Method for enhancing fatty acid synthesis capability of escherichia coli through overexpression rfaY
By regulating the rfaY gene and tesA’ gene of E. coli, a recombinant plasmid was constructed, which solved the problem that the production potential of E. coli fatty acids in the prior art was not fully released, and efficient synthesis of fatty acids and improved cell membrane integrity was achieved.
Patent Information
- Application Number
- CN202510453734.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-11
- Publication Date
- 2025-08-22
AI Technical Summary
The existing technology for metabolic engineering to transform E. coli's fatty acid production is difficult to fully release its production potential, and the optimization effect of relying solely on core metabolic pathways is limited.
By regulating the non-fatty acid pathway gene rfaY, a recombinant plasmid overexpressing rfaY and tesA’ was constructed and transformed into E. coli MG1655 (DE3)ΔfadE, the engineered strain RF was constructed to improve fatty acid synthesis ability and cell membrane integrity.
The fatty acid production and cell membrane integrity of E. coli was significantly improved, with fatty acid production increased by 208% and cell membrane integrity increased by 81%.
Smart Images

Figure CN120519491A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of biosynthesis and bioenergy, and particularly relates to the application of gene rfaY in improving the fatty acid production and tolerance of Escherichia coli. Background Art
[0002] Fatty acids, as important platform compounds, hold broad application prospects in industrial production and the energy sector. In industrial processes, fatty acids serve as precursors for compounds used as antimicrobial agents, textile processing agents, surfactants, and polymer additives. In the energy sector, fatty acids can be used as precursors for biofuel production. Fatty acid-derived fuels, due to their low hygroscopicity and good miscibility with diesel, have attracted considerable attention as a renewable resource.
[0003] As a prokaryotic model organism, Escherichia coli has become a key research target for understanding fundamental metabolic mechanisms and developing industrial strains, thanks to its comprehensive gene editing technology, well-defined genome annotation, rapid proliferation, and wide availability of carbon sources. Currently, metabolic engineering efforts, primarily through knockout of genes in bypass metabolic pathways, overexpression of key genes in synthetic pathways, and adaptation of upstream and downstream metabolic modules, have significantly increased the production of fatty acids synthesized by engineered E. coli, demonstrating the enormous potential of E. coli for industrial fatty acid synthesis.
[0004] However, due to the complexity of the microbial metabolic network, it is difficult to fully release its production potential by simply relying on the optimization of the core metabolic pathway. Therefore, by analyzing the global regulatory mechanism through systems biology means, in particular, the regulatory effect of non-product synthesis pathway genes on physiological processes such as carbon flow distribution and stress response, it will become the key breakthrough for fully developing Escherichia coli production potential and efficiently synthesizing fatty acids. In the present invention, by regulating the gene rfaY encoding lipopolysaccharide core heptose II phosphokinase, not only the fatty acid synthesis ability of Escherichia coli is significantly improved, but also the cell membrane integrity and fatty acid tolerance are improved. Summary of the Invention
[0005] The purpose of the present invention is to overcome the shortcomings of existing metabolic engineering technology for transforming Escherichia coli to produce fatty acids and to provide a recombinant Escherichia coli strain that can efficiently synthesize fatty acids by regulating the non-fatty acid pathway gene rfaY.
[0006] A second objective of the present invention is to provide a method for constructing a recombinant Escherichia coli strain for synthesizing fatty acids, characterized by overexpressing the endogenous E. coli genes rfaY (encoding lipopolysaccharide (LPS) core heptose II phosphokinase) and tesA' (encoding a thioesterase without a leader sequence).
[0007] The third object of the present invention is to provide a use of a synthetic fatty acid recombinant Escherichia coli strain for synthesizing fatty acids.
[0008] The fourth object of the present invention is to provide a use of a recombinant Escherichia coli strain that synthesizes fatty acids to improve cell membrane integrity.
