Sauced rosa roxburghii tratt as well as preparation process and application thereof

Abstract

The invention relates to the technical field of biological fermentation, and discloses sauced rosa roxburghii tratt and a preparation process and application thereof.The sauced rosa roxburghii tratt is prepared through a 1298 fermentation process, namely, the sauced rosa roxburghii tratt is prepared through nine procedures of steam processing, liquid fermentation, separation and juicing, material mixing and yeast stirring under eight fermentation environment parameters in a one-year fermentation period and a liquid-state and solid-state combined fermentation mode, and the sauced rosa roxburghii tratt is obtained. The inherent health attribute of the rosa roxburghii tratt is reserved to the maximum extent, and the sauce flavor is achieved. Efficacy verification tests show that the sauced roxburgh rose can activate phosphorylation expression of adenylate activated protein kinase in a mouse body, reduce fatty acid synthase and inhibit expression of a fat generation gene, so that de novo synthesis of fatty acid is inhibited, lipid accumulation in the liver is reduced, and the effect of preventing and treating liver cancer is achieved. The compound can regulate intestinal flora related to lipid accumulation and energy metabolism, realizes the effect of regulating the non-alcoholic fatty liver, and has a wide application prospect in preparation of large healthy food, health care products and medicines for regulating or improving the non-alcoholic fatty liver.

Description

Technical Field

[0001] The invention relates to the technical field of biological fermentation, and in particular to a sauce-flavored roxburghii and a preparation process and application thereof. Background Art

[0002] Sea buckthorn (Roxburgh) is rich in various active substances and possesses high nutritional value. However, the sour and astringent taste of sea buckthorn products on the market has limited its promotion and development. Research has shown that probiotic fermentation can effectively remove or reduce anti-nutritional factors such as tannins and phytic acid in raw materials, thereby producing healthy foods with higher nutritional value. Processing sea buckthorn into fruit vinegar through microbial fermentation can significantly improve the bitterness of sea buckthorn juice. Furthermore, during the fermentation process, microbial metabolism can further release or transform the active ingredients in sea buckthorn, such as polysaccharides, flavonoids, and triterpenes, enhancing their bioavailability. For example, mixed-strain fermentation can promote esterification reactions, forming compounds with both flavor and function. With growing consumer demand for natural and functional beverages, fermented products are becoming a hot topic due to their health benefits, such as regulating glucose and lipid metabolism and treating dyslipidemia. Biofermentation, as a food processing method, involves the complex fermentation of vegetables and fruits with a variety of probiotics to create nutritious foods with health and conditioning benefits. During the fermentation process, the product's content of functional substances such as organic acids, oligosaccharides, vitamins, polyphenols, amino acids, and antioxidants increases significantly. These ingredients have the potential to enhance human immunity and promote metabolism. Microbial fermentation involves the introduction of multiple strains of bacteria, such as lactic acid bacteria, yeast, and acetic acid bacteria, for mixed fermentation, the addition of specific enzyme preparations, and prolonged fermentation time. This enriches the product with enzymes, organic acids, probiotic metabolites, and small molecule active substances. Its core characteristic is that it retains more natural enzyme activity.

[0003] The existing technology for the fermentation products of sea buckthorn is mainly liquid fermentation, or the pomace is treated by microbial solid-state fermentation. There is no product developed by combining liquid fermentation with solid-state fermentation after fresh sea buckthorn fruit is processed. Liquid fermentation, such as the existing patent (CN202311245766.1), discloses a production and fermentation method, application, and fermentation device of sea buckthorn enzyme fruit vinegar, including: washing the fresh sea buckthorn fruit, drying it, weighing it, crushing it, adding water to mix it to obtain a sea buckthorn stock solution; the enzyme fermentation agent is activated with warm water and inoculated into the sea buckthorn stock solution, and after stirring evenly, it is transferred into a fermentation tank; sucrose is added to the fermentation tank for constant temperature aerobic fermentation, and the supernatant is taken when the solid content is 7%-8% and the pH is 4, which is the sea buckthorn enzyme fruit vinegar; wherein the enzyme fermentation agent is a mixed fermentation agent of yeast, lactic acid bacteria, and acetic acid bacteria, the amount of the enzyme fermentation agent added is 0.02% of the sea buckthorn stock solution, and the amount of sucrose added is 10% of the sea buckthorn stock solution. The fermented sea buckthorn enzyme fruit vinegar not only effectively improves the original bad flavor of the sea buckthorn, but also has a significant effect on improving non-alcoholic fatty liver disease, and the effect is better than that of the sea buckthorn juice. By treating pomace with microbial solid-state fermentation, as described in patent (CN202311047051.5), a sun-dried vinegar made from pomace of sea buckthorn is disclosed, as well as its preparation method and application. The main raw materials for sun-dried vinegar include 30-40 parts of fresh pomace of sea buckthorn, 10-20 parts of glutinous rice porridge, and 40-60 parts of plant enzyme fermentation residue; the preparation process includes glutinous rice porridge preparation, vinegar mash fermentation, vinegar mash fermentation, vat-drying mash, percolation and vinegar leaching, and sun-drying of raw vinegar. Using plant enzyme fermentation residue as the bacterial source for sun-dried vinegar effectively shortens the fermentation time of vinegar mash, which is half the time compared to the traditional fermentation process. It also solves the problem of low fermentation efficiency of inoculating acetic acid bacteria by conventional process due to the high acidity of pomace of sea buckthorn. The fermentation process is mature and stable, and can be used on a large scale for pomace of sea buckthorn, solving the problem that pomace of sea buckthorn is difficult to use on a large scale.

[0004] The sauce-flavored flavor is a typical flavor representative of liquor. The existing patent (CN202210015249.4) discloses a method for making a sauce-flavored sea buckthorn wine. By performing special treatment on sea buckthorn, highly active sea buckthorn dry is finally obtained, which is used in the second round of fermentation of sauce-flavored liquor production process 12987. The fermented sea buckthorn wine has significant effects on preventing cancer, reducing the three highs, and anti-oxidation. In addition, drinking wine or water soaked in sea buckthorn can avoid constipation and play a good therapeutic role for stomach discomfort. Therefore, the sauce aroma is mainly the flavor of the wine product, and there is no juice that embodies the sauce aroma.

[0005] In summary, although liquid fermentation has certain advantages in extracting active ingredients from sea buckthorn, the process has high requirements for equipment and requires strict control of parameters such as the temperature and pH value of the fermentation environment. The operation is complicated and the liquid fermentation process is easily contaminated by miscellaneous bacteria, affecting product quality and flavor stability. When microbial solid-state fermentation is used to treat pomace, due to the physical properties of sea buckthorn pomace such as water content and particle size, the heat and mass transfer efficiency during the fermentation process may be low, and the microbial growth and metabolism may be uneven, resulting in long fermentation cycles and low conversion rates of active ingredients. In addition, the separation and purification of solid-state fermentation products are difficult, affecting the development and application of subsequent products. Summary of the Invention

[0006] The invention provides a sauce-flavored roxburgh and a preparation process and application thereof. By applying a microbial fermentation process to the development of roxburgh roxburgh products, the inherent health properties of roxburgh roxburgh are retained to the greatest extent, while the product has an elegant, delicate, mellow and silky sauce-flavored flavor.

