the 5′ and 3′ ends of the ASFVp72 gene probe p72-P are FAM and BHQ1, respectively; The fluorescent groups at the 5′ and 3′ ends of the ASFV type I CD2v gene probe CD2V-Ⅰ-P are ROX and BHQ2, respectively; The fluorescent groups at the 5′ and 3′ ends of the ASFV type II CD2v gene probe CD2V-II-P are HEX and BHQ1, respectively; The fluorescent groups at the 5′ and 3′ ends of the ASFV I177L gene probe I177L-P are Cy5 and BHQ3, respectively.

[0007] Furthermore, in the first primer-probe combination, the target gene sequence of the primer is shown as SEQ ID NO.11; In the second primer-probe combination, the target gene sequence of the primer is shown in SEQ ID NO.12; In the third primer-probe combination, the target gene sequence of the primer is shown in SEQ ID NO.13; In the fourth primer-probe combination, the target gene sequence of the primer is shown as SEQ ID NO.14.

[0008] The present invention also provides an application of the above-mentioned primer-probe combination in the preparation of a quadruple fluorescent quantitative PCR kit for African swine fever virus, genotyping, and gene deletion strains and detection.

[0009] The present invention also provides a quadruple fluorescent quantitative PCR kit for African swine fever virus, genotyping, and gene deletion strain and detection, wherein the kit includes the above-mentioned primer probe combination.

[0010] Furthermore, the kit also includes DNA-PCR reaction solution (UNG) and ddH2O; wherein, in the primer-probe combination, the concentration of each primer and probe is 25 μmol / L. The details are as follows: The concentrations of the African swine fever virus p72 gene upstream primer, the African swine fever virus CD2v-Ⅰ gene upstream primer, the African swine fever virus CD2v-Ⅱ gene upstream primer, and the African swine fever virus I177L gene upstream primer are all 25 μmol / L, the concentrations of the African swine fever virus p72 gene downstream primer, the African swine fever virus CD2v-Ⅰ gene downstream primer, the African swine fever virus CD2v-Ⅱ gene downstream primer, and the African swine fever virus I177L downstream primer are all 25 μmol / L, and the African swine fever virus p72 gene probe, the African swine fever virus CD2v-Ⅰ gene probe, the African swine fever virus CD2v-Ⅱ gene probe, and the African swine fever virus I177L gene probe are all 25 μmol / L.

[0011] The present invention also provides a detection method for the above-mentioned quadruple fluorescent quantitative PCR kit, comprising the following steps: 1) Extract DNA from the sample to be tested; 2) Perform RT-qPCR using the above DNA as a template to obtain the Ct value; 3) Compare and interpret the Ct value based on the standard curve in the kit.

[0012] Furthermore, in step 2), each 25 μL of the PCR amplification system for the quadruple real-time fluorescence quantitative PCR is: 12.5 μL 2× DNA-PCR reaction solution (UNG), 1.2 μL primer-probe combination, 6.3 μL ddH2O, 5 μL total sample DNA; in the reaction system, the final concentration of all primers p72-F / R, CD2V-I-F / R, CD2V-II-F / R, and I177L-F / R was 0.1 μmol / L; The final concentration of all probes, p72-Probe, CD2v-Ⅰ-P, CD2V-Ⅱ-P and I177L-P, was 0.15 μmol / L.

[0013] From the above, it can be seen that the volume ratio of the primer and probe in the primer-probe combination is: forward primer: reverse primer: probe = 1:1:1.5.

[0014] Furthermore, in step 2), the reaction conditions are: 37°C, 2 min; 95°C, 3 min; 95°C, 10 s, 58°C, 20 s, 40 cycles, with simultaneous collection Fluorescence values of the four channels: FAM, HEX, ROX, and Cy5.

