Application of pepper miR167b gene in regulation and control of plant growth and development

Abstract

The invention discloses application of a pepper miR167b gene in regulation and control of plant growth and development, and belongs to the technical field of gene engineering. An expression vector of the miR167b gene is constructed and is overexpressed in tomatoes, and the results show that the miR167b overexpressed plant is dwarfed, the fruit shape is changed, the fruit size and weight are obviously lower than those of a wild type, the fruit setting rate is high, the fruit is seedless, the number of fruit ventricles is reduced, ovules are aborted, and no embryo sac is formed in the tomato. Further analysis finds that the content of indolebutyric acid in overexpressed plant fruits is increased, which indicates that the miR167b gene can induce apomixis of fruits by regulating auxin, lays a foundation for revealing a pepper apomixis mechanism, provides gene resources and basis for improving a woody plant breeding strategy, and has important theoretical value and application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to Zanthoxylum bungeanum miR167b The application of genes in regulating plant growth and development. Background Art

[0002] Sichuan peppercorn( Zanthoxylum ) is a shrub or small tree of the genus Zanthoxylum in the Rutaceae family. It is a special economic tree species with important economic and ecological value in my country. However, Zanthoxylum bungeanum is a pure female plant with the characteristic of apomixis. This characteristic makes it impossible to genetically improve it through traditional sexual hybridization breeding, which seriously restricts the breeding process and variety optimization. Although apomixis, as a form of asexual reproduction, helps to maintain genetic stability, it limits the introduction of genetic diversity and the integration of excellent traits in breeding. At present, the molecular mechanism of apomixis of Zanthoxylum bungeanum has not been clarified, and there is a lack of effective technical means to overcome its breeding barriers. In addition, traditional breeding methods are not only costly, but also difficult to guarantee the effect, and there are many uncertainties, which leads to severe challenges for the sustainable development of the industry. Summary of the Invention

[0003] The technical problem to be solved by the present invention is: to provide Zanthoxylum bungeanum miR167b The application of genes in regulating plant growth and development can solve the technical problems of low efficiency and long cycle of traditional breeding methods.

[0004] To achieve the above object, the technical solution adopted by the present invention is: providing Zanthoxylum bungeanum miR167b The application of genes in regulating plant growth and development, miR167b The nucleotide sequence of the precursor is shown in SEQ ID NO:1.

[0005] On the basis of the above technical solution, the present invention can also be improved as follows: Further application is: through overexpression miR167b Genes to regulate plant growth and development.

[0006] Furthermore, by overexpression miR167b Genes to achieve the regulation of plant floral organs and fruits.

[0007] Furthermore, the growth and development are as follows: plant height decreases, fruit shape changes, fruit size and weight decrease, fruit setting rate is high, the fruit is seedless, the number of ventricles in the fruit is reduced, and ovules are aborted.

[0008] Furthermore, the plant is a dicotyledonous plant.

[0009] Furthermore, the plant is a tomato.

[0010] The present invention also discloses a method comprising miR167b Gene overexpression vector.

[0011] The present invention also discloses a method comprising miR167b Preparations for regulating plant growth and development of genes or overexpression vectors.