[0007] The present invention provides a preparation process of sauce-flavored roxburghii, which is prepared by a fermentation process consisting of a 1-year fermentation cycle, 2 fermentation methods, 9 fermentation steps, and 8 fermentation environment parameters. The preparation process specifically includes:

[0008] S1, steam processing: wash the fresh roxburghii fruit, remove the stems and blow dry, put it into a steam steamer at a temperature of 90-100 ° C and cook for 10-30 minutes, spread it out and blow dry the surface moisture at low temperature for later use;

[0009] S2, liquid fermentation: the steam-processed roxburghii fruit obtained in step S1 is mixed according to 40-60 parts of roxburghii fruit, 40-60 parts of water, and 8-15 parts of white sugar, crushed and beaten, and loaded into a fermentation ceramic jar, and mixed strains are added to the fermentation container respectively, and the fermentation workshop temperature is controlled to 20-25° C. and aerobic fermentation is carried out for 1-3 months; wherein the mixed strains are composed of yeast and lactic acid bacteria;

[0010] S3, separation and juicing: after the liquid fermentation of step S2 is completed, the supernatant is collected for standby use, the lower part is separated by a belt press, the liquid part is combined with the supernatant and naturally clarified to obtain a liquid fermentation sauce-flavored roxburghii stock solution, and the moisture content of the solid part is controlled to 30-40%, which is used as liquid fermentation residue for standby use;

[0011] S4, mixing koji: the liquid fermentation residue obtained in step S3 is uniformly mixed according to 40-60 parts of liquid fermentation residue, 20-30 parts of bran, and 10-15 parts of Maotai-flavor Daqu, and stirred every 3 minutes. The mixture is fermented at 20-25°C for 10-15 days until white mycelium grows, and then the mixture is placed in an open fermentation jar and pressed and sealed with 1-3 parts of salt.

[0012] S5, solid-state fermentation: the open fermentation jar is transferred to an open-air fermentation drying yard, and solid-state fermentation is carried out for 6-8 months to obtain the sauce-flavored roxburghii solid-state fermented mash;

[0013] S6, extracting juice by leaching: crushing the sauce-flavored roxburghii solid-state fermented mash obtained in step S5 and putting it into a soaking tank of a vinegar leaching device, with each layer of 20-30 cm, adding water of 75-80° C. to the soaking tank to cover 3-5 cm above the sauce-flavored roxburghii solid-state fermented mash, soaking for 5-8 hours, and slowly releasing a leaching liquid; adding water of 50-75° C. to the vinegar mash again to cover 3-5 cm above the sauce-flavored roxburghii solid-state fermented mash, soaking for 2-3 hours, collecting a second leaching vinegar, and mixing the first leaching liquid and the second leaching vinegar to obtain a solid-state fermentation leaching vinegar liquid;

[0014] S7, sun exposure and concentration: the sauce-flavored roxburghii solid fermentation liquid obtained in step S6 is placed in an open jar, moved to an open-air fermentation drying yard, the open jar is covered with tempered glass, and sun-exposed for 3-5 months for esterification and concentration to obtain the solid-state fermented sauce-flavored roxburghii stock liquid;

[0015] S8, blending ratio: blending the liquid fermented sauce-flavored roxburghii stock solution obtained in step S2 and step S7 with the solid-state fermented sauce-flavored roxburghii stock solution in a certain ratio to obtain the sauce-flavored roxburghii fermented stock solution.

[0016] Furthermore, in step S1, the fresh fruit variety of roxburghii is Guinong No. 5, Guinong No. 7 or golden roxburghii;

[0017] Furthermore, in step S2, the yeast is any one or a combination of Saccharomyces boulardii, Angel Saccharomyces cerevisiae, Saccharomyces odorifera, Saccharomyces weigensis, Hansenula anomala, Schizosaccharomyces pombe, Rhodotorula glutinosus, Pichia pastoris, Candida glycerogenes and Candida utilis.

[0018] Furthermore, in step S2, the lactic acid bacteria are any one or a combination of Lactobacillus plantarum, Lactobacillus acidophilus, Streptococcus thermophilus, Lactobacillus gasseri, Bifidobacterium and Lactobacillus reuteri.

[0019] Furthermore, the one-year fermentation cycle is that the fermentation is carried out from August to October of each year, and the fermentation is completed from August to October of the second year, which requires a one-year cycle;

[0020] Furthermore, the two fermentation methods are liquid fermentation and solid fermentation.

[0021] Furthermore, the eight fermentation environment parameters are the temperature, latitude, air cleanliness, wind speed, concentration of negative oxygen ions in the air, altitude, water cleanliness, and ultraviolet radiation of the open-air fermentation drying yard during the fermentation process of the sauce-flavored sea buckthorn; wherein, the annual average temperature of the open-air fermentation drying yard environment is 20-25°C; the latitude is 26-28° north latitude; the air cleanliness is the excellent rate of the air quality of the open-air fermentation drying yard environment, which is 98-99% on average throughout the year; the wind speed is 2-3 meters per second on average throughout the year; the concentration of negative oxygen ions in the air is 20,000 to 30,000 negative oxygen ions per cubic meter of air; the altitude is 800-1500 meters above sea level; the water cleanliness is 100%; and the ultraviolet radiation is 3600-3900 megajoules per square meter on average throughout the year.

[0022] The present invention also provides a sauce-flavored roxburghii drink, which is prepared by adding food processing auxiliary materials to the sauce-flavored roxburghii fermentation stock solution prepared by the preparation process described above;

[0023] The sauce-flavored roxburghii drink has a sauce-flavored flavor that is expressed by the synergistic effect of 30-40% ester compounds, 33-38% alcohol compounds, and 20-25% acid compounds.

[0024] The active ingredients in the sauce-flavored sea buckthorn beverage are any one or more of quercetin, ellagic acid and gallic acid.

[0025] The present invention also provides an application of the above-mentioned sauce-flavored roxburghii beverage, and the application of the sauce-flavored roxburghii beverage in the preparation of health foods, health products, and medicines for regulating or improving non-alcoholic fatty liver disease.

[0026] The beneficial effects of the present invention are:

[0027] 1. The sauce-flavored sea buckthorn is fermented through the combined action of liquid fermentation and solid-state fermentation, and the segmented microbial fermentation method is used to solve the "sour and bitter" taste problem of sea buckthorn, which retains the inherent health properties of sea buckthorn to the greatest extent, and at the same time has an elegant, delicate, mellow and silky sauce flavor.

[0028] 2. Fresh sea buckthorn fruit is steamed before fermentation. High-temperature steam kills microorganisms on the pear surface, allowing for targeted enhancement through the addition of microbial agents. Raw sea buckthorn fruit is known to be cold, but steaming reduces this coldness, making it more suitable for those with weak spleen and stomach. Steaming also disrupts the pear's cell wall structure, promoting the release of polysaccharides and polyphenols, enhancing its immune-regulating and antioxidant properties. It also blocks ascorbic acid oxidase activity, reducing vitamin C loss during fermentation. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The present invention is a schematic flow diagram of the process for preparing the sauce-flavored roxburghii.

[0030] Figure 2 This is the total ion current diagram of the volatile components of RRJ, RFV and FRRJ in the present invention.

[0031] Figure 3 Schematic diagram of the relative contents of volatile components in RRJ, RFV and FRRJ in the present invention.

[0032] Figure 4 Schematic diagram of the relative contents of the main flavor components in RRJ, RFV and FRRJ of the present invention.

[0033] Figure 5 This is the PCA diagram of the volatile components of RRJ, RFV and FRRJ in the present invention.

[0034] Figure 6 Schematic diagram of the effect of the sauce-flavored roxburghii pear on the body weight change rate (A) and epididymal fat weight (B) of NAFLD mice in the present invention.

[0035] Figure 7 Schematic diagram of the effect of the sauce-flavored roxburghii on liver index in NAFLD mice in the present invention.

[0036] Figure 8 Schematic diagram of the effect of the sauce-flavored roxburghii of the present invention on the content of lipid metabolism indicators in mouse liver.

