Molecular marker Marker 2937 related to fruit hardness of sweet cherries and application of molecular marker Marker 2937

Abstract

The invention relates to a molecular marker Marker 2937 related to the fruit hardness of sweet cherries and application of the molecular marker Marker 2937. The amplification result of the three KSASP primers designed by the invention is that the 16080735bp position of the chromosome 4 of the sweet cherry genome is an SNP site, the genotype of the SNP site is defined as T / T in a hard fruit material, and the genotype of the SNP site is defined as A / A in a soft fruit material. The amplification effect can obviously and effectively distinguish the genotype of the SNP site in the sweet cherry fruit, the nucleotide mutation site can be rapidly and accurately detected, and an accurate, rapid and effective method is provided for breeding of a hard sweet cherry variety. The development of the KASP marker can improve the identification and screening of fruit hardness genotypes of filial generations of different sweet cherry varieties, a phenotype identification method is not adopted, the breeding efficiency can be obviously improved, and the breeding cost is saved.

Description

Technical Field

[0001] The present invention relates to the fields of sweet cherry breeding and molecular biology, and in particular to a molecular marker of a fruit firmness-related gene and its application. Background Art

[0002] Sweet cherry (Prunus avium L.) is a drupe in the genus Prunus, subgenus Cerasus, of the Rosaceae family (Sun Yugang et al. (2018) World Sweet Cherry Breeding Achievements and Main Varieties. Deciduous Fruit Trees 50:5-10; Li Mingli et al. (2019) Current Status and Development Suggestions for the Sweet Cherry Industry in Shandong Province. Deciduous Fruit Trees 51:7-25). Sweet cherry originated in the Black Sea region and gradually spread to Europe and Asia in the 20th century (El Baji M et al. (2021) Morphological and pomological characteristics of sweet cherry (Prunus avium L.) grown in-situ under the south mediterranean climate in Morocco. Scientia Horticulturae 21:52-65). Sweet cherry cultivation in my country is primarily concentrated in Shandong, Liaoning, Beijing, Hebei, and Shaanxi provinces, with a production of approximately 1.2 million tons, making China a leading producer worldwide (Liu Qingzhong et al. (2022) Current Status and Development Prospects of the Sweet Cherry Industry in Shandong Province. Deciduous Fruit Trees 54:1-4). Sweet cherries are brightly colored and rich in nutrients, including antioxidants, phenolics, cellulose, vitamins, and minerals. They are beneficial for cardiovascular and cerebrovascular diseases, possessing significant economic value and are highly favored by consumers (Kelley DS et al. (2018) A Review of the Health Benefits of Cherries. 10:368). Fruit firmness is affected by a variety of factors, including changes in fruit cuticle thickness and cuticle wax composition, changes in pulp cell wall composition and content, changes in fruit vascular composition and content, and changes in fruit cell wall (cellulose, hemicellulose, pectin, and lignin) content (Liu Gangshuai et al. (2021) Advances in Fruit Cuticle Research. 21:374-385; Gong Yihui et al. (2020) Advances in Research on the Relationship between Peel Wax and Fruit Storage. Packaging Engineering 41:23-28; Liu X et al. (2021) Study on cell wall composition, fruit quality, and tissue structure of hardened 'Suli' pears (Pyrus bretschneideri Rehd). J Plant Growth Regul 40:2007-2016.). Excessive softening of fruit can affect the transportation and storage of the fruit, seriously affecting the economic benefits of fruit farmers.Given the importance of sweet cherry fruit, it has been used as an important selection indicator in breeding practice.

[0003] At present, with the development of sequencing technology, sequencing cost is constantly reduced, and more and more plant genomes are analyzed. Single nucleotide polymorphism (SNP) is the largest and most widely distributed molecular marker in plant genomes. By screening effective molecular markers for new variety breeding, it helps to break genetic linkage and improve breeding efficiency. Association analysis, also known as linkage disequilibrium mapping, is an analytical method for identifying the relationship between target traits and molecular markers based on linkage disequilibrium (Flint-Garcia SA, Thornsberry JM, Buckler IV ES (2003) Structure of linkage disequilibrium in plants. Annual review of plant biology 54: 357-374). However, due to the influence of its statistical method and population structure, there is often a false positive problem. Linkage analysis can complement association analysis, so combining association and linkage analysis can quickly and accurately identify genetic loci controlling target traits (Korte, A. and Farlow, A. (2013) The advantages and limitations of trait analysis with GWAS: a review. Plant Methods, 9:29.). Currently, my country lacks sweet cherry germplasm resources and has a limited number of hard-fleshed sweet cherry varieties. Developing more molecular markers that can facilitate resource screening and identification and assist in breeding is of strategic importance for cultivating hard-fleshed sweet cherry varieties in my country. Summary of the Invention

[0004] One of the objectives of the present invention is to develop a molecular marker associated with sweet cherry fruit firmness.