[0015] Furthermore, in step 3), the judgment criteria are as follows: If there is no Ct value in the FAM channel, the HEX channel, the ROX channel, or the CY5 channel, the result is considered negative. Alternatively, when the Ct value of the FAM channel is <40 and there is a clear amplification curve, and there are or are no amplification curves in other channels, the result is determined to be ASFV positive; Alternatively, when the Ct value of the FAM channel is <40 and there is a clear amplification curve, but no amplification curve is observed in other channels, the result is determined to be a CD2v and I177L double deletion virus; Alternatively, when the Ct value of the FAM channel is <40 and there is a clear amplification curve, and the Ct value of one channel in HEX or ROX is <40 and there is a clear amplification curve, the result is determined to be I177L deletion virus; Alternatively, when the Ct value of the FAM channel is <40 and there is a clear amplification curve, there is no amplification curve in the HEX and ROX channels, and the Ct value of the CY5 channel is <40 and there is a clear amplification curve, the result is determined to be CD2v deletion virus; Alternatively, when the Ct value of the FAM channel is <40 and there is an obvious amplification curve, the Ct value of the HEX channel is <40 and there is an obvious amplification curve, the ROX channel has no Ct value, and the CY5 channel has or does not have an amplification curve, the result is determined to be CD2v-Ⅱ virus; Alternatively, when the Ct value of the FAM channel is <40 and there is an obvious amplification curve, the Ct value of the ROX channel is <40 and there is an obvious amplification curve, the HEX channel has no Ct value, and the CY5 channel has or has no amplification curve, the result is determined to be CD2v-Ⅰ virus.

[0016] Beneficial effects of the present invention: 1. The primer-probe combination and kit provided by the present invention can simultaneously detect African swine fever virus, identify CD2v genotyping, and CD2v and I177L gene-deficient strains; the p72 gene is used as a full-coverage target gene for ASFV detection, CD2v is used as a target gene for distinguishing genes CD2v-I, CD2v-II, and gene-deficient strains, and I177L is used as a target gene for gene-deficient strains.

[0017] 2. By comparing approximately 1,500 complete ASFV genomes and gene sequences, the conserved regions of the p72, CD2v-Ⅰ, CD2v-Ⅱ, and I177L genes were determined, and all primer sequences were fully covered by setting degenerate bases.

[0018] 3. The use of different fluorescently labeled probes ensures specific detection of each gene locus and avoids cross-interference between different loci. The method of the present invention has extremely high sensitivity, with a minimum detection limit of up to 8 copies / μL, ensuring the detection of trace amounts of viral DNA and avoiding missed detection.

[0019] 4. The quadruple real-time fluorescence quantitative PCR detection method for detecting African swine fever virus provided by the present invention has no cross-reaction with classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), porcine circovirus (PCV2), porcine epidemic diarrhea virus (PEDV) and porcine transmissible gastroenteritis virus (TGEV). The results show that the primer probe combination and method of the present invention have good specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a schematic diagram of the standard curve for quadruple fluorescence quantitative PCR amplification. In the figure, A is a schematic diagram of the standard curve of pASFV-p72, B is a schematic diagram of the standard curve of pASFV-CD2v-Ⅰ, C is a schematic diagram of the standard curve of pASFV-CD2v-Ⅱ, D is a schematic diagram of the standard curve of pASFV-I177L; Figure 2 This is the specific detection result of quadruple fluorescence quantitative PCR. Among them, the amplification curves of the standard plasmids included four groups of p72, CD2v-Ⅰ, CD2v-Ⅱ and I177L, the amplification curves of ASFV nucleic acid included three groups of p72, CD2v-Ⅱ and I177L, and there were no amplification curves for CSFV, PRRSV, PRV, PCV2, PEDV, TGEV nucleic acids and the negative control H2O; Figure 3 The figure shows the sensitivity test results of the quadruple fluorescence quantitative PCR method for the four genes p72, CD2v-Ⅰ, CD2v-Ⅱ and I177L. In the figure, A is the detection result of pASFV-p72, B is the detection result of pASFV-CD2v-Ⅰ, C is the detection result of pASFV-CD2v-Ⅱ, D is the detection result of pASFV-I177L. From left to right, curves 1-8 are 8×10 6 , 8×10 5 , 8×10 4 , 8 × 10 3 , 8×10 2 , 8×10 1 , 8×10 0 , detection curve of 0.8 copies, 9 is NC. DETAILED DESCRIPTION

[0021] The present invention is further described in detail below with reference to specific embodiments so that those skilled in the art can understand.

[0022] Example 1 Design of a quadruple fluorescent quantitative PCR primer and probe combination for detecting African swine fever virus The ASFV genome sequence and full gene sequence were retrieved from the NCBI GeneBank database. The sequences of the p72 gene (510 sequences), CD2V-I gene (104 sequences), CD2V-II (583 sequences) and I177L (359 sequences) were aligned using mafft and MEGA11 software. PrimerPremier5 software was used to design primers and probes, and degenerate bases were used for some positions in the sequence.

