Application of alpha-amylase / subtilisin inhibitor LASI gene in improvement of drought resistance and salt resistance of crops

Abstract

The invention discloses application of an alpha-amylase / subtilisin inhibitor LASI gene in improvement of drought resistance and salt resistance of crops. The nucleotide sequence of the Ligusticum wallichii LASI gene is as shown in SEQ ID NO. 1; transgenic arabidopsis thaliana plants are obtained through genetic engineering and transgenic identification methods, the drought resistance and the salt resistance of transgenic and wild type arabidopsis thaliana are analyzed through growth indexes and biochemical indexes, and LASI transgenic arabidopsis thaliana with the drought resistance and the salt resistance is successfully obtained. The invention provides a new gene source for cultivating crops with stronger drought resistance and salt tolerance by utilizing a gene engineering technology.

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biology and biotechnology, and in particular relates to the application of an α-amylase / subtilisin inhibitor LASI gene in improving the drought resistance and salt tolerance of crops. Background Art

[0002] Under drought and salt stress, plant cells undergo physiological changes such as excessive protein degradation, accumulation of reactive oxygen species, and imbalances in cellular homeostasis, ultimately affecting normal plant growth and development and even leading to death. In recent years, rising global temperatures, driven by factors such as increased greenhouse gas emissions, have significantly increased the frequency and severity of droughts. In the context of global warming, salt accumulates in irrigated soils as water evaporates, leading to the expansion and increasing severity of salinity. Breeding drought-resistant and salt-tolerant crop varieties is one of the most economical and effective measures to improve and utilize adverse environmental resources. Genetic engineering, an effective means of breeding drought- and salt-tolerant crops, primarily requires the identification of effective drought- and salt-tolerant genes. Our previous research has validated the disease resistance and antibacterial properties of Chuanxiong LASI, and this new invention expands upon and applies these drought- and salt-tolerant properties. Summary of the Invention

[0003] In view of the deficiencies in the prior art, the present invention provides an application of an α-amylase / subtilisin inhibitor LASI gene in improving the drought and salt tolerance of crops.

[0004] The present invention discloses an application of an α-amylase / subtilisin inhibitor LASI gene in improving the drought and salt tolerance of crops: transgenic Arabidopsis plants are obtained through genetic engineering and transgenic identification methods, and the drought and salt tolerance of transgenic and wild-type Arabidopsis are analyzed through growth indicators and biochemical indicators. LASI-transgenic Arabidopsis with drought and salt resistance are successfully obtained, thereby providing a new gene source for cultivating crops with stronger drought and salt resistance using genetic engineering technology. The method specifically comprises the following steps:

[0005] Step 1: Obtaining the LASI gene of Chuanxiong.

[0006] Total DNA from the rhizomes of Ligusticum chuanxiong was extracted using a plant RNA extraction kit provided by OMEGA. The extracted total RNA was subjected to 1% agarose gel electrophoresis to detect its extraction amount and concentration. After reverse transcription into cDNA, the LASI gene was amplified using the cDNA as a template to add a KpnI restriction site.

[0007] Step 2: Construction of recombinant vector.

[0008] Step 2.1: Select pCambia2301 as the vector and use KpnI enzyme to linearize the vector. During the enzyme digestion reaction, add all components, mix gently, and then centrifuge briefly. Incubate at 37°C for 30 minutes.

[0009] Step 2.2: Recombinate the PCR product from step 1 with the linearized vector. After adding the sample, gently pipette to mix. Centrifuge briefly and incubate at 37°C for 30 minutes. Then immediately cool on ice.

[0010] Step 2.3: Thaw 100 μL of E. coli DH5α competent cells on ice, slowly add 10 μL of the recombinant product, and incubate on ice for 30 minutes. Heat shock the cells at 42°C in a metal bath for 90 seconds, then incubate on ice for 2 minutes. Add 800 μL of LB liquid medium and culture on a shaker at 37°C for 45 minutes. Centrifuge at 5000 rpm for 3 minutes, discard 800 μL of the supernatant, and coat the remaining cells with 50 μg / mL kanamycin-resistant LB solid medium. Incubate the cells in an inverted manner at 37°C overnight.

[0011] Step 2.4: Pick resistant colonies for PCR positive detection, insert the upstream promoter fragment of the target gene and the downstream amplification primers of the target gene respectively. After the PCR reaction, culture the positive transformants to extract the plasmid and send them to Qingke Biotechnology for sequencing.

[0012] Step 3: Obtain transgenic Arabidopsis plants.

[0013] Step 3.1: Transform the recombinant plasmid into Agrobacterium GV3101 competent cells using the heat shock method.