[0037] Figure 9 Schematic diagram of the effect of the sauce-flavored roxburghii pear on SOD activity (A) and MDA content (B) in mouse liver in the present invention.

[0038] Figure 10 Schematic diagram of the effect of the sauce-flavored roxburghii pear on the activities of ALT (A) and AST (B) in mouse serum.

[0039] Figure 11 Schematic diagram of the effect of the sauce-flavored roxburghii of the present invention on the insulin resistance index in the serum of NAFLD mice.

[0040] Figure 12 Schematic diagram of H&E staining of mouse liver samples by using rosa roxburghii in the present invention.

[0041] Figure 13 Schematic diagram of oil red staining of mouse liver samples with rosa roxburghii in the present invention.

[0042] Figure 14 The figure is a histogram of protein expression and relative abundance of gray values ​​of the rosa roxburghii in the mouse liver samples in the present invention.

[0043] Figure 15 This is a schematic diagram of the changing trend index of the Alpha diversity index of the intestinal flora of mice caused by the effect of the sauce-flavored roxburghii in the present invention.

[0044] Figure 16 Schematic diagram of the effect of the sauce-flavored sea buckthorn on the species composition of the intestinal flora at the phylum (A) and genus (B) levels in the present invention.

[0045] Figure 17 Schematic diagram of the effect of the sauce-flavored sea buckthorn on the relative abundance of intestinal flora at the phylum and genus levels in the present invention.

[0046] Figure 18 This is a picture of the open-air fermentation drying area for the sauce-flavored sea buckthorn in the present invention.

[0047] The purpose, features and advantages of the present invention will be further described with reference to the accompanying drawings and in conjunction with the embodiments. DETAILED DESCRIPTION

[0048] It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0049] The sauce-flavored flavor is a typical flavor representative of liquor. The sauce-flavored flavor is mainly reflected in the flavor of liquor products, and there is no juice that embodies the sauce-flavored flavor. The present invention discloses a sauce-flavored sea buckthorn and its preparation process and application. The product is prepared using the "1298" fermentation process, i.e., a fermentation cycle of one year, two fermentation methods of liquid and solid, under eight fermentation environmental parameters, and fermented through nine steps including steam processing, liquid fermentation, separation and juicing, and mixing and koji. The product retains the inherent health properties of sea buckthorn to the greatest extent, while having an elegant, delicate, and mellow sauce-flavored flavor.

[0050] Efficacy verification tests have shown that the sauce-flavored sea buckthorn pear described in the present invention can activate the phosphorylation expression of adenylate-activated protein kinase in mice, reduce fatty acid synthase, and inhibit the expression of lipogenesis genes, thereby inhibiting the de novo synthesis of fatty acids, reducing lipid accumulation in the liver, and regulating the intestinal flora related to lipid accumulation and energy metabolism, thereby achieving the effect of regulating non-alcoholic fatty liver disease. It has broad application prospects in the preparation of health foods, health products, and medicines that regulate or improve non-alcoholic fatty liver disease.

[0051] like Figure 1 、 18 As shown, the present invention provides a preparation process of sauce-flavored sea buckthorn, which is prepared by a "1298" fermentation process, including a 1-year fermentation cycle, 2 fermentation methods (liquid fermentation and solid fermentation), 9 fermentation steps, and 8 fermentation environment parameters.

[0052] Example 1

[0053] 1-year fermentation cycle: Fermentation begins in August of each year and is completed in August of the following year, requiring a 1-year cycle.

[0054] 8 fermentation environment parameters: temperature, latitude, air cleanliness, wind speed, concentration of negative oxygen ions in the air, altitude, water cleanliness, and ultraviolet radiation of the open-air fermentation drying yard during the fermentation process of sauce-flavored sea buckthorn; (1) Temperature of the open-air fermentation drying yard: the average temperature of the open-air fermentation drying yard environment throughout the year is 21°C; (2) Latitude: 26° north latitude; (3) Air cleanliness: the air quality of the open-air fermentation drying yard environment is excellent at an average of 99% throughout the year; (4) Wind speed: the average is 2.3 meters per second throughout the year; (5) Concentration of negative oxygen ions in the air: 20,000 negative oxygen ions per cubic meter of air; (6) Altitude: the altitude is 1,200 meters above sea level; (7) Water cleanliness: 100%; (8) Ultraviolet radiation: the average is 3,600 megajoules per square meter throughout the year.

[0055] The 9 fermentation processes include the following raw materials expressed in parts by weight and prepared by the following specific steps:

[0056] S101, steam processing: picking fresh roxburghii fruit on August 15 of the lunar calendar, washing the roxburghii fruit, removing the stems, and drying the fruit, and then steaming the fruit in a steam steamer at a temperature of 100° C. for 10 minutes. After steaming, spreading the fruit and drying the surface moisture at a low temperature for later use. The roxburghii fruit variety is Guinong No. 5.

[0057] S102, liquid fermentation: the steam-processed roxburghii fruit obtained in step S101 is mixed with 40 parts of roxburghii fruit, 60 parts of water, and 8 parts of white sugar, crushed and pulped, and then loaded into a fermentation ceramic jar, and mixed strains are added to the fermentation container respectively, and the fermentation workshop temperature is controlled to be 25° C. and aerobic fermentation is carried out for 1 month; wherein the mixed strains are composed of yeast and lactic acid bacteria, the yeast is Angel Saccharomyces cerevisiae, and the lactic acid bacteria is Lactobacillus plantarum;

[0058] S103, separation and juicing: After the liquid fermentation of step S102 is completed, the supernatant is collected for standby use, the lower part is separated by a belt press, the liquid part is combined with the supernatant and naturally clarified to obtain a liquid fermented sauce-flavored roxburghii stock solution, and the water content of the solid part is controlled to 40% as a liquid fermentation residue for standby use;

[0059] S104, mixing the liquid fermentation residue obtained in step S103, according to 60 parts of liquid fermentation residue, 20 parts of bran, and 15 parts of Maotai-flavor Daqu, stir and mix them evenly, stir every 3 minutes, ferment at 25°C for 10 days until white mycelium grows, put them into an open fermentation jar, press and compact them, and then seal them with 3 parts of salt;

[0060] S105, solid-state fermentation: transferring the open fermentation jar to an open-air fermentation drying yard, and solid-state fermenting for 7 months to obtain a sauce-flavored roxburghii solid-state fermented mash, i.e., completing the solid-state fermentation in May of the following year;

[0061] S106, extracting juice by leaching: the sauce-flavored roxburghii solid-state fermented mash obtained in step S105 is crushed and put into a soaking tank of a vinegar leaching device, with each layer of 20 cm, 80° C. water is added to the soaking tank to cover 3 cm above the sauce-flavored roxburghii solid-state fermented mash, soaked for 8 hours, and a first leaching liquid is slowly released; 50° C. water is added to the vinegar mash again to cover 5 cm above the sauce-flavored roxburghii solid-state fermented mash, soaked for 2 hours, a second leaching vinegar is collected, and the first leaching liquid and the second leaching vinegar are mixed to obtain a solid-state fermentation leaching vinegar liquid;

[0062] S107, sun exposure and concentration: the sauce-flavored roxburghii solid-state fermentation liquid obtained in step S106 is put into an open jar, moved to an open-air fermentation drying yard, the open jar is covered with tempered glass, and sun-exposed for esterification and concentration for 3 months (in August of the following year) to obtain the solid-state fermented sauce-flavored roxburghii stock liquid;

[0063] S108, blending ratio: blending the liquid fermented sauce-flavored roxburghii stock solution obtained in step S102 and step S107 with the solid fermented sauce-flavored roxburghii stock solution in a certain ratio to obtain the sauce-flavored roxburghii fermented stock solution.