[0009] The technical solution of the present invention is summarized as follows:
[0010] This study enhances fatty acid synthesis in Escherichia coli by overexpressing rfaY. By constructing a recombinant plasmid that co-overexpresses the rfaY gene and the tesA' gene, and transforming the recombinant plasmid into the E. coli MG1655(DE3)ΔfadE chassis, an engineered strain, RF, was constructed that significantly increases fatty acid production. Furthermore, membrane integrity characterization revealed that the cell membrane integrity of the RF strain was significantly improved.
[0011] 1. A method for constructing a recombinant Escherichia coli strain capable of synthesizing fatty acids, comprising the following steps:
[0012] (1) The rfaY overexpression cassette was obtained by amplifying the fragment of plasmid pASKA-rfaY+ by priming T5-rfaY_Fw and priming T5-rfaY_Rv.
[0013] The nucleotide sequence of T5-rfaY_Fw is shown in SEQ ID NO.1;
[0014] The nucleotide sequence of T5-rfaY_Rv is shown in SEQ ID NO.2;
[0015] The nucleotide sequence of pASKA-rfaY+ is shown in SEQ ID NO.3;
[0016] The nucleotide sequence of the rfaY overexpression cassette fragment is shown in SEQ ID NO.4;
[0017] The nucleotide sequence of the gene rfaY is shown in SEQ ID NO.5;
[0018] (2) Amplify the fragment of plasmid pF by priming lac-tesA'_Fw and lac-tesA'_Rv to obtain the pF_lac_tesA' backbone.
[0019] The nucleotide sequence of the lac-tesA'_Fw is shown in SEQ ID NO.6;
[0020] The nucleotide sequence of the lac-tesA'_Rv is shown in SEQ ID NO.7;
[0021] The nucleotide sequence of the pF plasmid is shown in SEQ ID NO.8;
[0022] The nucleotide sequence of the pF_lac_tesA' skeleton is shown in SEQ ID NO.9;
[0023] The nucleotide sequence of the gene tesA' is shown in SEQ ID NO.10;
[0024] (3) The rfaY overexpression cassette was connected to the pF_lac_tesA' backbone by seamless cloning to construct the recombinant plasmid pRF.
[0025] The nucleotide sequence of the plasmid pRF is shown in SEQ ID NO.11;
[0026] (4) The recombinant plasmid pRF and plasmid pF were transformed into Escherichia coli MG1655 (DE3)-ΔfadE, respectively, to obtain the fatty acid-synthesizing recombinant Escherichia coli strain RF and the control strain F.
[0027] 2. The synthetic fatty acid recombinant Escherichia coli strain RF constructed by the above construction method.
[0028] 3. Use of the above-mentioned recombinant Escherichia coli strain RF in synthesizing fatty acids.
[0029] 4. The above-mentioned synthetic fatty acid recombinant Escherichia coli strain RF can significantly improve cell membrane integrity.
[0030] Advantages of the present invention:
[0031] 1. The fatty acid-synthesizing recombinant Escherichia coli strain RF constructed in the present invention can efficiently synthesize fatty acids using glycerol as a carbon source by regulating the expression of endogenous genes that are not directly related to fatty acid metabolism.
[0032] 2. The fatty acid production of the synthetic fatty acid recombinant Escherichia coli strain RF constructed by the present invention can reach 2461.29 mg / L, which is 208% higher than that of the control strain.
[0033] 3. The synthetic fatty acid recombinant Escherichia coli strain RF constructed by the present invention can significantly improve the integrity of the cell membrane. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Various other advantages and benefits will become apparent to those skilled in the art upon reading the detailed description of the preferred embodiment below. The accompanying drawings are for illustration purposes only and are not to be considered as limiting the present invention. The same reference symbols are used throughout the drawings to represent the same components. In the drawings:
[0035] Figure 1 Schematic diagram of the construction of recombinant plasmid pRF.
[0036] Figure 2This is a graph showing the test tube fermentation yield of recombinant Escherichia coli strains F and RF for synthesizing fatty acids.
[0037] Figure 3 This is a diagram of the cell membrane integrity of recombinant Escherichia coli strains F and RF that synthesize fatty acids. DETAILED DESCRIPTION
[0038] The original strain Escherichia coli MG1655 (DE3) was purchased from ZOMANBIO (http: / / www.zomanbio.com / products_info.php?nid=4196) in September 2018.