[0014] Take 200 μL of Agrobacterium GV3101 competent cells and melt them on ice. Slowly add 5 μL of recombinant plasmid and ice bath for 30 minutes; quick freeze in liquid nitrogen for 2 minutes, keep warm in a 37°C metal bath for 5 minutes, and then quickly ice bath for 5 minutes; add 800 μL of LB liquid culture medium and expand the culture in a shaker at 28°C and 180 rpm for 4 hours; centrifuge at 5000 rpm for 5 minutes, discard the supernatant, resuspend the precipitated bacteria, evenly spread them on LB solid culture medium, and invert to culture in a 28°C constant temperature incubator for 2 days; pick the monoclonal colonies on the plate for colony PCR verification and screening of positive clones, and store the positive recombinant Agrobacterium in a refrigerator at -80°C with 20% glycerol.

[0015] Step 3.2: Arabidopsis genetic transformation.

[0016] Wild-type Arabidopsis seeds were placed in EP tubes, sterilized with anhydrous ethanol for 30 seconds, 10% sodium hypochlorite for 4 minutes, and washed three times with sterile ddH2O. The treated seeds were then placed on 1 / 2MS solid culture medium and cultured in the dark at 4°C for 3 days, followed by culturing under alternating conditions of 16 hours of light and 8 hours of darkness for 2 weeks. The seeds were then transferred to nutrient soil for culture and allowed to grow inflorescences. Positive Agrobacterium was cultured in LB liquid medium at 28°C and 180 rpm for 24 hours. The culture was centrifuged at 5000 rpm for 15 minutes, the supernatant was discarded, and the bacteria were resuspended in 10 mL of infiltration solution containing 10% sucrose and 0.025% Silwet L-77. The grown fruit pods of the Arabidopsis were cut off, and the inflorescences were immersed in the infiltration solution for 30 seconds with slight shaking during the process. The infected Arabidopsis plants were wrapped with plastic wrap to maintain humidity, cultured in the dark for 1 day, and then cultured under normal conditions. The plastic wrap was removed after 2-3 days, and the plants were cultured until mature plants were harvested.

[0017] Step 3.3: Screening and identification of LASI transgenic positive seedlings.

[0018] The seeds were sown in 1 / 2MS medium containing 50 μg / mL kanamycin and cultured. After one week, healthy positive seedlings were selected and transferred to nutrient soil for further culture. After three weeks, plant genomic DNA was extracted. Since wild-type Arabidopsis does not contain the 35s promoter, PCR verification was performed using primers containing the upstream sequence of the 35s promoter and the downstream primers of the LASI gene. If amplification was successful, it was a positive plant.

[0019] Step 4: Detection of Arabidopsis growth and development under drought and salt stress.

[0020] Wild-type and LASI transgenic Arabidopsis seeds were cultured in 1 / 2MS conventional culture medium. After two weeks, seedlings with similar growth characteristics were selected and transferred to nutrient soil, with four plants per pot. Each type was divided into three groups: no treatment, drought stress, and salt stress. The no-stress group was cultured normally, the drought stress group was not watered and allowed to dry naturally, and the salt stress group had its roots immersed in 1% NaCl solution for 10 minutes every week. After three weeks of drought and salt stress, the growth indicators of wild-type and LASI transgenic Arabidopsis were recorded, including fresh weight, number of leaves, leaf length, and leaf width, as well as biochemical indicators including SOD, POD, CAT, MDA, H2O2, ABA, α-amylase, and subtilisin inhibitory activity.

[0021] Furthermore, the nucleotide sequence of the α-amylase / subtilisin inhibitor LASI gene is shown in SEQ ID NO. 1, and the specific sequence is as follows:

[0022] ATGAAGAAAAATTTGTTCTACATCTCATTCCTCCTTGTTGCTTTGTCAACTTACTCTC

[0023] TTGTTTCAGGGGATGCATCGCCTGATGCTGTACGCGACATGGACGGAGACATACTCCGA

[0024] GCAGGGTTCATTACTATATCTTGCCTGGTTTACGAGGTATGGGAGGTGGTGTAACACTA

[0025] GGTAGCACCAGAAATGAATCTTGCCCCTTAGACGTTGTCCAAGAAACATTTGAAACAGA

[0026] CAACGGTAACCTTCCCTTAACATTCACAATGGTTGATCCGAAAAAAGGTGTTATCCGCGA

[0027] ATCAACTGATTTGAACATCGAGTTCAATGGTGTAACGATTTGCATTCAATCATTGGTTTGG

[0028] AAACTTGATAACTATGATGGAGAGTACGTTGTTAGTACTCGGGGAGTTAAAGGAAACCC

[0029] GGGAATTGAAACTCTAGACAGTTGGTTTAAGATTGAAAAATATTCGAATAACTACAAGTT

[0030] TGTTTTTGTTTTCTGCCCAACCGTATGCGATTTCTGCAAACCAATATGCGGAGATATCGGC

[0031] ATCTCGATCAAGAATGGTGTTCGAAGATTGGTTCTTAGCGATGAACCCTTCATGGTTATG

[0032] TTCTTGAAGGTT.