[0005] Another objective of this study was to provide applications of molecular markers associated with sweet cherry fruit firmness.

[0006] Also provided are primers for amplifying the molecular marker.

[0007] Primers were used to amplify molecular markers related to sweet cherry fruit firmness, where the related gene is located on chromosome 4 in the sweet cherry genome (Prunus avium Tieton Genome v2.0;

[0008] The target site was 16080735 bp on chromosome 4 and the fragments of 50-150 bp before and after it, and specific primers for PCR amplification were designed.

[0009] The target is located in the sweet cherry genome (Prunus avium Tieton Genome v2.0;

[0010] https: / / www.rosaceae.org / Analysis / 9262820) at position 16,080,735 bp on chromosome 4 and the 100 bp fragments before and after.

[0011] The primers are three specific KASP primers, and their sequences are as follows:

[0012] Upstream primer 1: 5'- GAAGGTCGGAGTCAACGGATT CAGATTTCAAGAACCCAGCAAA-3'

[0013] Upstream primer 2: 5'- GAAGGTGACCAAGTTCATGCT CAGATTTCAAGAACCCAGCAAT-3'

[0014] Downstream primer: 5'-CTCCCACCACTGGCATAGC-3'

[0015] Different fluorescent labels are added to the 5' ends of upstream primer 1 and upstream primer 2 respectively.

[0016] The three specific KASP primers are:

[0017] CR2937-F1:5'- GAAGGTCGGAGTCAACGGATT CAGATTTCAAGAACCCAGCAAA-3'(SEQ IDNO.1)CR2937-F2:5'- GAAGGTGACCAAGTTCATGCT CAGATTTCAAGAACCCAGCAAT-3' (SEQ ID NO. 2) CR2937-R: 5'-CTCCCACCACTGGCATAGC-3' (SEQ ID NO. 3).

[0018] A molecular marker associated with sweet cherry fruit firmness, Marker 2937, is located at a single nucleotide polymorphism (SNP) at position 16,080,735 bp on chromosome 4 of the sweet cherry genome (Prunusavium Tieton Genome v2.0; https: / / www.rosaceae.org / Analysis / 9262820). The genotype of the SNP at this SNP is defined as T / T in hard-fruit materials and A / A in soft-fruit materials.

[0019] The genotype of the SNP site was obtained by PCR amplification using sweet cherry genomic DNA as a template using KASP primers. The sequences of the KASP primers are as follows:

[0020] CR2937-F1:5'- GAAGGTCGGAGTCAACGGATT CAGATTTCAAGAACCCAGCAAA-3'(SEQ IDNO.1)

[0021] CR2937-F2:5'- GAAGGTGACCAAGTTCATGCT CAGATTTCAAGAACCCAGCAAT-3'(SEQ IDNO.2)

[0022] CR2937-R: 5'-CTCCCACCACTGGCATAGC-3' (SEQ ID NO. 3).

[0023] The primers and the molecular markers are used in screening or identifying the firmness of sweet cherry fruits.

[0024] Using any of the primers, the genotype of the SNP site is obtained by PCR amplification with sweet cherry genomic DNA as a template. The genotype is T / T in hard fruit materials and A / A in soft fruit materials.

[0025] The primer is a KASP primer, and its sequence is as follows:

[0026] CR2937-F1:5'- GAAGGTCGGAGTCAACGGATT CAGATTTCAAGAACCCAGCAAA-3'(SEQ IDNO.1)

[0027] CR2937-F2:5'- GAAGGTGACCAAGTTCATGCT CAGATTTCAAGAACCCAGCAAT-3'(SEQ IDNO.2)

[0028] CR2937-R: 5'-CTCCCACCACTGGCATAGC-3' (SEQ ID NO. 3).