[0064] Example 2

[0065] 1-year fermentation cycle: Fermentation begins in October of each year and is completed in October of the following year, requiring a 1-year cycle.

[0066] 8 fermentation environment parameters: temperature, latitude, air cleanliness, wind speed, concentration of negative oxygen ions in the air, altitude, water cleanliness, and ultraviolet radiation of the open-air fermentation drying yard during the fermentation process of sauce-flavored sea buckthorn; (1) Temperature of the open-air fermentation drying yard: the average temperature of the open-air fermentation drying yard environment throughout the year is 21°C; (2) Latitude: 26° north latitude; (3) Air cleanliness: the air quality of the open-air fermentation drying yard environment is excellent at an average of 99% throughout the year; (4) Wind speed: the average is 2 meters per second throughout the year; (5) Concentration of negative oxygen ions in the air: 30,000 negative oxygen ions per cubic meter of air; (6) Altitude: the altitude is 800 meters above sea level; (7) Water cleanliness: 100%; (8) Ultraviolet radiation: the average is 3900 megajoules per square meter throughout the year.

[0067] The 9 fermentation processes include the following raw materials expressed in parts by weight and prepared by the following specific steps:

[0068] S201, steam processing: the roxburghii fresh fruit is washed, the stems are removed, and the dried fruit is placed in a steam steamer at a temperature of 90° C. and steamed for 30 minutes. After steaming, the roxburghii fresh fruit is spread out and the surface moisture is dried at a low temperature for standby use. The roxburghii fresh fruit variety is golden roxburghii;

[0069] S202, liquid fermentation: the steam-processed golden roxburghii fruit obtained in step S201 is mixed according to 60 parts of roxburghii fruit, 40 parts of water, and 15 parts of white sugar, crushed and pulped, and then loaded into a fermentation ceramic jar, and mixed strains are added to the fermentation container respectively, and the fermentation workshop temperature is controlled to be 20° C. and aerobically fermented for 2 months; wherein the mixed strains are composed of yeast and lactic acid bacteria, the yeast is any one or a combination of Saccharomyces boulardii, Angel Saccharomyces cerevisiae, Flavoring Saccharomyces cerevisiae, Saccharomyces weigensis, Hansenula anomala, Schizosaccharomyces pombe, Rhodotorula glutinosus, Pichia pastoris, glycerogenic Candida and utilis; the lactic acid bacteria are any one or a combination of Lactobacillus plantarum, Lactobacillus acidophilus, Streptococcus thermophilus, Lactobacillus gasseri, Bifidobacterium and Lactobacillus reuteri;

[0070] S203, separation and juicing: After the liquid fermentation of step S202 is completed, the supernatant is collected for standby use, the lower part is separated by a belt press, the liquid part is combined with the supernatant and naturally clarified to obtain a liquid fermented sauce-flavored roxburghii stock solution, and the moisture content of the solid part is controlled to 30% as a liquid fermentation residue for standby use;

[0071] S204, mixing the liquid fermentation residue obtained in step S203, according to 60 parts of liquid fermentation residue, 20 parts of bran, and 10 parts of Maotai-flavor Daqu, stir and mix them evenly, stir every 3 minutes, ferment at 20°C for 15 days until white mycelium grows, put them into an open fermentation jar, press and compact them, and then seal them with 1 part of salt;

[0072] S205, solid-state fermentation: transferring the open fermentation jar to an open-air fermentation drying yard, and solid-state fermenting for 6 months to obtain a sauce-flavored roxburghii solid-state fermented mash;

[0073] S206, extracting juice by leaching: the sauce-flavored roxburghii solid-state fermented mash obtained in step S205 is crushed and put into a soaking tank of a vinegar leaching device, with each layer of 30 cm, 75° C. water is added to the soaking tank to cover 5 cm above the sauce-flavored roxburghii solid-state fermented mash, soaked for 5 hours, and a first leaching liquid is slowly released; 50° C. water is added to the vinegar mash again to cover 3 cm above the sauce-flavored roxburghii solid-state fermented mash, soaked for 3 hours, a second leaching vinegar is collected, and the first leaching liquid and the second leaching vinegar are mixed to obtain a solid-state fermentation leaching vinegar liquid;

[0074] S207, sun-drying and concentrating: the solid-state fermentation liquid of the sauce-flavored roxburghii obtained in step S206 is put into an open jar, moved to an open-air fermentation drying yard, the open jar is covered with tempered glass, and sun-dried for 4 months for esterification and concentration to obtain the solid-state fermentation roxburghii stock liquid;

[0075] S208, blending ratio: blending the liquid fermented sauce-flavored roxburghii stock solution obtained in step S202 and step S207 with the solid fermented sauce-flavored roxburghii stock solution in a certain ratio to obtain the sauce-flavored roxburghii fermented stock solution.

[0076] Example 3

[0077] 1-year fermentation cycle: Fermentation begins in September of each year and is completed in September of the following year, requiring a 1-year cycle.

[0078] 8 fermentation environment parameters: temperature, latitude, air cleanliness, wind speed, concentration of negative oxygen ions in the air, altitude, water cleanliness, and ultraviolet radiation of the open-air fermentation drying yard during the fermentation process of sauce-flavored sea buckthorn; (1) Temperature of the open-air fermentation drying yard: The average temperature of the open-air fermentation drying yard environment is 22°C throughout the year; (2) Latitude: 26° north latitude; (3) Air cleanliness: The air quality of the open-air fermentation drying yard environment is excellent at an average of 98% throughout the year; (4) Wind speed: The average is 2 meters per second throughout the year; (5) Concentration of negative oxygen ions in the air: 20,000 negative oxygen ions per cubic meter of air; (6) Altitude: The altitude is 1,200 meters above sea level; (7) Water cleanliness: 100%; (8) Ultraviolet radiation: The average is 3,700 megajoules per square meter throughout the year.

[0079] The 9 fermentation processes include the following raw materials expressed in parts by weight and prepared by the following specific steps:

[0080] S301, steam processing: the roxburghii fresh fruit is washed, stemmed and dried, and then placed in a steam steamer tower at a temperature of 95 ° C and steamed for 25 minutes. After steaming, the roxburghii fresh fruit is spread out at a low temperature and dried for use. The roxburghii fresh fruit variety is Guinong No. 5;

[0081] S302, liquid fermentation: the steam-processed roxburghii fruit obtained in step S301 is mixed according to 50 parts of roxburghii fruit, 50 parts of water, and 10 parts of white sugar, crushed and pulped, and then loaded into a fermentation ceramic jar, and mixed strains are added to the fermentation container respectively, and the fermentation workshop temperature is controlled to be aerobic fermentation for 2 months; wherein, the mixed strains are composed of yeast and lactic acid bacteria, the yeast is Angel Saccharomyces cerevisiae, and the lactic acid bacteria is Lactobacillus acidophilus;

[0082] S303, separation and juicing: After the liquid fermentation of step S302 is completed, the supernatant is collected for standby use, the lower part is separated by a belt press, the liquid part is combined with the supernatant and naturally clarified to obtain a liquid fermented sauce-flavored roxburghii stock solution, and the moisture content of the solid part is controlled to 35% as a liquid fermentation residue for standby use;

[0083] S304, mixing the liquid fermentation residue obtained in step S303, according to 50 parts of liquid fermentation residue, 25 parts of bran, and 12 parts of Maotai-flavor Daqu, stirring and mixing them evenly, stirring every 3 minutes, fermenting at 22° C. for 12 days until white mycelium grows, and then putting them into an open fermentation jar, pressing and compacting them, and then sealing them with 2 parts of salt;