[0033] An engineered bacterium comprising the above-mentioned gene.

[0034] A plasmid comprising the above gene.

[0035] A recombinant expression vector, characterized in that it comprises the above-mentioned gene.

[0036] A preparation for improving the drought resistance and salt tolerance of crops, comprising a Chuanxiong α-amylase / subtilisin inhibitor LASI, or an active ingredient that promotes the expression of the Chuanxiong α-amylase / subtilisin inhibitor LASI gene as an effective ingredient.

[0037] Furthermore, the active ingredient is a small molecule compound, shRNA, gRNA or short peptide.

[0038] The above genes are used in crop variety improvement or seed resources.

[0039] The above genes are used in the cultivation of transgenic crops with drought resistance and salt tolerance.

[0040] The beneficial technical effects of the present invention are:

[0041] The present invention obtains transgenic Arabidopsis plants through genetic engineering and transgenic identification methods, analyzes the drought and salt tolerance of transgenic and wild-type Arabidopsis through growth indicators and biochemical indicators, and successfully obtains transgenic Arabidopsis with high drought and salt tolerance, thereby providing a new gene source for cultivating crops with stronger drought and salt resistance using genetic engineering technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 Screening and identification of LASI transgenic Arabidopsis thaliana; band M: DL2000 Maker; 1-8: single colonies of recombinant bacteria containing pCambia2301-LASI in GV3103; 0: single colony of recombinant bacteria containing no pCambia2301 in GV3101; X: pCambia2301-LASI plasmid.

[0043] Figure 2 This is a growth comparison chart of transgenic Arabidopsis and wild-type Arabidopsis.

[0044] Figure 3 This is the sequencing map of the recombinant bacteria of the recombinant plasmid pCambia2301-LASI.

[0045] Figure 4 The fresh weight growth index of wild-type and LASI transgenic Arabidopsis thaliana under salt stress and drought stress for 3 weeks. (*: p < 0.05, **: p < 0.01, ***: p < 0.001)

[0046] Figure 5 The leaf number growth index of wild-type and LASI transgenic Arabidopsis thaliana under salt stress and drought stress for 3 weeks. (*: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001)

[0047] Figure 6The leaf length growth index of wild-type and LASI transgenic Arabidopsis thaliana after 3 weeks of salt stress and drought stress. (*: p < 0.05, **: p < 0.01)

[0048] Figure 7 The leaf width growth index of wild-type and LASI transgenic Arabidopsis thaliana under salt stress and drought stress for 3 weeks. (*: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001)

[0049] Figure 8 The SOD activity of wild-type and LASI transgenic Arabidopsis thaliana under salt and drought stress for 3 weeks (*: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001)

[0050] Figure 9 POD activity in wild-type and LASI transgenic Arabidopsis thaliana after three weeks of salt and drought stress (*: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001)

[0051] Figure 10 CAT activity in wild-type and LASI transgenic Arabidopsis thaliana after three weeks of salt and drought stress. (*: p<0.05, **: p<0.01, ***: p<0.001)

[0052] Figure 11 Statistics of MDA content in wild-type and LASI transgenic Arabidopsis thaliana after 3 weeks of salt and drought stress. (****: p<0.0001)

[0053] Figure 12 Statistics of H2O2 content in wild-type and LASI transgenic Arabidopsis plants after three weeks of salt and drought stress. (***: p<0.001, ****: p<0.0001)

[0054] Figure 13 α-amylase inhibitory activity in wild-type and LASI transgenic Arabidopsis thaliana after 3 weeks of salt and drought stress (**: p < 0.01, ***: p < 0.001, ****: p < 0.0001)

[0055] Figure 14 The subtilisin inhibitory activity of wild-type and LASI transgenic Arabidopsis thaliana under salt and drought stress for 3 weeks (*: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.0001)

[0056] Figure 15 ABA content in wild-type and LASI transgenic Arabidopsis plants after three weeks of drought and salt stress. (**: p<0.01, ***: p<0.001, ****: p<0.0001)

[0057] Figure 16 This is a technical flow chart of the application of the α-amylase / subtilisin inhibitor LASI gene of the present invention in improving the drought resistance and salt tolerance of crops. DETAILED DESCRIPTION

[0058] The present invention will be further described in detail below with reference to the accompanying drawings and specific implementation methods.

[0059] The application process of the α-amylase / subtilisin inhibitor LASI gene of the present invention in improving the drought resistance and salt tolerance of crops is as follows: Figure 16 As shown: Transgenic Arabidopsis plants were obtained through genetic engineering and transgenic identification methods. The drought and salt tolerance of transgenic and wild-type Arabidopsis were analyzed through growth indicators and biochemical indicators. Transgenic Arabidopsis with the LASI gene and drought and salt tolerance were successfully obtained, thereby providing a new gene source for cultivating crops with stronger drought and salt tolerance using genetic engineering technology. The specific steps include:

[0060] Step 1: Obtaining the LASI gene of Chuanxiong.