[0023] Table 1 Multiplex PCR primer and probe combinations for African swine fever virus detection

[0024] Note: In the table, F is the forward primer, R is the reverse primer, and P is the probe sequence. Example 2 Preparation of recombinant plasmid standards The p72 target gene sequence is as follows: CAGTCATATCCGTTGCGAGGAAACGTTTGAAGCTGCCCATGGGCCCCCATCTGGGACGTGCCCTGAATCGGAGCATCCTGCCAGGATGAATGACATGCACCCAATATATGATGGCCCACCATATCATGGAAAAAGTCTCCG, SEQ ID NO.11; The CD2V-Ⅰ target gene sequence is as follows: GAAGAAATAGAAAGTCCACCACCCTCTGAATCTAATGAAGAAGATATTTCTCACGATGACACCACTTCCATACATGAACCATCTCCCAGAGAACCATTACTTCCTAAGCCTTACAGTCGTTATCAGTATAATACACCTA, SEQ ID NO.12; The CD2V-Ⅱ target gene sequence is as follows: GAAGAAATAGAAAGTCCACCACCTGAATCTAATGAAGAAGAACAATGTCAGCATGATGACACCACTTCCATACATGAACCATCTCCCAGAGAACCATTACTTCCTAAGCCTTACAGTCGTTATCAGTATAATACACCTA, SEQ ID NO.13; The I177L target gene sequence is as follows: CAAATGCGAAGGGGGATCCGTATAAAATCCTAGCTTGCCGGTAATGGCTATTAAGTTAAATTTGGTACCAGTAACACTAATATTTAAAAAGCCCTGATCATTAACTTTCCAC, SEQ ID NO. 14.

[0025] The standard plasmids pUC57-ASFV-p72, pUC57-ASFV-CD2V-I, pUC57-ASFV-CD2V-II, and pUC57-ASFV-I177L were synthesized by Beijing Qingke Biotechnology Co., Ltd. and stored in the laboratory. The concentration of the standard plasmids was determined using a NanoDrop 2000C (Thermo Fisher Scientific). The standard plasmids were quantified using the following formula: Plasmid copy number (copies / μL) = [plasmid DNA concentration (ng / μL) × 10 -9 ×6.02×10 23 ] / (660 Daltons × plasmid DNA length bp).

[0026] Example 3 Establishment of a Quadruple Fluorescence Quantitative PCR Kit for African Swine Fever Virus, Genotyping, and Gene Deletion Strains and Detection and Optimization of Detection Methods 1. Quadruple fluorescent quantitative PCR kit for African swine fever virus, genotyping, and gene deletion strains and detection The kit includes the primer-probe combination screened in the above example and its DNA-PCR reaction solution (UNG) and ddH2O; in the reaction system, the final concentration of all primers p72-F / R, CD2V-Ⅰ-F / R, CD2V-Ⅱ-F / R, and I177L-F / R is 0.1 μmol / L; The final concentration of all probes, including p72-P, CD2v-Ⅰ-P, CD2V-Ⅱ-P, and I177L-P, was 0.15 μmol / L.

[0027] 2. Reaction System and Conditions for Quadruple Fluorescence Quantitative PCR The 25 μL reaction system for quadruple fluorescence quantitative PCR assay is as follows, where 2× DNA-PCR reaction solution (UNG) was purchased from Kangwei Century Biotechnology Co., Ltd.:

[0028] Reaction conditions for multiplex TaqMan fluorescence quantitative PCR assay: 37°C, 2 min; 95°C, 3 min; 95°C, 10 s, 58°C, 20 s, 40 cycles, and the fluorescence values of the four channels of FAM, HEX, ROX, and CY5 were collected at the end of each cycle.

[0029] 3. Establishment of standard curve After optimizing the reaction conditions, standard plasmids pUC57-ASFV-p72, pUC57-ASFV-CD2v-Ⅰ, pUC57-ASFV-CD2V-Ⅱ, and pUC57-ASFV-I177L were added from 8×10 7 Continuously dilute 10-fold to 8 × 10 copies / μL -1 Copies / μL were used as templates to construct standard multiplex real-time fluorescence quantitative PCR standard curves. For specific results, see the attached Figure 1 shown.

[0030] Depend on Figure 1 The data show that the corresponding standard curves were constructed for the four genes involved in the quadruple real-time fluorescence quantitative PCR detection, and R 2 All of them were greater than 0.99, showing a good linear relationship.