[0029] KASP primers were used to amplify Marker 2937, a molecular marker associated with sweet cherry fruit firmness, along with two upstream genotyping primers (targeting the two mutant bases, A and T, of the SNP at bp 16,080, and 735, on chromosome 4) and a downstream universal primer. The upstream genotyping primers for Marker 2937 are SEQ ID NOs. 1 and 2, and the downstream universal primer is SEQ ID NO. 3.

[0030] A molecular marker related to sweet cherry fruit firmness, wherein the related gene is located on chromosome 4, the molecular marker linked to the gene is Marker 2937, and the molecular marker is obtained by amplification of the above primer pair.

[0031] A molecular marker associated with sweet cherry fruit firmness is described. The molecular marker uses a primer pair, sweet cherry genomic DNA as a template, and single-nucleotide polymorphism (SNP) sites identified by genotyping using KASP marker detection. The upstream primers contain a universal adapter sequence, an amplification primer, and a key genotyping site. The 3' ends of the upstream primers (F1 and F2) are complementary to two bases of the SNP, respectively, and the 5' ends are supplemented with universal fluorescent adapter sequences (VIC: GAAGGTCGGAGTCAACGGATT) and FAM: GAAGGTGACCAAGTTCATGCT).

[0032] The genotype of hard-fruited sweet cherries is T, and the genotype of soft-fruited sweet cherries is A. The primer pair sequences are as follows:

[0033] CR2937-F1:5'- GAAGGTCGGAGTCAACGGATT CAGATTTCAAGAACCCAGCAAA-3'(SEQ IDNO.1)

[0034] CR2937-F2:5'- GAAGGTGACCAAGTTCATGCT CAGATTTCAAGAACCCAGCAAT-3'(SEQ IDNO.2)

[0035] CR2937-R:5'-CTCCCACCACTGGCATAGC-3'(SEQ ID NO.3)

[0036] The primer pairs for obtaining the molecular marker related to sweet cherry fruit firmness are also within the scope of protection of the present invention. As long as the primers are designed for targets about 50-100 bp above or below the molecular marker position, they can also be conventional primers instead of KASP primers.

[0037] The primer powder was diluted to 100 μL / mL, and the primers CR2937-F1, CR2937-F2, and CR2937-R were diluted with water at a ratio of 24:24:48:100.

[0038] The present invention also provides the application of the above-mentioned detection primer in sweet cherries, which includes the detection of soft and hard sweet cherry varieties and the detection of natural sweet cherry varieties, providing assistance for subsequent breeding.

[0039] The present invention also provides a method for detecting the firmness of sweet cherry fruit, comprising the following steps:

[0040] S1. Extract genomic DNA from the sweet cherry fruit to be tested, 20 ng / μL;

[0041] S2. Perform PCR amplification using the detection primers shown in SEQ ID NOs: 1-3, detect the fluorescent signal during amplification, and determine the fruit firmness genotype based on the fluorescent signal.

[0042] Furthermore, the PCR amplification reaction system is 5 μL, containing 2 μL genomic DNA, 2 μL 2×Taq DNA Polymerase Mix, and 1 μL SNP Primer Mix (4×); the Primer Mix contains CR2937-F1, CR2937-F2, CR2937-R, and ddH2O, wherein CR2937-F1, CR2937-F2, CR2937-R, and ddH2O are mixed at a ratio of 24:24:48:100.

[0043] The first step consisted of one cycle of pre-denaturation (94°C) for 10 min. The second step consisted of 10 cycles of denaturation (94°C) for 20 s and annealing / extension (61°C-55°C) for 45 s, with the temperature decreasing by 0.6°C each cycle. The third step consisted of 37 cycles of denaturation (94°C) for 20 s and annealing / extension (55°C) for 45 s.

[0044] This study, using a combination of association and linkage analysis, identified a single-nucleotide polymorphism (SNP) site significantly associated with sweet cherry fruit firmness, and subsequently developed a molecular marker. This marker significantly influences sweet cherry fruit firmness. Therefore, this study provides a new technical approach for screening sweet cherry varieties for high firmness. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is the QTL positioning map for three consecutive years (2017-2019), represented by (A, B, C), where A is the QTL positioning result in 2017, B is the QTL positioning result in 2018, and C is the QTL positioning result in 2019.