[0061] Total RNA was extracted from the rhizomes of Ligusticum chuanxiong using a plant RNA extraction kit provided by OMEGA. The extracted total RNA was subjected to 1% agarose gel electrophoresis to determine its extraction amount and concentration. After reverse transcription into cDNA, the cDNA was used as a template to amplify the LASI gene, adding a KpnI restriction site. The amplification primers, system, and conditions are shown in Tables 1-3. The electrophoresis pattern is shown in Figure 1 .

[0062] Table 1 LASI gene PCR primers

[0063]

[0064] Table 2 LASI gene PCR reaction system

[0065]

[0066] Table 3 PCR reaction conditions for amplifying the LASI gene

[0067]

[0068]

[0069] Step 2: Construction of recombinant vector.

[0070] Step 2.1: Select pCambia2301 as the vector and use KpnI enzyme to linearize the vector. During the enzyme digestion reaction, add all components and mix gently, then centrifuge briefly. Incubate at 37°C for 30 minutes.

[0071] Table 4 Vector linearization reaction system

[0072]

[0073] Step 2.2: Recombinate the PCR product from step 1 with the linearized vector. Add the sample according to the reaction system in Table 5 and gently pipette to mix. Centrifuge briefly and incubate at 37°C for 30 minutes. Then immediately cool on ice.

[0074] Table 5 LASI gene recombination reaction system

[0075]

[0076] Step 2.3: Thaw 100 μL of E. coli DH5α competent cells on ice, slowly add 10 μL of the recombinant product, and incubate on ice for 30 minutes. Heat shock the cells at 42°C in a metal bath for 90 seconds, then incubate on ice for 2 minutes. Add 800 μL of LB liquid medium and culture on a shaker at 37°C for 45 minutes. Centrifuge at 5000 rpm for 3 minutes, discard 800 μL of the supernatant, and coat the remaining cells with 50 μg / mL kanamycin-resistant LB solid medium. Incubate the cells in an inverted manner at 37°C overnight.

[0077] Step 2.4: Pick resistant colonies for PCR positive detection. The PCR primers are shown in Table 6, which are primers for inserting the upstream promoter fragment of the target gene and the downstream amplification primers of the target gene. The PCR reaction system and conditions are shown in Tables 7 and 8. Then, the positive transformants were cultured and the plasmids were extracted and sent to Qingke Bio for sequencing. The plasmid map is shown in Figure 3 .

[0078] Table 6 PCR primers for LASI gene positive transformants

[0079]

[0080] Table 7 PCR reaction system of LASI gene positive transformants

[0081]

[0082] Table 8 PCR reaction conditions for LASI gene positive transformants

[0083]

[0084] Step 3: Obtain transgenic Arabidopsis plants.

[0085] Step 3.1: Transform the recombinant plasmid into Agrobacterium GV3101 competent cells using the heat shock method.

[0086] Take 200 μL of Agrobacterium GV3101 competent cells and melt them on ice. Slowly add 5 μL of recombinant plasmid and ice bath for 30 minutes; quick freeze in liquid nitrogen for 2 minutes, keep warm in a 37°C metal bath for 5 minutes, and then quickly ice bath for 5 minutes; add 800 μL of LB liquid medium and expand the culture in a shaker at 28°C and 180 rpm for 4 hours; centrifuge at 5000 rpm for 5 minutes, discard the supernatant, resuspend the precipitated bacteria, evenly spread them on LB solid medium (containing 50 μg / mL kanamycin and 50 μg / mL rifampicin), and invert and culture in a 28°C constant temperature incubator for 2 days; pick the monoclonal colonies on the plate for colony PCR verification and screening of positive clones, and store the positive recombinant Agrobacterium in a refrigerator at minus 80°C with 20% glycerol.

[0087] Step 3.2: Arabidopsis genetic transformation.

[0088] Wild-type Arabidopsis seeds were placed in EP tubes, sterilized with anhydrous ethanol for 30 seconds, 10% sodium hypochlorite for 4 minutes, and then washed three times with sterile ddH2O. The treated seeds were then placed on 1 / 2MS solid medium and cultured in the dark at 4°C for 3 days, followed by alternating culture with 16h (25°C) light / 8h (16°C) dark for 2 weeks; transferred to nutrient soil for culture and waited for inflorescence growth; positive Agrobacterium was cultured in LB liquid medium (containing 50μg / mL kanamycin and 50μg / mL rifampicin) at 28°C and 180rpm for 24h; centrifuged at 5000rpm for 15min, the supernatant was discarded, and the suspension was washed with 10mL of 10% sucrose and 0.025% Silwet Resuspend the bacteria in the infiltration solution of L-77; cut off the grown fruit pods of Arabidopsis thaliana and immerse the inflorescence in the infiltration solution for 30 seconds with slight shaking during the process; wrap the infected Arabidopsis thaliana with plastic wrap to maintain humidity, culture in a dark environment for 1 day, then return to normal conditions for culture. Remove the plastic wrap after 2 to 3 days and continue to culture until the plants are mature and harvested.