[0031] The standard curve corresponding to the primer probe of p72 is: y=-3.5425x+40.061,R 2 =0.9986, The standard curve corresponding to the primer probe of CD2v-Ⅰ is: y=-3.3243x+38.461,R 2 =0.9989, The standard curve corresponding to the primer probe of CD2V-Ⅱ is: y=-3.4818x+40.995,R 2 =0.9999, The standard curve corresponding to the primer probe of I177L is: y=-3.5257x+40.075,R 2 =0.9976.

[0032] 4. The detection method of the quadruple fluorescent quantitative PCR kit comprises the following steps: 1) Extract DNA from the sample to be tested; 2) Perform RT-qPCR using the above DNA as a template to obtain the Ct value. For each 25 μL PCR amplification system for quadruple real-time fluorescence quantitative PCR: 12.5 μL 2× DNA-PCR reaction solution (UNG), 1.2 μL primer-probe combination, 6.3 μL ddH2O, 5 μL total sample DNA; in the reaction system, the final concentration of all primers p72-F / R, CD2V-I-F / R, CD2V-II-F / R, and I177L-F / R was 0.1 μmol / L; The final concentration of all probes, including p72-P, CD2v-Ⅰ-P, CD2V-Ⅱ-P, and I177L-P, was 0.15 μmol / L.

[0033] The volume ratio of the primer and probe in the primer-probe combination is: forward primer: reverse primer: probe = 1:1:1.5; The reaction conditions were as follows: 37°C, 2 min; 95°C, 3 min; 95°C, 10 s, 58°C, 20 s, 40 cycles, and the fluorescence values of the four channels of FAM, HEX, ROX, and Cy5 were collected simultaneously.

[0034] 3) Compare and interpret the Ct value based on the standard curve in the kit. The specific criteria for judgment are as follows: If there is no Ct value in the FAM channel, the HEX channel, the ROX channel, or the CY5 channel, the result is considered negative. Alternatively, when the Ct value of the FAM channel is <40 and there is a clear amplification curve, and there are or are no amplification curves in other channels, the result is determined to be ASFV positive; Alternatively, when the Ct value of the FAM channel is <40 and there is a clear amplification curve, but no amplification curve is observed in other channels, the result is determined to be a CD2v and I177L double deletion virus; Alternatively, when the Ct value of the FAM channel is <40 and there is a clear amplification curve, and the Ct value of one channel in HEX or ROX is <40 and there is a clear amplification curve, the result is determined to be I177L deletion virus; Alternatively, when the Ct value of the FAM channel is <40 and there is a clear amplification curve, there is no amplification curve in the HEX and ROX channels, and the Ct value of the CY5 channel is <40 and there is a clear amplification curve, the result is determined to be CD2v deletion virus; Alternatively, when the Ct value of the FAM channel is <40 and there is an obvious amplification curve, the Ct value of the HEX channel is <40 and there is an obvious amplification curve, the ROX channel has no Ct value, and the CY5 channel has or does not have an amplification curve, the result is determined to be CD2v-Ⅱ virus; Alternatively, when the Ct value of the FAM channel is <40 and there is an obvious amplification curve, the Ct value of the ROX channel is <40 and there is an obvious amplification curve, the HEX channel has no Ct value, and the CY5 channel has or has no amplification curve, the result is determined to be CD2v-Ⅰ virus.

[0035] 1. Verification of the specificity, sensitivity, and repeatability of the above kits 1. Specificity detection of the kit The nucleic acids of African swine fever virus (ASFV), classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), porcine epidemic diarrhea (PEDV), and porcine transmissible gastroenteritis virus (TGEV) were detected using the above kits; At the same time, positive controls were set up using pUC57-ASFV-p72, pUC57-ASFV-CD2v-Ⅰ, pUC57-ASFV-CD2V-Ⅱ, and pUC57-ASFV-I177L standard plasmids as templates, and negative controls using sterile nuclease-free water NC as template.

[0036] The test results are as attached Figure 2 As shown, the standard plasmid control FAM, HEX, ROX, and CY5 channels all showed specific amplification curves, and the African swine fever virus nucleic acid FAM, HEX, and CY5 channels showed specific amplification curves, while the other common porcine viruses and negative controls did not show amplification.

[0037] Therefore, the quadruple fluorescence quantitative PCR detection method established in this example has good specificity.

[0038] 2. Sensitivity test of the kit The recombinant plasmid standard from Example 2 was serially diluted 10-fold. Each dilution group served as a template for quadruple fluorescence quantitative PCR detection. Sterile nuclease-free water (NC) served as a negative control. Detection was performed using the primer and probe combinations described in Example 1 and the reaction system and conditions described in Example 3.