[0046] Figure 2 Marker2937 was developed as a KASP marker, where A represents the genotyping of the parents and B represents the genotyping of the sweet cherry variety.

[0047] Figure 3 This figure shows the correlation between Marker 2937 genotypes in different sweet cherry varieties and fruit firmness in different years. Anova test was used. Significant differences between the two groups at the p ≤ 0.05 level are indicated by *, and ns indicates no significant difference between the two groups. *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.001; ns, p > 0.05. DETAILED DESCRIPTION

[0048] The present invention is further described in detail below with reference to the embodiments.

[0049] The present invention is achieved through the following technical solutions:

[0050] A molecular marker for a gene associated with sweet cherry fruit firmness is located on chromosome 4. Using genetic populations constructed from the hard-fruited sweet cherry variety 'Wanhongzhu' and the soft-fruited sweet cherry variety 'Shangnan 2808', we integrated the advantages of association analysis and linkage analysis, and used linkage analysis under multiple years to determine reliable QTL confidence intervals. qFF4.1( Figure 1 A, B, and C in the middle. Marker 2937, near its LOD peak, can explain 58.60%, 41.60%, and 54.90% of the phenotypic contribution rates of fruit firmness in 2017-2019 (Table 1). The present invention utilizes different germplasm resources to determine their breeding potential through association analysis and then develops molecular markers.

[0051] The molecular marker is Marker 2937, and the primer pair for amplifying a molecular marker related to the firmness of sweet cherry fruit is SEQ ID NO. 1 and SEQ ID NO. 2, and the reverse primer sequence is SEQ ID NO. 3. The molecular marker amplification product of the hard-fruit sweet cherry variety 'Wanhongzhu' is T, indicating that the material has a late-ripening hard fruit phenotype; the molecular marker amplification product of the soft-fruit sweet cherry variety 'Shangnan 2808' is A, indicating that the material has an early-ripening soft fruit phenotype. Figure 2 Middle A).

[0052] Table 1 LOD values ​​and phenotypic contribution rates of Marker 2937

[0053]

[0054] Association analysis: Using 56 sweet cherry varieties preserved by the Forestry and Fruit Research Institute of Beijing Academy of Agricultural and Forestry Sciences, KASP genotyping was performed, and it was found that the number of sweet cherry varieties with T / T genotype was 44, and the number of sweet cherry varieties with A / A genotype was 12 ( Figure 2 Middle B).

[0055] Sweet cherry varieties were harvested at maturity and then non-destructively measured using a firmness tester (Firmtech Eleven). Thirty cherries of each variety were tested. Non-destructively, the test was performed on both sides of the ventral suture of the sweet cherry fruit using the cherry200g mode. The indenter was pressed vertically against the surface of the sweet cherry fruit to measure firmness in g / mm.

[0056] The statistics of fruit hardness of different genotypes in different years showed that the average fruit hardness of sweet cherry genotype T / T was higher than that of T / A genotype (see Table 2, Figure 3 ).

[0057] Table 2 Changes in fruit firmness of Marker 2937 over three consecutive years

[0058]

[0059] Correlation analysis of different Marker2937 genotypes with fruit hardness in different years showed that different genotypes were significantly correlated with fruit hardness. The fruit hardness of hard fruit genotypes was 45.91%, 59.55% and 34.39% higher than that of soft fruit genotypes. Figure 3). It can be seen that this molecular marker is useful for cultivating hard-fruited sweet cherry fruits and assisting breeding, greatly shortening the time and workload for cultivating hard-fruited sweet cherry varieties. Development of molecular markers: The present invention is based on competitive allele-specific PCR (KASP) technology, and utilizes the sweet cherry fruit hardness marker site and upstream and downstream specific sequences to design a detection primer set. One end of the upstream primer is provided with a specific linker sequence for connecting a fluorescent group. The primer set is used to amplify the sample to be tested, and the fluorescent signal generated during the PCR amplification process is then recorded and analyzed by a computer, which can realize the monitoring of single nucleotide variations at the SNP site. For example, primer CR2937-F1 carries red fluorescence, and primer CR2937-F2 carries blue fluorescence. When only red fluorescence is detected, it means that the nucleotide at 16080735bp of chromosome LG4 is only T, and the SNP site of the sweet cherry sample is determined to be a hard fruit allele, and the genotype is defined as T / T; if only blue fluorescence is detected, it means that the nucleotide at 16080735bp of chromosome LG4 is only A, and the site is determined to be a hard fruit allele, and the genotype is defined as A / A; if green fluorescence appears at the detection site, it means that both A and T exist at the SNP site, and it is determined to be a heterozygote, and the genotype is defined as A / T.