[0089] Step 3.3: Screening and identification of LASI transgenic positive seedlings.

[0090] The seeds were sown in 1 / 2MS medium containing 50 μg / mL kanamycin and cultured. After one week, the healthy positive seedlings were selected and transferred to nutrient soil for further culture (such as Figure 2 Three weeks later, genomic DNA was extracted from the plants. Because wild-type Arabidopsis thaliana does not contain the 35S promoter, PCR verification was performed using primers containing the upstream sequence of the 35S promoter and the downstream primers of the LASI gene. Successful amplification indicated a positive plant. Primer sequences, reaction components, and amplification conditions are the same as in Tables 6-8.

[0091] Step 4: Detection of Arabidopsis growth and development under drought and salt stress.

[0092] Wild-type and LASI transgenic Arabidopsis seeds were cultured in 1 / 2MS conventional culture medium. After two weeks, seedlings with similar growth characteristics were selected and transferred to nutrient soil, with four plants per pot. Each type was divided into three groups: no treatment, drought stress, and salt stress. The no-stress group was cultured normally, the drought stress group was not watered and allowed to dry naturally, and the salt stress group had its pots immersed in 1% NaCl solution for 10 minutes every week. After three weeks of drought and salt stress, the growth indicators of wild-type and LASI transgenic Arabidopsis were recorded, including leaf length, leaf number, leaf width, and fresh weight.

[0093] The leaf length statistics are as follows Figure 4 As shown, it can be seen that the leaf length of the LASI gene-transfected Arabidopsis thaliana under no stress is 1.22 times that of the wild type; the leaf length of the LASI gene-transfected Arabidopsis thaliana under salt stress is 1.25 times that of the wild type; and the leaf length of the LASI gene-transfected Arabidopsis thaliana under drought stress is 1.18 times that of the wild type.

[0094] The leaf count results are as follows Figure 5 As shown, it can be seen that the number of leaves of Arabidopsis thaliana with the LASI gene under no stress is 1.11 times that of the wild type; the number of leaves of Arabidopsis thaliana with the LASI gene under salt stress is 1.21 times that of the wild type; and the number of leaves of Arabidopsis thaliana with the LASI gene under drought stress is 1.11 times that of the wild type.

[0095] Leaf width statistics are as follows Figure 6 As shown, it can be seen that the leaf width of the LASI gene-transfected Arabidopsis thaliana under no stress is 1.54 times that of the wild type; under salt stress, the leaf width of the LASI gene-transfected Arabidopsis thaliana is 1.30 times that of the wild type; under drought stress, the leaf width of the LASI gene-transfected Arabidopsis thaliana is 1.25 times that of the wild type.

[0096] Fresh weight statistics results are as follows Figure 7 As shown, it can be seen that the fresh weight of Arabidopsis thaliana with the LASI gene is 1.42 times that of the wild type under no stress; the fresh weight of Arabidopsis thaliana with the LASI gene is 1.54 times that of the wild type under salt stress; and the fresh weight of Arabidopsis thaliana with the LASI gene is 1.27 times that of the wild type under drought stress.

[0097] In summary, it can be seen that under drought and salt stress, the growth indicators such as fresh weight, leaf number, leaf length, and leaf width of the LASI transgenic group are significantly better than those of the wild type, indicating that the LASI gene can effectively improve the drought and salt tolerance of Arabidopsis thaliana.

[0098] And biochemical indicators: SOD, POD, CAT, MDA, H2O2, ABA, α-amylase and subtilisin inhibitory activity.

[0099] (1) Statistical analysis of superoxide dismutase (SOD) activity

[0100] Accurately weigh 0.3 g of Arabidopsis leaves from the same part of each group, mince them, pour them into a homogenizer, add 1 mL of pre-chilled SOD extract, add a small amount of quartz sand, and grind on ice. Grind the tissue until homogenized and transfer it to a centrifuge tube. Rinse the homogenizer with 2 mL of pre-chilled SOD extract and pour it into the centrifuge tube to make a total volume of 3 mL. Centrifuge at 11,000 rpm at 4°C for 20 min, and save the supernatant for SOD activity detection. SOD activity was measured using the plant peroxidase (POD) detection kit (NBT) produced by Shanghai Yuanye Biotechnology Co., Ltd.

[0101] The statistical results are as follows Figure 8 As shown in the figure, under no stress, the SOD activity of transgenic Arabidopsis increased by 19%; under salt stress, the SOD activity of transgenic Arabidopsis increased by 19%; under drought stress, the SOD activity of transgenic Arabidopsis increased by 8%, indicating that the Chuanxiong LASI gene enhances the stress resistance of Arabidopsis.