[0084] S305, solid-state fermentation: transferring the open fermentation jar to an open-air fermentation drying yard, and solid-state fermenting for 6 months to obtain a sauce-flavored roxburghii solid-state fermented mash;

[0085] S306, extracting juice by leaching: the sauce-flavored roxburghii solid-state fermented mash obtained in step S305 is crushed and put into a soaking tank of a vinegar leaching device, with each layer of 25 cm, 75° C. water is added to the soaking tank to cover 4 cm above the sauce-flavored roxburghii solid-state fermented mash, soaked for 6 hours, and a first leaching liquid is slowly released; 60° C. water is added to the vinegar mash again to cover 4 cm above the sauce-flavored roxburghii solid-state fermented mash, soaked for 2.5 hours, a second leaching vinegar is collected, and the first leaching liquid and the second leaching vinegar are mixed to obtain a solid-state fermentation leaching vinegar liquid;

[0086] S307, sun-drying and concentrating: the solid-state fermentation liquid of the sauce-flavored roxburghii obtained in step S306 is put into an open jar, moved to an open-air fermentation drying yard, the open jar is covered with tempered glass, and sun-dried for 4 months for esterification and concentration to obtain the solid-state fermentation roxburghii stock liquid;

[0087] S308, blending ratio: blending the liquid fermented sauce-flavored roxburghii stock solution obtained in step S302 and step S307 with the solid fermented sauce-flavored roxburghii stock solution in a certain ratio to obtain the sauce-flavored roxburghii fermented stock solution.

[0088] The present invention also provides a sauce-flavored roxburghii drink, which is prepared by adding food processing auxiliary materials to the sauce-flavored roxburghii fermentation stock solution prepared by the above-mentioned preparation process.

[0089] (1) In the above-mentioned Example 1, the sauce-flavored flavor of the sauce-flavored sea buckthorn beverage is expressed by the synergistic action of 34.1% ester compounds, 35.2% alcohol compounds and 21.0% acid compounds, and the active ingredients in the sauce-flavored sea buckthorn beverage are quercetin, ellagic acid and gallic acid.

[0090] (2) In the above Example 2, the sauce-flavored flavor of the sauce-flavored sea buckthorn beverage is expressed by the synergistic effect of 30% ester compounds, 38% alcohol compounds and 20% acid compounds, and the active ingredients in the sauce-flavored sea buckthorn beverage are quercetin, ellagic acid and gallic acid.

[0091] (3) In the above-mentioned Example 3, the sauce-flavored flavor of the sauce-flavored sea buckthorn beverage is expressed by the synergistic action of 35% ester compounds, 36% alcohol compounds and 23% acid compounds, and the active ingredient in the sauce-flavored sea buckthorn beverage is any one or more of quercetin, ellagic acid and gallic acid.

[0092] The present invention also provides an application of a sauce-flavored roxburghii drink in the preparation of health foods, health products, and medicines for regulating or improving non-alcoholic fatty liver disease.

[0093] Experiment 2 described below (high-fat diet-induced NAFLD model mice) proved that the sauce-flavored sea buckthorn pear can activate the phosphorylation expression of adenylate-activated protein kinase in mice, reduce fatty acid synthase, inhibit the expression of lipogenesis genes, thereby inhibiting the de novo synthesis of fatty acids, reducing lipid accumulation in the liver, regulating the intestinal flora related to lipid accumulation and energy metabolism, and achieving the effect of regulating non-alcoholic fatty liver disease.

[0094] In order to further verify the purpose and beneficial effects of the present invention, the inventors conducted the following experiments:

[0095] 1. Analysis of the characteristic flavor of sauce-flavored roxburghii

[0096] SPME-GC-MS was used to detect the volatile flavor compounds of roxburghii raw juice (RRJ), sauce-flavored roxburghii (RFV) and fermented roxburghii fruit vinegar (FRRJ). The differences in volatile components among the three types of roxburghii were compared and the characteristic flavor compounds of sauce-flavored roxburghii were identified.

[0097] ① Experimental methods

[0098] Sample extraction method: 3 mL of sample and 5 μL of 0.7554 mg / mL cyclohexanone as the internal standard were precisely pipetted into a 20 mL sampling vial. After headspace extraction at 45°C for 10 minutes, a 1 cm solid-phase microextraction (SPME) sampler was inserted and extraction continued for 30 minutes, with stirring for 2 seconds every 10 seconds. Upon completion, the sampler was removed and immediately inserted into the gas chromatograph inlet (250°C) for thermal desorption. An HP-5MS UItra Inert (30 m × 0.25 mm × 0.25 μm) flexible quartz capillary column was used.

[0099] ②Test results

[0100] After extraction and injection using solid phase microextraction technology, molecular fragmentation information was recorded by GC-MS, and the total ion current (see Figure 2 ).Depend on Figure 2 It can be seen that GC-MS can better separate the volatile components of the volatile flavor substances of the roxburghii raw juice (RRJ), the sauce-flavored roxburghii (RFV) and the sauce-flavored roxburghii liquid fermentation raw liquid (FRRJ), and it can be observed that the number of chromatographic peaks increases after the roxburghii is fermented; the number of chromatographic peaks of the sauce-flavored roxburghii obtained by the sauce-flavored roxburghii fermentation process of the present invention is more than that of the roxburghii raw juice and the roxburghii liquid fermentation fruit vinegar.

[0101] The flavor of the three raw materials was analyzed by SPME-GC-MS (see Figure 3). The test results showed that a total of 80 volatile organic compounds were identified in the raw sea buckthorn juice, sauce-flavored sea buckthorn and sea buckthorn liquid fermented fruit vinegar, including esters, alcohols, aldehydes, acids, ketones, phenols, ethers, hydrocarbons, olefins, furans and others. Further analysis showed that esters (40.0%) and alcohols (30.0%) were the main flavor components in the raw sea buckthorn juice; the liquid fermented sea buckthorn fruit vinegar showed a specific enrichment of ester substances (83.2%), while the proportion of alcohols dropped to 9.3%; the sauce-flavored sea buckthorn formed a multi-dimensional flavor system with esters (34.1%), alcohols (35.2%) and acids (21.0%) acting synergistically. Moreover, compared with the raw sea buckthorn juice, the types and contents of esters, alcohols, aldehydes and acids in the sauce-flavored sea buckthorn increased, and the proportion of acids increased by 15.7%, indicating that the optimization of the mixed fermentation process effectively promoted the esterification reaction and the conversion of acid precursors.

[0102] Based on volatile components Figure 4 The analysis in Table 1 below confirms that the fermentation process for the sauce-flavored sea buckthorn fruit of the present invention significantly enhances the diversity of flavor profiles. Further analysis shows that the sauce-flavored sea buckthorn fruit contains six new ester compounds compared to the original sea buckthorn fruit juice, with their total concentration increasing from 19.42 mg / L to 279.58 mg / L. Phenylethyl acetate accounts for 59.79% of this, becoming a key flavor component. In terms of basic components, the original sea buckthorn fruit juice contains alcohols (five types, 14.51 mg / L), aldehydes (four types, 1.33 mg / L), acids (three types, 1.81 mg / L), and phenols (one type, 2.29 mg / L). After the sea buckthorn fruit was fermented using the sauce-flavored sea buckthorn fruit fermentation process, the corresponding species in the sauce-flavored sea buckthorn fruit increased to 12 (284.45 mg / L), 4 (4.63 mg / L), 12 (163.73 mg / L), and 6 (80.79 mg / L), respectively. Among them, phenylethanol, nonanal, acetic acid, and 2-methoxy-4-methylbenzene accounted for 77.05%, 41.90%, 45.47%, and 51.53%, respectively, constituting the dominant components of each category. This data demonstrates that the process for preparing rosa roxburghii with a sauce-flavored aroma can effectively promote the esterification and acid conversion metabolic pathways, significantly improving the biosynthesis efficiency of characteristic flavor substances.