[0012] The beneficial effects of the present invention are as follows: miR167b The gene expression vector was used to overexpress it in tomatoes and it was found miR167b The overexpression plants were dwarfed, the fruit shape was changed, the fruit size and weight were significantly lower than the wild type, the fruit setting rate was high, the fruit was seedless, the number of ventricles in the fruit was reduced, the ovules were aborted, and no embryo sac was formed inside. Further analysis found that the indolebutyric acid content in the fruits of the overexpression plants was increased, indicating that miR167b The gene can induce fruit apomixis by regulating auxin, laying the foundation for revealing the mechanism of apomixis in Zanthoxylum bungeanum, and also providing genetic resources and basis for improving woody plant breeding strategies. It has important theoretical value and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a morphological observation of the male and female flowers of Zanthoxylum bungeanum at different developmental stages; Figure 2 for miR167b expression levels in female and male flowers of Zanthoxylum bungeanum at different developmental stages; Figure 3 for miR167b Differentiation culture of transgenic plants; Figure 4 for miR167b Rooting culture of transgenic plants; Figure 5 for miR167b Positive identification results of transgenic plants; Figure 6 for miR167b Physical transgenic and wild-type tomato plants; Figure 7 for miR167b Plant height statistics of transgenic and wild-type tomatoes; Figure 8 For wild type and miR167b Phenotypic observation of gene overexpression tomato fruit; Figure 9 For wild type and miR167b Longitudinal diameter analysis of gene overexpression tomato fruits; Figure 10 For wild type and miR167b Diameter analysis of gene-overexpressing tomato fruits; Figure 11 For wild type and miR167b Gravimetric analysis of gene-overexpressing tomato fruits; Figure 12 For wild type and miR167b Cross-section of a gene-overexpressing tomato fruit; Figure 13 For wild type and miR167b Counting the number of seeds in gene-overexpressing tomato fruits; Figure 14 Wild type and miR167b Comparison of transgenic tomato fruit slices; Figure (A) shows the internal structure of wild-type tomato (WT) fruit, and Figure (B) shows the internal structure of wild-type tomato (WT) fruit. miR167b Genetically modified tomatoes ( miR167b -OX1) Internal structure of the fruit; Figure 15 for miR167b Comparison of IAA content in transgenic and wild-type tomato fruits; Figure 16 for miR167b Comparison of IBA content in transgenic and wild-type tomato fruits; Figure 17 for miR167b Comparison of TRP content in transgenic and wild-type tomato fruits; Figure 18 for miR167b Comparison of indole content in transgenic and wild-type tomato fruits. DETAILED DESCRIPTION

[0014] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. In the examples, where specific conditions are not specified, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments used where the manufacturer is not specified are conventional products that can be purchased commercially. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. It is obvious to those skilled in the art that various modifications are within the spirit and scope of the present invention as defined and determined by the appended claims, and all inventions and creations utilizing the present invention are protected.

[0015] miR167b The nucleotide sequence of the precursor is as follows: ATTCGTGCACTAGTAGTAGTTGAAGCTGCCAGCATGATCTGAACTTTCCTTGACCTCCATCTCTAGGGAAAGGCCAGATCATCTGGCAGTTTCACCTATTGATGGTAGCATGGCCAGAAACCCTAATTTCTTTCCTCCACCAGATCGTTCTCAACAAACCCAGTAGGTTTTGGCAGATGAAAAACCCTAGAAACAGGTATC (SEQ ID NO: 1).

[0016] Example 1 Construction of overexpression vector Build contains miR167b The recombinant expression vector is transformed into a microbial transformant to prepare an engineered bacterium (Agrobacterium tumefaciens GV3101); specifically: (1) Designed miRNA167b precursor amplification primers SEQ-F and SEQ-R, and amplified them from Zanthoxylum bungeanum DNA using PCR. miR167b Precursor sequence; the nucleotide sequences of amplification primers SEQ-F and SEQ-R are as follows: SEQ-F: AGAATTCGAGCTCGGTACCCATTCGTGCACTAGTAGTAGTTG (SEQ ID NO: 2); SEQ-R: GTCGACTCTAGAGGATCCCCGATACCTGTTTCTAGGGTTTTTCA (SEQ ID NO: 3); (2) When the band size is confirmed to be consistent with the expected size by gel electrophoresis, the PCR product is recovered by cutting the gel. At the same time, the BGPlant-Express MCS vector plasmid is extracted and digested with Sma I. The reaction is carried out at 37°C and 65°C for 5 minutes and 10 minutes respectively. Then, the target fragment is recovered by gel electrophoresis and diluted 3-5 times before direct use. miR167b The precursor was connected to the vector BG Plant-Express MCS recovered by enzyme digestion, reacted at 50℃ for 15-60min, and then transformed into E. coli TransT1 competent cells, plated, and single clones were selected for colony PCR verification. After verification, the single clones were sent to the company for sequencing verification. Only after the sequencing was correct could the strain be identified as a positive strain, indicating that the overexpression vector BG- miR167b .