[0039] Depend on Figure 3 The data show that the established quadruple fluorescence quantitative PCR detection method has high sensitivity and low detection limit. The minimum amount of DNA that can be detected within the Ct value range of < 40 is 8 copies, which has extremely excellent sensitivity.

[0040] 3. Repeatability test of the kit For the four test genes, three serial dilutions of 8×104, 8×103, and 8×102 copies of standard plasmids were selected, respectively. According to the primer and probe combination in Example 1 and the reaction system and reaction conditions given in Example 3, three batches of repeated fluorescence quantitative PCR detection were performed. Three replicates were set for each dilution in each batch. The obtained Ct values were statistically analyzed, and the repeatability of the method was evaluated by the coefficient of variation of the Ct values within and between groups. The results are shown in Table 2.

[0041] Table 2 Intra-group and inter-group stability tests

[0042] As shown in the test results in Table 2, there was no significant difference in the Ct values of the four groups in each concentration gradient, and the coefficients of variation within and between groups were less than 2%, indicating that the established quadruple fluorescence quantitative PCR detection method had good repeatability and stability.

[0043] Example 4 Application of the Quadruple Fluorescence Quantitative PCR Detection Kit to Detect Clinical Samples Nucleic acids were extracted from 120 clinical oral, nasopharyngeal swab samples and tested by quadruple fluorescence quantitative PCR according to the kit of Example 3. The results were compared with the single-channel fluorescence quantitative PCR method for detecting the p72 target. The results are shown in Table 3.

[0044] Table 3 Results of nucleic acid testing of 120 clinical oral, nasopharyngeal swab samples

[0045] As shown in Table 3, using a single-target (p72) fluorescence quantitative PCR method, 5 ASFV-positive samples were detected among 120 clinical samples. Using the quadruple fluorescence quantitative PCR method of the present invention, the same set of clinical samples was tested. Similarly, the amplification curves for the FAM (p72) channel of all 5 samples were S-shaped, with Ct values <40, indicating that the samples were ASFV-positive. This demonstrates that the method of the present invention can be used for the detection of African swine fever virus by quadruple fluorescence PCR, with a 100% concordance rate with the conventional single-target fluorescence quantitative PCR method. Furthermore, the amplification curves for the CY5 (I177L) channel of all 5 positive samples were S-shaped, with Ct values <40; the amplification curves for the HEX (CD2V-II) channel of all 4 samples were S-shaped, with Ct values <40; and one sample showed no amplification curves for both the HEX (CD2V-II) and ROX (CD2V-I) channels, indicating that this sample was CD2v-deficient virus.

[0046] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without inventiveness, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A quadruple real-time fluorescence quantitative PCR primer-probe combination for detecting African swine fever virus, characterized by: The primer-probe combination includes a first primer-probe combination, a second primer-probe combination, a third primer-probe combination, and a fourth first primer-probe combination; wherein, The first primer-probe combinations shown are as follows: The ASFVp72 gene-specific forward primer sequence p72-F is shown in SEQ ID NO. 1; The ASFVp72 gene-specific reverse primer sequence p72-R is shown in SEQ ID NO. 2; The sequence of the ASFVp72 gene probe, p72-P, is shown in SEQ ID NO. 3; The second primer-probe combination is as follows: The ASFV type I CD2v gene-specific forward primer sequence CD2V-I-F is shown in SEQ ID NO. 4; The ASFV type I CD2v gene-specific reverse primer sequence CD2V-Ⅰ-R is shown in SEQ ID NO. 5; The sequence of the ASFV type I CD2v gene probe, CD2V-Ⅰ-P, is shown in SEQ ID NO. 6; The third primer-probe combination is as follows: The ASFV type II CD2v gene-specific forward primer sequence CD2V-II-F is shown in SEQ ID NO. 4; The ASFV type II CD2v gene-specific reverse primer sequence CD2V-II-R is shown in SEQ ID NO. 5; The sequence of the ASFV type II CD2v gene probe, CD2V-II-P, is shown in SEQ ID NO. 7; The fourth primer-probe combination is as follows: The ASFV I177L gene-specific forward primer sequence I177L-F is shown in SEQ ID NO. 8; The ASFV I177L gene-specific reverse primer sequence I177L-R is shown in SEQ ID NO.9; The sequence of the ASFV I177L gene probe I177L-P is shown in SEQ ID NO.

10.