[0039] Escherichia coli chassis strain MG1655(DE3)-ΔfadE (stored in our laboratory)
[0040] rfaY gene: from Escherichia coli W3110;
[0041] tesA' gene: from Escherichia coli MG1655 (DE3);
[0042] The nucleotide sequence of the pF plasmid is shown in SEQ ID NO.8.
[0043] pASKA-rfaY + The nucleotide sequence of the plasmid is shown in SEQ ID NO. 3 (Kitagawa M, Ara T, Arifuzzaman M, et al. Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research [J]. DNA Res, 2005, 12 (5): 291-299.).
[0044] Product synthesis within microorganisms is regulated not only by genes involved in the product synthesis pathway but also by genes outside of the pathway within the complex metabolic network within the cell. Therefore, identifying and regulating the expression of potential genes within the cellular metabolic network can not only fully tap the potential of cellular product synthesis, but also accelerate the construction of high-yield engineered Escherichia coli strains and deepen the understanding of the cellular product synthesis and regulatory mechanisms.
[0045] The present invention will be further described below with reference to specific embodiments.
[0046] Example 1: A method for constructing a recombinant Escherichia coli chassis for synthesizing fatty acids, characterized by comprising the following steps:
[0047] (1) Transform the plasmid pF into Escherichia coli MG1655(DE3)-ΔfadE to obtain the recombinant strain F;
[0048] The nucleotide sequence of the pF plasmid is shown in SEQ ID NO.1;
[0049] (2) The rfaY overexpression cassette was obtained by amplifying the fragment of plasmid pASKA-rfaY+ by priming T5-rfaY_Fw and priming T5-rfaY_Rv.
[0050] The nucleotide sequence of T5-rfaY_Fw is shown in SEQ ID NO.2;
[0051] The nucleotide sequence of T5-rfaY_Rv is shown in SEQ ID NO.3;
[0052] The nucleotide sequence of pASKA-rfaY+ is shown in SEQ ID NO.4;
[0053] The nucleotide sequence of the rfaY overexpression cassette fragment is shown in SEQ ID NO.5;
[0054] The nucleotide sequence of the gene rfaY is shown in SEQ ID NO.6;
[0055] (3) Amplify the fragment of plasmid pF by priming lac-tesA'_Fw and lac-tesA'_Rv to obtain the pF_lac_tesA' backbone.
[0056] The nucleotide sequence of the lac-tesA'_Fw is shown in SEQ ID NO.7;
[0057] The nucleotide sequence of the lac-tesA'_Rv is shown in SEQ ID NO.8;
[0058] The nucleotide sequence of the pF_lac_tesA' skeleton is shown in SEQ ID NO.9;
[0059] The nucleotide sequence of the gene tesA' is shown in SEQ ID NO.10;
[0060] (4) The rfaY overexpression cassette was connected to the pF_lac_tesA' backbone by seamless cloning to construct the recombinant plasmid pRF.
[0061] The nucleotide sequence of the plasmid pRF is shown in SEQ ID NO.11;
[0062] (5) The recombinant plasmid pRF was transformed into Escherichia coli MG1655 (DE3)-ΔfadE to obtain the fatty acid-synthesizing recombinant Escherichia coli strain RF.
[0063] Example 2: Production of fatty acids by test tube fermentation of recombinant Escherichia coli strain RF
[0064] 1. Strain activation
[0065] The recombinant E. coli strains F and RF were taken out of the -80°C freezer and transferred to LB liquid culture medium containing kanamycin at a final concentration of 50 μg / mL, respectively, and cultured overnight at 30°C and 250 rpm to activate the strains.
[0066] 2. Test tube fermentation
[0067] The activated strains F and RF culture solutions obtained in step 1 were transferred into test tubes containing 5 mL of test tube fermentation medium at a ratio of 1%, and cultured at 30°C and 250 rpm. 600 When the concentration of IPTG was 1, IPTG with a final concentration of 100 μM was added to F and RF, respectively. The culture was continued at 30°C and 250 rpm for 40 h, and the culture medium was used for product analysis.