[0060] The detection results of the present invention are highly consistent with the phenotype of the hardness of the fruit of the sample to be tested. After population verification, the amplification effect using the above primers is the best, and the genotype of the SNP site in the sweet cherry fruit can be clearly and effectively distinguished, and the above nucleotide mutation site can be quickly and accurately detected, providing an accurate, fast and effective method for the selection and breeding of hard-fruited sweet cherry varieties.

Claims

1. Primers for amplifying molecular markers related to sweet cherry fruit firmness were designed. The relevant gene was located at 16080735 bp on chromosome 4 of the sweet cherry genome and the fragments of 50-150 bp before and after it were the targets. Specific primers for PCR amplification were designed.

2. The primer according to claim 1, wherein the target is a fragment located at 16080735 bp on chromosome 4 of the sweet cherry genome and 100 bp before and after.

3. The primers according to claim 2, wherein the primers are three specific KASP primers, and the sequences thereof are as follows: Upstream primer 1: 5'-CAGATTTCAAGAACCCAGCAAA-3', Upstream primer 2: 5'-CAGATTTCAAGAACCCAGCAAT-3', Downstream primer: 5'-CTCCCACCACTGGCATAGC-3', Different fluorescent labels are added to the 5' ends of upstream primer 1 and upstream primer 2 respectively.

4. The primer according to claim 3, wherein the three specific KASP primers are: CR2937-F1:5'-GAAGGTCGGAGTCAACGGATTCAGATTTCAAGAACCCAGCAAA-3', CR2937-F2:5'-GAAGGTGACCAAGTTCATGCTCAGATTTCAAGAACCCAGCAAT-3', CR2937-R:5'-CTCCCACCACTGGCATAGC-3'.

5. A molecular marker, Marker 2937, associated with sweet cherry fruit firmness, characterized by: A SNP site is located at the 16080735 bp position of chromosome 4 of the sweet cherry genome. The genotype of the SNP site is defined as T / T in hard fruit materials and A / A in soft fruit materials.

6. The molecular marker according to claim 5, using KASP primers, and obtaining the genotype of the SNP site by PCR amplification using sweet cherry genomic DNA as a template, wherein the KASP primer sequence is as follows: CR2937-F1:5'-GAAGGTCGGAGTCAACGGATTCAGATTTCAAGAACCCAGCAAA-3', CR2937-F2:5'-GAAGGTGACCAAGTTCATGCTCAGATTTCAAGAACCCAGCAAT-3', CR2937-R:5'-CTCCCACCACTGGCATAGC-3'.

7. Use of the primer according to any one of claims 1 to 4, or the molecular marker according to claim 5 or 6, in screening or identifying the firmness of sweet cherry fruit.

8. The use according to claim 7, wherein the genotype of the SNP site is obtained by PCR amplification using the primers according to any one of claims 1 to 4 with sweet cherry genomic DNA as a template, and the genotype in the SNP site is T / T in hard fruit materials and A / A in soft fruit materials.

9. The use according to claim 8, wherein the primer is a KASP primer, and its sequence is as follows: R2937-F1: 5'-GAAGGTCGGAGTCAACGGATTCAGATTTCAAGAACCCAGCAAA-3', CR2937-F2: 5'-GAAGGTGACCAAGTTCATGCTCAGATTTCAAGAACCCAGCAAT-3', CR2937-R: 5'-CTCCCACCACTGGCATAGC-3'.

10. The use according to claim 9, wherein the PCR amplification reaction system is 5 μL, comprising 2 μL genomic DNA, 2 μL 2×Taq DNA Polymerase Mix, and 1 μL 4×SNP Primer Mix; the Primer Mix comprises CR2937-F1, CR2937-F2, CR2937-R, and ddH2O, wherein: Mix CR2937-F1, CR2937-F2, CR2937-R and ddH2O in a ratio of 24:24:48:100.

Images