[0102] (2) Statistical analysis of peroxidase (POD) activity

[0103] Weigh 0.3 g of Arabidopsis leaves from the same part of each group, mince them, add a small amount of quartz sand, and transfer them to a homogenizer. Add 1 mL of pre-chilled pH 7.0 phosphate buffer and grind on ice to homogenize. Transfer the extract to a centrifuge tube. Rinse the homogenizer with 2 mL of pre-chilled pH 7.0 phosphate buffer again, transfer the extract to a centrifuge tube, and bring the total extract volume to 3 mL. Centrifuge at 11,000 rpm for 20 min at 4°C. The supernatant is used for POD activity detection. POD activity is detected using the plant peroxidase (POD) detection kit (guaiacol microplate method) produced by Shanghai Yuanye Biotechnology Co., Ltd.

[0104] The statistical results are as follows Figure 9 As shown, it can be seen that the POD activity of transgenic Arabidopsis is not much different from that of unstressed Arabidopsis; under salt stress, the POD activity of transgenic Arabidopsis increases by 12%; under drought stress, the POD activity of transgenic Arabidopsis increases by 22%.

[0105] (3) Statistical analysis of catalase (CAT) activity

[0106] Accurately weigh 0.5 g of Arabidopsis leaves from the same part of each group, mince them, and pour them into a homogenizer. Add 1 mL of pre-chilled pH 7.0 sodium phosphate buffer. Transfer the extract to a centrifuge tube. Rinse the homogenizer with 2 mL of pre-chilled pH 7.0 phosphate buffer again, and transfer the extract to a centrifuge tube to a total volume of 3 mL. Centrifuge at 11,000 rpm at 4°C for 20 min. The supernatant was retained for CAT activity assay. CAT activity was assayed using the Plant Peroxidase (CAT) Detection Kit (Nitro Blue Tetrazolium Photoreduction Inhibition Method) manufactured by Shanghai Yuanye Biotechnology Co., Ltd.

[0107] The statistical results are as follows Figure 10 As shown, it can be seen that under no stress, the CAT activity of transgenic Arabidopsis thaliana increased by 95%; under salt stress, the CAT activity of transgenic Arabidopsis thaliana increased by 115%; under drought stress, the CAT activity of transgenic Arabidopsis thaliana increased by 89%.

[0108] (4) Statistical analysis of malondialdehyde (MDA) content

[0109] Weigh 0.2 g of fresh Arabidopsis leaves from each group and add 2 mL of tissue homogenate to thoroughly homogenize. Transfer to a centrifuge tube and centrifuge at 4000 g for 10 minutes. Save the supernatant for later use. MDA content in tissues was measured using a plant malondialdehyde (MDA) detection kit produced by Shanghai Yuanye Biotechnology Co., Ltd.

[0110] Malondialdehyde (MDA) was used as an indicator of membrane damage and lipid peroxidation during stress. Figure 11 As shown in the figure, after salt stress and drought stress treatment, the MDA content of the transgenic plants was significantly lower than that of the wild-type plants, indicating that the Chuanxiong LASI gene enhanced the ability of Arabidopsis thaliana to resist oxidative damage.

[0111] (5) Statistical analysis of H2O2 content

[0112] 2 g of fresh Arabidopsis leaf tissue from each group was minced and added with 2 mL of pre-chilled acetone. The homogenate was quickly ground using a homogenizer in an ice bath. The homogenate was centrifuged at 11,000 rpm for 20 minutes at 4°C, and the supernatant was collected for later use. A hydrogen peroxide (H2O2) detection kit produced by Shanghai Yuanye Biotechnology Co., Ltd. was used. The procedure was performed according to the kit's instructions.

[0113] Drought stress and salt stress usually lead to oxidative stress by producing reactive oxygen species (such as H2O2), which in turn leads to the activation of the antioxidant defense system. Figure 12 As shown in the results, the H2O2 content of WT Arabidopsis decreased by 12%, 17%, and 31% under no stress, salt stress, and drought stress, respectively. This suggests that the LASI gene in Chuanxiong can inhibit oxidative stress caused by adverse conditions by participating in the regulation of physiological and biochemical reactions, thereby enhancing the plant's ability to resist abiotic stress.

[0114] (6) Calculation of abscisic acid (ABA) content

[0115] 0.5 g of Arabidopsis leaves from the same part of each group were accurately weighed and ground with liquid nitrogen. The leaves were then extracted with 80% pre-cooled methanol for 16 h, centrifuged at 10,000 rpm at 4°C for 20 min, and the supernatant was collected. The precipitate was extracted with 80% methanol for 2 h, centrifuged at 10,000 rpm at 4°C for 20 min, and the supernatants were combined. Methanol was rotary evaporated at 42°C, and the aqueous phase was extracted three times with ethyl acetate. The ethyl acetate layer was collected. The solution was rotary evaporated at 42°C, dissolved in 0.8 mL of methanol, and filtered through a 0.45 μm filter membrane. ABA content was determined using an ELISA kit (ELISA) from Enzyme-Linked Biology.