[0068] The formulation of the test tube fermentation medium is: 17.1 g / L Na₂HPO₄·12H₂O, 3 g / L KH₂PO₄, 0.5 g / L NaCl, 2 g / L NH₄Cl, 2 g / L yeast extract, 30 g / L glycerol, 0.25 g / L MgSO₄·7H₂O, 11.1 mg / L CaCl₂, 1 mL / L trace element stock solution, 10 mg / L V B1, 0.1% (v / v) Triton-X100, and the balance is water. Kanamycin was added to a final concentration of 50 μg / mL when culturing strains F and RF.
[0069] The trace element mother solution is: 27g / LFeCl3·6H2O, 2g / LZnCl2, 2g / LNa2MoO4·2H2O, 1.9g / LCuSO4·5H2O and 0.5g / L H3BO3, and the balance is water.
[0070] 3. Extraction and analysis of fatty acids
[0071] 500 μl of the F and CF culture fluids obtained in step 2 of this embodiment were taken respectively, and 50 μl of hydrochloric acid and 60 μg of heptadecanoic acid were added as internal standards. After adding 0.5 mL of ethyl acetate, the mixture was vortexed for 5 min and centrifuged at 12000 rpm for 2 min. 350 μl of the upper organic phase was collected respectively, and 0.5 mL of ethyl acetate was added to the lower solution again, vortexed for 5 min, centrifuged at 12000 rpm for 2 min, and 500 μl of the upper organic phase was taken respectively; the organic phases collected in the first two steps were combined and filtered with a 0.22 μm organic filter membrane. The filtrate was detected and analyzed by gas chromatography (GC). A SHIMADZU Nexis GC-2030 instrument, a TG-WaxMS A chromatographic column (30 m × 0.32 mm × 0.25 μm; Thermo Scientific) and a dielectric barrier discharge plasma detector (BID) were used, with helium as the carrier gas, a flow rate of 1 mL / min, no split injection, and a sample volume of 1 uL. The column temperature program was as follows: initial temperature 50°C, hold for 1 minute, then increase to 245°C at a rate of 30°C / min, and hold at 245°C for 22.5 minutes. Fatty acid species were identified by reference to the elution time of the corresponding fatty acid standards. Fatty acid amounts were quantified by reference to the fatty acid peak area and the internal standard (heptadecanoic acid) peak area. The final fatty acid concentration was the sum of the concentrations of saturated and monounsaturated fatty acids with chain lengths of C12, C14, C16, and C18.
[0072] 4. Results
[0073] Depend on Figure 2 It can be seen that the recombinant E. coli strain F produced 799.55 mg / L fatty acids in test tube culture; the recombinant E. coli strain RF had better fatty acid synthesis ability and produced 2461.29 mg / L fatty acids in test tube culture, which was 208% higher than that of strain F.
[0074] Example 3: Determination of cell membrane integrity of recombinant E. coli strain RF
[0075] 1. Strain activation
[0076] The recombinant E. coli strains F and RF were taken out of the -80°C freezer and transferred to LB liquid culture medium containing kanamycin at a final concentration of 50 μg / mL, respectively, and cultured overnight at 30°C and 250 rpm to activate the strains.
[0077] 2. Test tube fermentation
[0078] The activated strains F and RF culture solutions obtained in step 1 were transferred into test tubes containing 5 mL of test tube fermentation medium at a ratio of 1%, and cultured at 30°C and 250 rpm. 600When the pH value was 1, IPTG with a final concentration of 100 μM was added to F and RF, respectively. The cultures were cultured at 30°C and 250 rpm for 40 h, and the culture medium was used for cell membrane integrity analysis.
[0079] The formula of the test tube fermentation medium was as follows: 17.1 g / L Na₂HPO₄·12H₂O, 3 g / L KH₂PO₄, 0.5 g / L NaCl, 2 g / L NH₄Cl, 2 g / L yeast extract, 30 g / L glycerol, 0.25 g / L MgSO₄·7H₂O, 11.1 mg / L CaCl₂, 1 mL / L trace element stock solution, 10 mg / L V B1, 0.1% (v / v) Triton-X100, and the balance was water. Kanamycin was added to a final concentration of 50 μg / mL when culturing strains F and RF.