[0103] Table 1 Volatile component detection results

[0104]

[0105]

[0106]

[0107]

[0108]

[0109] Origin2022 software was used to perform principal component analysis (PCA-X) on RRJ, FRRJ and RFV samples. The results are as follows: Figure 5 As shown. The analysis showed that all samples were within the 95% confidence ellipse, and the variance contributions of the first two principal components (PC1 and PC2) were 63.7% and 30.3% respectively, with a cumulative contribution rate of 94.0%, indicating that the model can effectively analyze the overall characteristic differences of the samples. According to the spatial distribution characteristics of the principal components, the sample spacing was positively correlated with the inter-group differences. In the PCA diagram, the original sea buckthorn juice and the liquid fermented sea buckthorn fruit vinegar were distributed in the same quadrant and some areas overlapped, while the sauce-flavored sea buckthorn was independently distributed in different quadrants, showing significant spatial separation characteristics. Specifically, the close distribution of the original sea buckthorn juice and the liquid sea buckthorn fruit vinegar suggested that the flavor components of the two were highly similar, while the long-range distribution of the sauce-flavored sea buckthorn indicated that its volatile components were specific. Based on the above analysis, the unique flavor characteristics of the sauce-flavored sea buckthorn may be related to the significant increase in the diversity and content of substances such as esters, alcohols, and aldehydes. In summary, the sauce-flavored sea buckthorn flavor is mainly expressed through the synergistic system of esters, alcohols and acids.

[0110] 2. Regulatory effect of roxburghii roxburghii (RFV) on non-alcoholic fatty liver disease (NAFLD)

[0111] A high-fat diet was used to induce a NAFLD model in mice. Simultaneously, the model was established and the drug administration was stopped after 12 weeks. Serum levels of ALT, AST, and INS, as well as liver tissue levels of TG, TC, LDL-C, HDL-C, SOD, and MDA were measured, as well as liver tissue pathology. Western Blot analysis was also performed to examine the expression of AMPK pathway proteins in mouse livers to further validate the regulatory mechanism of the NAFLD model.

[0112] ① Experimental methods

[0113] Model Establishment and Experimental Grouping: Forty C57BL / 6J mice were randomly divided into five groups (n=8): control, model (NAFLD), RRJ, and low-dose (RFV-L) and high-dose (RFV-H) RFV groups. Mice in each group were housed for one week at 22±2°C with a 12-hour light-dark cycle. During this period, mice had free access to feed and drinking water. One week later, all groups, except the control group, were fed a high-fat diet for 12 weeks to establish the model. Simultaneously, mice in the treatment groups were given RRJ and RFV by gavage, while mice in the control and model groups were given saline by gavage at a dose of 0.01 mL / g body weight. The original Rosa roxburghii juice was diluted 2-fold with deionized water for the control group, while the low- and high-dose Rosa roxburghii juices were diluted 8-fold and 4-fold with deionized water, respectively, for the control and model groups. Body weight was recorded every 5 days, and the rate of change at the endpoint of the intervention was calculated using the formula.

[0114] Collection of test samples: Fecal samples of mice in each group were collected two days before the autopsy (feces of at least 6 mice were selected for each group). The collected fecal samples were divided into 10mL sterile centrifuge tubes, 200mg per tube, and then placed in a -80℃ refrigerator for storage. After the last administration, the mice were fasted for 12 hours, blood was collected from the eyeballs, and the mice were killed by cervical dislocation. The liver and epididymal fat were dissected and rinsed with pre-cooled saline, dried with filter paper, and weighed. The livers of three mice were randomly selected from each group and fixed in 4% paraformaldehyde. The livers of the remaining mice were weighed and added to a physiological saline grinder at a ratio of 1:9 for homogenization. The blood and tissue homogenates were centrifuged at 5000rpm for 5 minutes at 2-8℃, and the supernatant was taken for subsequent testing.

[0115] To calculate the insulin resistance index, insert a blood glucose test strip into the blood glucose meter and drop a portion of blood onto the test strip. Wait for the meter to display the value and record it. For serum testing, use an insulin kit. Add the standard and diluent to the enzyme-coated plate according to the kit instructions. Add the sample diluted 5-fold and mix thoroughly on a shaker. Incubate at 37°C for 30 minutes. After incubation, add diluted wash buffer to each well, let it stand, and discard. Repeat this five times, pat dry, then add the enzyme-labeled reagent and incubate under the same conditions. Wash the plate five times, add colorants A and B, and develop at 37°C for 10 minutes. Add stop solution, and measure absorbance at 450 nm. Substitute the calculated insulin value and the corresponding blood glucose value into the formula to calculate the insulin resistance index.

[0116] Biochemical marker testing: Serum samples were tested for ALT, AST, and INS in strict accordance with the kit instructions. Liver tissue was homogenized with normal saline at a ratio of 1:9 and centrifuged at 4°C, 3000 rpm, for 10 minutes. The supernatant was then collected for later use. TG, TC, LDL-C, HDL-C, SOD, and MDA were measured according to the kit instructions.

[0117] Pathological section analysis: Liver tissue was accurately weighed, and samples from the same lobe were fixed in 4% paraformaldehyde. After dehydration, the samples were embedded in paraffin and tissue sections were prepared. Sections were stained with hematoxylin and eosin (HE) and oil red O, respectively. Histopathological morphology and lipid deposition were observed using light microscopy.

[0118] ② Experimental results

[0119] (1) Effects of rosa roxburghii on body weight and epididymal fat weight in NAFLD mice: Body weight changes and epididymal fat weight are important manifestations of male NAFLD mice. Figure 6 As shown in the results, compared with the blank group, the body weight change rate of mice in the model group at the end of the intervention significantly increased by 51.44% (P < 0.01), and the epididymal fat weight significantly increased by 217.35% (P < 0.01), proving that the model was successfully established by feeding with a high-fat diet. Compared with the model group, RRJ of sea buckthorn juice can significantly reduce the body weight of model mice by 35.41% and the epididymal fat weight by 41.81% (P < 0.01); the body weight of mice in the low- and high-dose groups of sauce-flavored sea buckthorn significantly decreased by 32.28% and 36.38% (P < 0.01), respectively, while the epididymal fat mass significantly decreased by 34.50% (P < 0.05) and 57.03% (P < 0.01), indicating that both sauce-flavored sea buckthorn and sea buckthorn juice can effectively inhibit the weight gain and fat accumulation of NAFLD mice. (Note: Figure 6 ##: compared with the blank group (p < 0.01); *: compared with the model group (p < 0.05); **: compared with the model group (p < 0.01, the same below)

[0120] (2) Effects of sauce-flavored roxburghii on liver index in NAFLD mice: Figure 7 As shown in the results, compared with the blank group, the liver index of the model group increased significantly by 10.64% (P < 0.01), indicating successful modeling. The liver index of mice in the RRJ, RFV-L, and RFV-H groups decreased by 10.14%, 13.61%, and 15.27%, respectively, effectively inhibiting liver enlargement caused by NAFLD in mice, with RFV-H showing a significant effect (P < 0.05).