[0017] (3) Shake the positive strain, extract the plasmid, and then transfer the BG- miR167bThe plasmid was transformed into Agrobacterium tumefaciens GV3101, and single clones were screened and selected on a plate containing 100 μg / mL kanamycin and 50 μg / mL rifampicin for colony PCR verification. The strains that passed the verification were the engineered bacteria of the recombinant expression vector.

[0018] Figure 1 This is a morphological observation of female and male flowers of Zanthoxylum bungeanum at different developmental stages; FFS1 represents the period of female flower primordium formation, FFS2 represents the period of female flower growth and differentiation, MFS1 represents the period of male flower primordium formation, MFS2 represents the period of male flower growth and differentiation, and MFS3 represents the period of male flower organ formation; Figure 1 It can be seen that the female flowers are composed of only two rounds of floral organs: pistils and sepals; the male flowers are composed of only male flowers and sepals.

[0019] Figure 2 for miR167b The expression levels of Zanthoxylum bungeanum in female and male flowers at different developmental stages were determined by Figure 2 It can be seen that miR167b There are significant differences in expression between male and female flowers; as female flowers develop, miR167b The expression of miR167b Expression showed an upward trend.

[0020] Example 2 Obtaining transgenic plants Will contain BG- miR167b Agrobacterium containing the recombinant plasmid BG-miRNA167b was then transferred into Micro-Tom tomatoes. Tomato explants were transformed using the leaf disc method, co-cultivated, and induced to germinate and root. The specific steps are as follows: (1) Seed sterilization and sowing Place an appropriate amount of wild-type tomato seeds in a sterile tissue culture flask. Disinfect with 75% anhydrous ethanol for 30 seconds, rinse three times with sterile water, then disinfect with 1.5% sodium hypochlorite solution for 15 minutes and rinse five times with sterile water. Place the flask in a shaker until the seeds germinate. Finally, spread the germinated seeds evenly on pre-prepared MS solid medium and culture in a lighted incubator.

[0021] (2) Explant cutting After about 14-20 days, when the first pair of true leaves grow to about 2-5 mm, cut the cotyledons and hypocotyls into segments and place them in the pre-culture medium in the dark for one day.

[0022] (3) Activation and infection of Agrobacterium Add 50-60 μL of pre-stored Agrobacterium tumefaciens glycerol solution to 20 mL of LB liquid medium containing antibiotics (20 μL Kan and 20 μL Rif), and then culture in a 28°C constant temperature shaker at 200 rpm for 1-2 days. 600 = around 1.0, secondary activation to OD 600 = 0.8, remove the bacterial solution, centrifuge at 6000 rpm for 10 minutes, and collect the bacteria. Then resuspend the bacterial solution in KCMS liquid medium to OD 600 =0.1, and finally, the explants pre-cultured for one day were soaked in the diluted Agrobacterium solution for 20 minutes, the solution was aspirated with filter paper, and then the explants were transferred to the co-culture medium to co-culture the Agrobacterium and explants for 2 days.

[0023] (4) Differentiation culture and rooting culture The explants after co-culture were transferred to differentiation medium and cultured in a light incubator. The differentiation medium was replaced every half month. Figure 3 As shown. The adventitious buds to be differentiated form seedlings, which are then cut and transferred to the rooting medium. Figure 4 ) can be transferred to the smart greenhouse for seedling hardening and soil cultivation. The conditions are: day and night lengths are 16 hours and 8 hours respectively, the day and night temperature is 22°C, and the light intensity is 250μ mol·m -2 ·s -1 , relative humidity is 80%, water on time and irrigate with nutrient solution regularly.

[0024] PCR identification was performed on the positive seedlings, and the identification results were as follows: Figure 5 As shown in Figure 2, the band sizes are all around 200 bp, which is consistent with the size of miRNA167b precursor, indicating that the obtained plants are positive plants, i.e. miR167b Transgenic lines.

[0025] Example 3 Overexpression miR167b Phenotypic characterization of transgenic plants 1. Identification of positive plant phenotypes The wild-type plants and the four obtained plants were observed using a Cannon EOS 5D Mark digital camera (Tokyo, Japan). miR167b Transgenic plants ( miR167b -OX1, miR167b -OX2, miR167b -OX3 and miR167b -OX4) morphological characteristics, and recorded wild type and miR167b The height of transgenic plants was observed. miR167b Fruit morphological characteristics of transgenic plants were recorded, and wild-type tomato plants and miR167bThe longitudinal and transverse dimensions and weight of fruits from transgenic tomato plants.