[0080] The trace element mother solution is: 27g / LFeCl3·6H2O, 2g / LZnCl2, 2g / LNa2MoO4·2H2O, 1.9g / LCuSO4·5H2O and 0.5g / LH3BO3, and the balance is water.
[0081] 3. PI staining and flow cytometric analysis
[0082] Take 500 μL of the culture medium in step 2, centrifuge at 5000 rpm for 2 min, discard the supernatant, rinse the bacterial pellet twice with sterile saline, and adjust the OD 600 To 0.8. Add 160 μL of 1 mg / mL PI dye to 4 mL of sample and incubate at 4°C for 10 min to ensure that the membrane-damaged cells are labeled with PI. Finally, centrifuge at 5000 rpm for 2 min, discard the supernatant, wash the cells again twice with sterile saline, and dilute the sample to OD 600 =0.02. A 500 μL PI-stained sample was analyzed using a flow cytometer (Beckman CytoFLEX) with an excitation wavelength of 488 nm and an emission wavelength of 620 nm. 30,000 cells were collected and the red fluorescence signal, forward scatter, and side scatter of the cells in the sample were measured. The data were analyzed using FlowJo software.
[0083] 4. Results
[0084] Cell membrane integrity results such as Figure 3As shown in the figure, the gray part represents the cell population that was not stained by PI, and the red part represents the cell population that was stained by PI due to damaged cell membrane. The proportion of cells with intact membranes corresponding to each strain is marked above the results of the F and RF strain samples. The proportion of cells with intact membranes in the RF strain is 92.5%, which is significantly higher than that of the control strain F (51.1%). The cell membrane integrity of the RF strain is improved by 81.0% compared with the control strain F. Therefore, the RF strain can significantly improve cell membrane integrity while increasing fatty acid production.
[0085] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
[0086] Sequence Listing
[0087] SEQ ID NO.1
[0088] T5-rfaY_Fw nucleotide sequence (artificially synthesized)
[0089] actagttcataaaaaatttatttgctttgtgagcg
[0090] SEQ ID NO.2
[0091] T5-rfaY_Rv nucleotide sequence (artificially synthesized)
[0092] gagctcattctcaccaataaaaaacgccc
[0093] SEQ ID NO.3
[0094] pASKA-rfaY+nucleotide sequence (artificially synthesized)
[0095]
[0096] SEQ ID NO.4
[0097] rfaY overexpression cassette nucleotide sequence (artificially synthesized)
[0098]
[0099] SEQ ID NO.5
[0100] rfaY nucleotide sequence (from wild - type Escherichia coli MG1655(DE3))
[0101] atgattcagaagagcaagatcaaagacttggttgtttttaccgatgaaaacaattcaaagtacctcaatgtattaaatgacttcttgtcttataatataaatatcatcaaggtttttcgttctattgatgatacaaaagttatgcttattgataccgattacggtaaattgattcttaaggttttttctccgaaagttaagcgtaacgaacgtttctttaagtctctgttaaaaggtgattattacgaacgcctttttgagcaaacccaaaaagtacgaaatgaagggttaaatacactcaatgacttttatttattggctgaacggaaaaccttacgttttgtccatacttatatcatgatcatcgagtatattgatggcatagagttgtgtgatatgcccgatattgatgatgcgctaaaaaataaaattcagcaatcaattaatgccttacatcaacatggcatggtttctggcgacccccatcgtggtaacttcattataaaaaatggtgaggttcgaattatcgatctctccggaaagcgtgcttcagcgcagcgtaaagcgaaagatcgtattgacttagagcgtcattacggtattaaaaatgagattagagatctaggctattatcttttagtatatcgtaaaaaaatgcgcaattttatgcggcgtttgaaagggaaaccagcgcgctaa
[0102] SEQ ID NO.6