2. The primer-probe combination according to claim 1, characterized in that The fluorescent groups at the 5′ and 3′ ends of the ASFVp72 gene probe p72-P are FAM and BHQ1, respectively; The fluorescent groups at the 5′ and 3′ ends of the ASFV type I CD2v gene probe CD2V-Ⅰ-P are ROX and BHQ2, respectively; The fluorescent groups at the 5′ and 3′ ends of the ASFV type II CD2v gene probe CD2V-II-P are HEX and BHQ1, respectively; The fluorescent groups at the 5′ and 3′ ends of the ASFV I177L gene probe I177L-P are Cy5 and BHQ3, respectively.

3. The primer-probe combination according to claim 1 or 2, characterized in that: In the first primer-probe combination, the target gene sequence of the primer is shown in SEQ ID NO.11; In the second primer-probe combination, the target gene sequence of the primer is shown in SEQ ID NO.12; In the third primer-probe combination, the target gene sequence of the primer is shown in SEQ ID NO.13; In the fourth primer-probe combination, the target gene sequence of the primer is shown as SEQ ID NO.

14.

4. Use of the primer-probe combination according to claim 1 in the preparation of a quadruple fluorescent quantitative PCR kit for African swine fever virus, genotyping, and gene deletion strains and detection.

5. A quadruple fluorescent quantitative PCR kit for African swine fever virus, genotyping, and gene deletion strain and detection, characterized in that: The kit comprises the primer-probe combination according to claim 1.

6. The quadruple fluorescent quantitative PCR kit according to claim 5, characterized in that: The kit also includes a DNA-PCR reaction solution and ddH2O; wherein, in the primer-probe combination, the concentration of each primer and probe is 25 μmol / L.

7. A detection method of the quadruple fluorescent quantitative PCR kit according to claim 5, characterized in that: The following steps are involved: 1) Extract DNA from the sample to be tested; 2) Perform RT-qPCR using the above DNA as a template to obtain the Ct value; 3) Compare and interpret the Ct value based on the standard curve in the kit.

8. The detection method according to claim 7, wherein: In step 2), for each 25 μL of the quadruple real-time fluorescence quantitative PCR system: 12.5 μL 2× DNA-PCR reaction solution, 1.2 μL primer-probe combination, 6.3 μL ddH2O, 5 μL total sample DNA; in the reaction system, the final concentration of all primers p72-F / R, CD2V-Ⅰ-F / R, CD2V-Ⅱ-F / R, and I177L-F / R was 0.1 μmol / L; The final concentration of all probes, including p72-P, CD2v-Ⅰ-P, CD2V-Ⅱ-P, and I177L-P, was 0.15 μmol / L.

9. The detection method according to claim 7, wherein: In the step 2), the reaction conditions are: 37°C, 2 min; 95°C, 3 min; 95°C, 10 s, 58°C, 20 s, 40 cycles, and the fluorescence values of the four channels of FAM, HEX, ROX, and Cy5 were collected simultaneously.

10. The detection method according to claim 7, wherein: In step 3), the judgment criteria are as follows: If there is no Ct value in the FAM channel, the HEX channel, the ROX channel, or the CY5 channel, the result is considered negative. Alternatively, when the Ct value of the FAM channel is <40 and there is a clear amplification curve, and there are or are no amplification curves in other channels, the result is determined to be ASFV positive; Alternatively, when the Ct value of the FAM channel is <40 and there is a clear amplification curve, but no amplification curve is observed in other channels, the result is determined to be a CD2v and I177L double deletion virus; Alternatively, when the Ct value of the FAM channel is <40 and there is a clear amplification curve, and the Ct value of one channel in the HEX or ROX channel is <40 and there is a clear amplification curve, the result is determined to be I177L deletion virus; Alternatively, when the Ct value of the FAM channel is < 40 and there is a clear amplification curve, there is no amplification curve in the HEX and ROX channels, and the Ct value of the CY5 channel is < 40 and there is a clear amplification curve, the result is determined to be CD2v-deficient virus; Alternatively, when the Ct value of the FAM channel is < 40 and there is a clear amplification curve, the Ct value of the HEX channel is < 40 and there is a clear amplification curve, the ROX channel has no Ct value, and the CY5 channel has or does not have an amplification curve, the result is determined to be CD2v-Ⅱ virus; Alternatively, when the Ct value of the FAM channel is < 40 and there is an obvious amplification curve, the Ct value of the ROX channel is < 40 and there is an obvious amplification curve, the HEX channel has no Ct value, and the CY5 channel has or does not have an amplification curve, the result is determined to be CD2v-Ⅰ virus.

Images