[0116] ABA is a stress-responsive plant hormone that is not only involved in plant tolerance to environmental stress but also in plant development. Figure 15 As shown in the figure, under non-stress conditions, the ABA content in LASI transgenic plants was slightly higher than that in wild-type plants. Under salt stress, the ABA content in LASI transgenic plants was 1.09 times that of wild-type plants (p < 0.001), and under drought conditions, the ABA content in LASI transgenic plants was also 1.33 times that of wild-type plants (p < 0.0001). Therefore, these results indicate that overexpression of the LASI gene can promote ABA accumulation, thereby improving plant drought and salt tolerance.

[0117] (7) Statistics of α-amylase inhibitory activity

[0118] Weigh 0.2 g of fresh plant sample, add 2 mL of ddH2O, grind with liquid nitrogen, centrifuge at 8000 × g for 10 minutes, and collect the supernatant. The sample was diluted to a 1 mg / mL protein concentration and reacted with α-amylase solution (0.5 U / mL) at 37°C for 10 minutes. DNS reagent was added for color development and the absorbance at 540 nm was measured. The supernatant was inactivated by incubating in a 70°C water bath for 15 minutes to inactivate β-amylase. Activity was then determined using the α-amylase (α-AMS) assay kit (DNS) produced by Shanghai Yuanye Biotechnology Co., Ltd.

[0119] The statistical results are as follows Figure 13 As shown, it can be seen that after treatment under three conditions of no stress, salt stress, and drought stress, the inhibitory activity of LASI-transgenic Arabidopsis on α-amylase significantly increased by 3.28 times, 3.55 times, and 12.82 times compared with the wild type.

[0120] (8) Statistics of subtilisin inhibitory activity

[0121] A 1 mg / mL subtilisin solution was mixed with an equal amount of plant extract and preincubated at 37°C for 10 minutes. Then, 1 mg / mL BSA substrate was added and reacted for 30 minutes. The reaction was terminated with TCA and centrifuged. The supernatant was collected and the amount of tyrosine released was measured at 562 nm. Subtilisin inhibitory activity was determined using the BCA protein concentration assay kit (Folin-phenol) produced by Anhui Biolab Biotechnology Co., Ltd.

[0122] The statistical results are as follows Figure 14 As shown, it can be seen that after treatment with no stress, salt stress, and drought stress, the inhibitory activity of LASI-transgenic Arabidopsis on subtilisin increased by 6%, 24%, and 68% compared with WT.

[0123] In summary, it can be seen that under drought and salt stress, the biochemical indicators of the LASI transgenic group, such as SOD, POD, CAT, MDA, H2O2, ABA, α-amylase and subtilisin inhibitory activity, are significantly better than those of the wild type, indicating that the LASI gene can effectively improve the drought and salt tolerance of Arabidopsis thaliana.