[0103] lac - tesA’_Fw nucleotide sequence (synthetic)
[0104] ttttttattggtgagaatgagctccgcataatgcttaagtcgaacag
[0105] SEQ ID NO.7
[0106] lac-tesA'_Rv nucleotide sequence (artificially synthesized)
[0107] caaataaattttttatgaactagtatttcctaatgcaggagtcgc
[0108] SEQ ID NO.8
[0109] pF nucleotide sequence (artificially synthesized)
[0110]
[0111] SEQ ID NO.9
[0112] pF_lac_tesA' backbone nucleotide sequence (artificially synthesized)
[0113]
[0114] SEQ ID NO.10
[0115] tesA’ nucleotide sequence (synthetic)
[0116] atggcggacacgttattgattctgggtgatagcctgagcgccgggtatcgaatgtctgccagcgcggcctggcctgccttgttgaatgataagtggcagagtaaaacgtcggtagttaatgccagcatcagcggcgacacctcgcaacaaggactggcgcgccttccggctctgctgaaacagcatcagccgcgttgggtgctggttgaactgggcggcaatgacggtttgcgtggttttcagccacagcaaaccgagcaaacgctgcgccagattttgcaggatgtcaaagccgccaacgctgaaccattgttaatgcaaatacgtctgcctgcaaactatggtcgccgttataatgaagcctttagcgccatttaccccaaactcgccaaagagtttgatgttccgctgctgcccttttttatggaagaggtctacctcaagccacaatggatgcaggatgacggtattcatcccaaccgcgacgcccagccgtttattgccgactggatggcgaagcagttgcagcctttagtaaatcatgactcataa
[0117] SEQ ID NO.11
[0118] pRF nucleotide sequence (synthetic)
[0119]
Claims
1. A method for constructing a recombinant Escherichia coli strain for synthesizing fatty acids, characterized by: The steps include: (1) The rfaY overexpression cassette was obtained by amplifying the fragment of plasmid pASKA-rfaY+ by priming T5-rfaY_Fw and priming T5-rfaY_Rv. The nucleotide sequence of T5-rfaY_Fw is shown in SEQ ID NO.1; The nucleotide sequence of T5-rfaY_Rv is shown in SEQ ID NO.2; The nucleotide sequence of pASKA-rfaY+ is shown in SEQ ID NO.3; The nucleotide sequence of the rfaY overexpression cassette fragment is shown in SEQ ID NO.4; The nucleotide sequence of the gene rfaY is shown in SEQ ID NO.5; (2) Amplify the fragment of plasmid pF by priming lac-tesA'_Fw and lac-tesA'_Rv to obtain the pF_lac_tesA' backbone. The nucleotide sequence of the lac-tesA'_Fw is shown in SEQ ID NO.6; The nucleotide sequence of the lac-tesA'_Rv is shown in SEQ ID NO.7; The nucleotide sequence of the pF plasmid is shown in SEQ ID NO.8; The nucleotide sequence of the pF_lac_tesA' skeleton is shown in SEQ ID NO.9; The nucleotide sequence of the gene tesA' is shown in SEQ ID NO.10; (3) The rfaY overexpression cassette was connected to the pF_lac_tesA' backbone by seamless cloning to construct the recombinant plasmid pRF. The nucleotide sequence of the plasmid pRF is shown in SEQ ID NO.11; (4) The recombinant plasmid pRF and plasmid pF were transformed into Escherichia coli MG1655 (DE3)-ΔfadE, respectively, to obtain the fatty acid-synthesizing recombinant Escherichia coli strain RF and the control strain F.
2. A fatty acid-synthesizing recombinant Escherichia coli strain RF constructed by the construction method according to claim 1.
3. A use of the fatty acid-synthesizing recombinant Escherichia coli strain RF according to claim 2 for synthesizing fatty acids.
4. The use of the synthetic fatty acid recombinant Escherichia coli strain RF for synthesizing fatty acids according to claim 3, characterized in that: The synthetic fatty acid recombinant Escherichia coli strain RF can improve cell membrane integrity.