[0121] (3) Effects of rosa roxburghii on lipid metabolism in NAFLD mice: Figure 8As shown, RFV and RRJ significantly regulate the levels of TG, TC, LDL-C, and HDL-C in the livers of NAFLD mice. They effectively upregulated HDL-C levels, promoting peripheral cholesterol excretion via the hepatic bile acid pathway. They also downregulated LDL-C levels, indicating that more cholesterol was transferred from the liver to peripheral tissues for utilization, effectively alleviating hepatocyte lipid deposition. The TG, TC and LDL-C in the model group were significantly higher than those in the blank group (P < 0.01), causing lipid metabolism disorders, while the low-dose and high-dose RFV groups significantly reduced TG by 29.54% and 55.17% (P < 0.05, P < 0.01), TC by 28.71% and 37.38% (P < 0.05, P < 0.01), LDL-C by 58.58% and 71.81% (P < 0.01, P < 0.01), respectively, and HDL-C by 77.82% and 77.95% (P < 0.01, P < 0.01), respectively, significantly improving the lipid metabolism disorders in the liver and inhibiting the accumulation of fat in the liver.

[0122] (4) Effects of sauce-flavored roxburghii on oxidative stress levels in NAFLD mice: Figure 9 As shown in the results, RFV and RRJ can significantly regulate oxidative stress-related indicators. Compared with the blank group, the SOD enzyme activity in the model group decreased significantly by 53.89% (P < 0.01), while the SOD in the RRJ and RFV low-dose and high-dose groups increased significantly by 75.05%, 62.93%, and 72.50%, respectively (P < 0.01), and the MDA content decreased by 82.42%, 58.72%, and 69.61%. In summary, the sauce-flavored roxburghii can prevent high-fat diet-induced NAFLD by increasing SOD activity in the liver, inhibiting MDA levels, and promoting lipid metabolism.

[0123] (5) Effects of RFV on ALT and AST in NAFLD mice: Figure 10 As shown, both RFV and RRJ effectively reduced ALT and AST enzyme activities in hyperlipidemia mice, improving abnormally elevated enzyme activity caused by impaired liver function. The high-dose RFV group showed a significant effect (P < 0.01). Compared with the control group, ALT and AST levels in the NAFLD group were significantly elevated. RRJ downregulated ALT and AST activities by 38.27% and 47.25%, respectively. Both low- and high-dose RFV downregulated ALT by 25.89% and 60.03%, respectively, and AST by 36.93% and 53.56%, respectively, effectively inhibiting the activities of both enzymes. Both low- and high-dose RFV exhibited a dose-dependent response.

[0124] (6) Effects of sauce-flavored roxburghii on the insulin resistance index of NAFLD mice: Figure 11As shown, RFV and RRJ reduced the insulin resistance index in NAFLD mice, with the high-dose RFV group showing a significant improvement, demonstrating a dose-response relationship. Compared with the blank group, the insulin resistance index in the model group increased by 74.98%. Low- and high-dose RRJ and RFV reduced the insulin resistance index in NAFLD mice by 29.28%, 26.95%, and 45.85%, respectively.

[0125] (7) Effects of RFV on mouse liver pathomorphology: Figure 12-13 It can be seen from the observation of HE-stained pathological sections that the liver tissue and hepatocytes in the Control group were normal in size, the cell nuclei were round and neatly arranged, and the hepatic cords and sinusoids were clearly visible. In the NAFLD group, diffuse balloon-like vacuolar fatty degeneration of varying sizes was observed, the hepatocytes became larger in size, the fatty degeneration was severe, the cell nuclei were squeezed to one side by the fat droplets, a small amount of inflammatory infiltration was observed, and the hepatic sinusoids were significantly narrowed. In the RFV-H group, the fatty vacuoles were significantly reduced, and the cell nuclei showed no obvious abnormalities. Oil red staining can make the fat droplets in the tissue orange-red and the cell nuclei blue. Oil red staining showed that a large number of red fat droplets were accumulated in the NAFLD group, and the fat droplets were dark in color, while the RFV-L and RFV-H groups showed a significant reduction in fat droplets, indicating that RFV can significantly improve the fatty degeneration of the liver and reduce fat accumulation.

[0126] (8) Effect of rosa roxburghii on the expression of proteins in the AMPK / FASN / SREBP-1c signaling pathway: To study the effect of rosa roxburghii on the AMPK / FASN / SREBP-1c signaling pathway, the expression of AMPK, FASN and SREBP-1c in mouse liver tissue was determined by WB experiment. Figure 14 As shown in the figure [protein strip diagram (A), P-AMPK / AMPK (B), SREBBP-1c / β-actin (C) and FASN / β-actin (D)], compared with the Control group, the expression of AMPK phosphorylation P-AMPK in the NAFLD group was significantly inhibited (P < 0.05), while the expression of SREBP-1 and FASN was significantly increased (P < 0.05). After RFV intervention, AMPK was activated, and the phosphorylation expression was significantly increased (P < 0.05, P < 0.01), while the expression of SREBP-1c and FASN was significantly decreased. In conclusion, the sauce-flavored sea buckthorn can inhibit the expression of SREBP-1c and FASN by activating AMPK phosphorylation in the AMPK signaling pathway, reduce lipid accumulation and improve NAFLD.

[0127] 3. Effect of RFV on intestinal flora regulation in mice with non-alcoholic fatty liver disease (NAFLD)

[0128] The 16s rRNA technology was used to analyze the effects of sauce-flavored roxburghii on the structure, diversity and relative abundance of fecal intestinal flora in each group of mice, and to further explore the regulatory mechanism of sauce-flavored roxburghii on NAFLD.

[0129] ①Test method

[0130] Feces from each group of mice were collected and placed in sterile 10 mL centrifuge tubes, with 200 mg per tube. The tubes were stored at -80°C and analyzed under dry ice. Sequencing was performed on a Miseq PE300 platform using primers 338F: ACTCCTACGGGAGGCAGCAG and 806R: GGACTACHVGGGTWTCTAAT. Data were analyzed using SPSS 22.0 software; P < 0.05 indicated statistical significance.

[0131] ②Test results

[0132] (1) Analysis of Alpha Diversity of Mouse Intestinal Microbiota: The bacterial 16S rRNA gene sequences of fecal samples from each group of mice were sequenced to analyze the changes in the intestinal microbiota of mice and to understand the possible mechanism of RFV in regulating NAFLD mice. Figure 15 It can be seen that compared with the blank group, the Chao1 index (391) in the model group decreased significantly and the Simpson index (0.08) did not change significantly. However, after high-dose intervention with sauce-flavored sea buckthorn, the Chao1 index (465) and Simpson index (0.30) increased significantly.