[0124] Finally, it should be noted that the above specific implementation methods are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. An α-amylase / subtilisin inhibitor LASI gene, characterized in that: Application in improving crop drought and salt tolerance: Transgenic Arabidopsis plants were obtained through genetic engineering and transgenic identification methods. The drought and salt tolerance of transgenic and wild-type Arabidopsis was analyzed through growth and biochemical indicators. Transgenic Arabidopsis with the LASI gene was successfully obtained, which provides a new gene source for cultivating crops with stronger drought and salt tolerance using genetic engineering technology. The specific steps include: Step 1: Obtaining the LASI gene of Chuanxiong; Total DNA from the rhizomes of Chuanxiong was extracted using a plant RNA extraction kit provided by OMEGA. The extracted total RNA was subjected to 1% agarose gel electrophoresis to determine its extraction quantity and concentration. After reverse transcription into cDNA, the cDNA was used as a template to amplify the LASI gene, which contained a KpnI restriction site. Step 2: Construction of recombinant vector; Step 2.1: Select pCambia2301 as the vector and linearize it with KpnI enzyme. During the enzyme digestion reaction, add all components, mix gently, and then centrifuge briefly. Incubate at 37°C for 30 minutes. Step 2.2: Recombinate the PCR product from step 1 with the linearized vector. Gently pipette to mix thoroughly, centrifuge briefly, and incubate at 37°C for 30 minutes. Immediately cool on ice. Step 2.3: Thaw 100 μL of E. coli DH5α competent cells on ice, slowly add 10 μL of the recombinant product, and incubate on ice for 30 minutes. Heat shock the cells in a metal bath at 42°C for 90 seconds, then incubate on ice for 2 minutes. Add 800 μL of LB liquid medium and culture on a shaker at 37°C for 45 minutes. Centrifuge at 5000 rpm for 3 minutes, discard 800 μL of the supernatant, and spread the remaining supernatant on 50 μg / mL kanamycin-resistant LB solid medium. Incubate the cells in an inverted manner at 37°C overnight. Step 2.4: Pick resistant colonies for PCR positive detection, insert the upstream promoter fragment of the target gene and the downstream amplification primers of the target gene respectively. After the PCR reaction, culture the positive transformants to extract the plasmid and send them to Qingke Bio for sequencing; Step 3: Obtain transgenic Arabidopsis plants; Step 3.1: Transform the recombinant plasmid into Agrobacterium GV3101 competent cells using the heat shock method; Thaw 200 μL of Agrobacterium GV3101 competent cells on ice, slowly add 5 μL of recombinant plasmid, and place on ice for 30 minutes; quickly freeze in liquid nitrogen for 2 minutes, incubate in a 37°C metal bath for 5 minutes, and then quickly place on ice for 5 minutes; add 800 μL of LB liquid medium and expand the culture in a shaker at 28°C and 180 rpm for 4 hours; centrifuge at 5000 rpm for 5 minutes, discard the supernatant, resuspend the pellet, evenly spread it on LB solid medium, and incubate inverted at 28°C in a constant temperature incubator for 2 days; pick single clones on the plate for colony PCR verification and screening of positive clones, and store the positive recombinant Agrobacterium in a -80°C refrigerator with 20% glycerol; Step 3.2: Arabidopsis genetic transformation; Wild-type Arabidopsis seeds were placed in EP tubes, sterilized with anhydrous ethanol for 30 seconds, 10% sodium hypochlorite for 4 minutes, and then washed three times with sterile ddH2O. The treated seeds were then placed on 1 / 2MS solid culture medium and cultured in the dark at 4°C for 3 days, followed by culturing under alternating conditions of 16 hours of light and 8 hours of darkness for 2 weeks. The seeds were then transferred to nutrient soil for culture and allowed to grow inflorescences. Positive Agrobacterium was cultured in LB liquid medium at 28°C and 180 rpm for 24 hours. The culture was centrifuged at 5000 rpm for 15 minutes, the supernatant was discarded, and the bacteria were resuspended in 10 mL of infiltration solution containing 10% sucrose and 0.025% Silwet L-77. The grown fruit pods of the Arabidopsis were cut off, and the inflorescences were immersed in the infiltration solution for 30 seconds with slight shaking during the process. The infected Arabidopsis were wrapped with plastic wrap to maintain humidity, cultured in a dark environment for 1 day, and then cultured under normal conditions. The plastic wrap was removed after 2 to 3 days, and the culture was continued until the plants matured and harvested. Step 3.3: Screening and identification of LASI transgenic positive seedlings; Seeds were sown and cultured in 1 / 2 MS medium containing 50 μg / mL kanamycin. After one week, healthy positive seedlings were selected and transferred to nutrient soil for further culture. Three weeks later, plant genomic DNA was extracted. Because wild-type Arabidopsis does not contain the 35s promoter, PCR verification was performed using primers containing the upstream sequence of the 35s promoter and the downstream primers of the LASI gene. If amplification was successful, the plant was positive. Step 4: Detection of Arabidopsis growth and development under drought and salt stress; Wild-type and LASI transgenic Arabidopsis seeds were cultured in 1 / 2MS conventional culture medium. After two weeks, seedlings with similar growth characteristics were selected and transferred to nutrient soil, with four plants per pot. Each type was divided into three groups: no treatment group, drought stress group, and salt stress group. The no-stress group was cultured normally, the drought stress group was not watered and allowed to dry naturally, and the salt stress group had its roots immersed in 1% NaCl solution for 10 minutes every week. After three weeks of drought and salt stress, the growth indicators of wild-type and LASI transgenic Arabidopsis, including fresh weight, number of leaves, leaf length, and leaf width, as well as biochemical indicators including SOD, POD, CAT, MDA, H2O2, ABA, α-amylase, and subtilisin inhibitory activity, were recorded.

2. The α-amylase / subtilisin inhibitor LASI gene according to claim 1, characterized in that The nucleotide sequence of the α-amylase / subtilisin inhibitor LASI gene is shown in SEQ ID NO.

1.

3. An engineered bacterium, characterized in that: The engineered bacteria comprises the gene according to claim 2.

4. A plasmid, characterized in that The plasmid comprises the gene according to claim 2.

5. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the gene according to claim 2.

6. A preparation for improving drought resistance and salt tolerance of crops, characterized in that: The preparation contains the Chuanxiong α-amylase / subtilisin inhibitor LASI, or an active ingredient that promotes the expression of the Chuanxiong α-amylase / subtilisin inhibitor LASI gene as an effective ingredient.

7. The preparation according to claim 6, characterized in that The active ingredient is a small molecule compound, shRNA, gRNA or a short peptide.

Images