[0026] (1) miR167b Overexpression affects tomato plant height like Figure 6 and Figure 7 As shown, miR167b Overexpression of α-terminal β ... miR167b The average height of transgenic plants was 6.75+1.15 cm, which was only about 1 / 3 of that of normal plants (WT).

[0027] (2) miR167b Overexpression affects tomato fruit morphology like Figures 8-11 As shown, m iR167b Overexpression of α-lactamase caused the tomato fruit to change in shape, and the fruit's longitudinal and transverse diameters and weight were significantly lower than those of the wild type (WT). Further observations revealed that the fruits of the wild type tomato plants could produce seeds normally. miR167b The genetically modified plants have seedless fruits ( Figure 12 ), the fruit setting rate increased significantly ( Figure 13 ).

[0028] 2. Analysis of the anatomical structure of transgenic fruits Fixed miR167b Genetically modified tomatoes ( miR167b -OX1) and wild-type tomato fruit samples (WT) were sequentially placed in environmentally friendly dewaxing and clearing solution I for 20 minutes, environmentally friendly dewaxing and clearing solution II for 20 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, and 75% ethanol for 5 minutes, followed by a final rinse with tap water. The washed samples were then stained in safranin solution for 2 hours, and excess dye was removed with tap water. The samples were then decolorized by immersion in 50%, 70%, and 80% ethanol in a gradient of 3-8 seconds. The samples were then stained with 1% Fast Green solution for 6-20 seconds, dehydrated in three cylinders of anhydrous ethanol, sectioned, and cleared in xylene for 5 minutes. The slides were then mounted with neutral gum. Finally, the samples were examined under an optical microscope, photographed, and imaged.

[0029] Figure 14 for miR167b Comparison of fruit sections of transgenic and wild-type tomato plants. The letter C indicates the placenta, the letter D indicates the septum, the letter V indicates the ventricle, the letter Es indicates the embryo sac, the letter Ov indicates the ovule, and the letter AOv indicates an aborted ovule. As can be seen from the figure, the fruit of the WT plant is normally developed, containing the ventricle, placenta, and ovule ( Figure 14 A); and miR167bThe number of ventricles in the fruit of the overexpressing plants decreased, the ovules were aborted, and the fruit shape changed more obviously. The tissue cells at the junction of the septum and the pericarp became denser, and the septum was significantly thickened ( Figure 14 B).

[0030] 3. Detection of plant hormone content in transgenic plants The wild-type and miR167b Transgenic plants ( miR167b -OX1) fruit plant hormone content, wild type and miR167b There were 3 replicates in each group of transgenic plant fruit samples.

[0031] Compared with the wild type, miR167b The indole-3-acetic acid (IAA) content in the tomato fruits of the transgenic plants decreased significantly, while the indole-3-butyric acid (IBA), L-tryptophan (TRP) and indole contents increased significantly ( Figures 15-18 ),show miR167b Apomixis is regulated by affecting auxin content.

Claims

1. Sichuan peppercorns miR167b The application of genes in regulating plant growth and development is characterized in that, miR167b The nucleotide sequence of the precursor is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that The application is: through overexpression miR167b Genes to regulate plant growth and development.

3. The use according to claim 2, characterized in that Through overexpression miR167b Genes to achieve the regulation of plant floral organs and fruits.

4. The use according to claim 1 or 2, characterized in that The growth and development are as follows: plant height decreases, fruit shape changes, fruit size and weight decrease, fruit setting rate is high, the fruit is seedless, the number of ventricles in the fruit is reduced, and ovules are aborted.

5. The use according to claim 4, characterized in that The plant is a dicotyledonous plant.

6. An overexpression vector, characterized in that Containing the claim 1 miR167b Gene.

7. A preparation for regulating plant growth and development, characterized in that: Containing the claim 1 miR167b The gene or the overexpression vector according to claim 6.

Images