[0133] (2) Effects of rosa roxburghii on the species level and relative abundance of intestinal flora in NAFLD mice: The bacterial 16S rRNA gene sequences of fecal samples of each group of mice were sequenced, and the flora structure was quantitatively compared at the phylum and genus classification levels. Figure 16-17As shown, at the phylum level, Firmicutes, Bacteroidetes, and Proteobacteria were the dominant bacterial groups in each group. Among them, Firmicutes had the highest relative abundance, which was Control (38.86%), NAFLD (90.43%), RRJ (87.21%), RFV-L (87.20%), and RFV-H (78.89%). The relative abundance of Bacteroidetes was Control (55.71%), NAFLD (0.57%), RRJ (0.32%), RFV-L (1.44%), and RFV-H (4.86%). Compared with the blank group, the Firmicutes in the model group increased significantly and the Bacteroidetes decreased significantly (P < 0.001). After high-dose intervention with rosa roxburghii, the Firmicutes decreased significantly and the relative abundance of Bacteroidetes increased significantly. The ratio of Firmicutes to Bacteroidetes (Firmicutes / Bacteroidetes, F / B) has been shown to be significantly correlated with imbalance in host metabolic homeostasis. The present invention quantitatively evaluated the intergroup differences in the F / B ratio between the groups. The F / B ratio reached the highest in the model group and gradually decreased after low- and high-dose intervention with RFV, especially in the high-dose group (P < 0.01). In summary, sauce-flavored roxburghii can reduce the abundance of Firmicutes in NAFLD, increase the relative abundance of Bacteroidetes, and significantly reduce the F / B ratio. Compared with other treatment groups, the high-dose sauce-flavored roxburghii resulted in a community composition similar to that of the blank group, which, to some extent, alleviated the NAFLD-induced microbial disturbance. At the genus level, significant differences in relative abundance among the groups were identified. Compared with the blank group, the relative abundance of Allobaculum, Faecalibaculum, Dubosiella, Blautia, and unclassified Lachnospiraceae in the fecal microbiota of mice in the model group increased (P < 0.5), while the relative abundance of Coriobacteriaceae (UCG-002) and Lactobacillus decreased (P < 0.5).Compared with the model group, RRJ significantly restored the relative abundance of Lactobacillus (P < 0.5), and RFV-H significantly restored the relative abundance of Allobaculum, Faecalibaculum, Dubosiella, Blautia, and Coriobacteriaceae_UCG-002 in NAFLD mice. In summary, RRJ and RFV can restore the relative abundance of the disturbed intestinal microbiota in NAFLD mice. Note: Relative abundance of F and B in each group at the phylum level (A) and F / B ratio (B); relative abundance of Allobaculum (C), Blautia (D), UCG-002 (E), Dubosiella (F), Faecalibaculum (G), and unclassified Lachnospiraceae (H) in each group at the genus level.

[0134] Beneficial effects of the present invention:

[0135] (1) The sauce-flavored sea buckthorn is fermented by combining liquid fermentation with solid-state fermentation, and using a segmented microbial fermentation method to solve the problem of the "sour and bitter" taste of sea buckthorn, thereby retaining the inherent health properties of sea buckthorn to the greatest extent, while having an elegant, delicate, mellow and silky sauce-flavored flavor.

[0136] (2) Fresh roxburghii fruit is steamed before fermentation. On the one hand, high-temperature steam is used to kill microorganisms on the surface of roxburghii fruit, and targeted enhancement is achieved by adding microbial agents later. On the other hand, raw roxburghii fruit is cold, and the coldness is weakened after steaming, making it more suitable for people with spleen and stomach deficiency. At the same time, steam treatment destroys the cell wall structure of roxburghii fruit, promotes the release of active substances such as polysaccharides and polyphenols, enhances its immune regulation and antioxidant functions, and blocks the activity of ascorbic acid oxidase, reducing the loss of vitamin C during the later fermentation process.

[0137] (3) Efficacy verification tests have shown that the sauce-flavored sea buckthorn pear can activate the phosphorylation expression of adenylate-activated protein kinase in mice, reduce fatty acid synthase, inhibit the expression of lipogenesis genes, thereby inhibiting the de novo synthesis of fatty acids, reducing lipid accumulation in the liver, regulating the intestinal flora related to lipid accumulation and energy metabolism, and achieving the effect of regulating non-alcoholic fatty liver disease.

[0138] It should be noted that, in this document, the terms "comprises," "includes," or any other variations thereof are intended to encompass non-exclusive inclusion, such that a process, apparatus, article, or method comprising a series of elements includes not only those elements but also other elements not explicitly listed, or elements inherent to such process, apparatus, article, or method. In the absence of further limitations, an element defined by the phrase "comprising a ..." does not exclude the presence of other identical elements in the process, apparatus, article, or method comprising the element.

[0139] The above description is only a preferred embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made by using the contents of the present invention description and drawings, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A preparation process for a sauce-flavored roxburghii, characterized in that: The product is prepared using a fermentation process consisting of a 1-year fermentation cycle, 2 fermentation methods, 9 fermentation steps, and 8 fermentation environmental parameters. The preparation process specifically includes: S1, steam processing: wash the fresh roxburghii fruit, remove the stems and blow dry, put it into a steam steamer at a temperature of 90-100 ° C and cook for 10-30 minutes, spread it out and blow dry the surface moisture at low temperature for later use; S2, liquid fermentation: the steam-processed roxburghii fruit obtained in step S1 is mixed according to 40-60 parts of roxburghii fruit, 40-60 parts of water, and 8-15 parts of white sugar, crushed and beaten, and loaded into a fermentation ceramic jar, and mixed strains are added to the fermentation container respectively, and the fermentation workshop temperature is controlled to 20-25° C. and aerobic fermentation is carried out for 1-3 months; wherein the mixed strains are composed of yeast and lactic acid bacteria; S3, separation and juicing: after the liquid fermentation of step S2 is completed, the supernatant is collected for standby use, the lower part is separated by a belt press, the liquid part is combined with the supernatant and naturally clarified to obtain a liquid fermentation sauce-flavored roxburghii stock solution, and the moisture content of the solid part is controlled to 30-40%, which is used as liquid fermentation residue for standby use; S4, mixing koji: the liquid fermentation residue obtained in step S3 is uniformly mixed according to 40-60 parts of liquid fermentation residue, 20-30 parts of bran, and 10-15 parts of Maotai-flavor Daqu, and stirred every 3 minutes. The mixture is fermented at 20-25°C for 10-15 days until white mycelium grows, and then the mixture is placed in an open fermentation jar and pressed and sealed with 1-3 parts of salt. S5, solid-state fermentation: the open fermentation jar is transferred to an open-air fermentation drying yard, and solid-state fermentation is carried out for 6-8 months to obtain the sauce-flavored roxburghii solid-state fermented mash; S6, extracting juice by leaching: crushing the sauce-flavored roxburghii solid-state fermented mash obtained in step S5 and putting it into a soaking tank of a vinegar leaching device, with each layer of 20-30 cm, adding water of 75-80° C. to the soaking tank to cover 3-5 cm above the sauce-flavored roxburghii solid-state fermented mash, soaking for 5-8 hours, and slowly releasing a leaching liquid; adding water of 50-75° C. to the vinegar mash again to cover 3-5 cm above the sauce-flavored roxburghii solid-state fermented mash, soaking for 2-3 hours, collecting a second leaching vinegar, and mixing the first leaching liquid and the second leaching vinegar to obtain a solid-state fermentation leaching vinegar liquid; S7, sun exposure and concentration: the sauce-flavored roxburghii solid fermentation liquid obtained in step S6 is placed in an open jar, moved to an open-air fermentation drying yard, the open jar is covered with tempered glass, and sun-exposed for 3-5 months for esterification and concentration to obtain the solid-state fermented sauce-flavored roxburghii stock liquid; S8, blending ratio: blending the liquid fermented sauce-flavored roxburghii stock solution obtained in step S2 and step S7 with the solid-state fermented sauce-flavored roxburghii stock solution in a certain ratio to obtain the sauce-flavored roxburghii fermented stock solution.

2. The preparation process of the sauce-flavored roxburghii according to claim 1, wherein In step S1, the fresh fruit variety of roxburghii is Guinong No. 5, Guinong No. 7 or golden roxburghii.

3. The preparation process of the sauce-flavored roxburghii according to claim 1, wherein In step S2, the yeast is any one or a combination of Saccharomyces boulardii, Saccharomyces cerevisiae, Saccharomyces odorifera, Saccharomyces weigensis, Hansenula anomala, Schizosaccharomyces pombe, Rhodotorula glutinosus, Pichia pastoris, Candida glycerogenes and Candida utilis.

4. The preparation process of the sauce-flavored roxburghii according to claim 1, wherein In step S2, the lactic acid bacteria are any one or a combination of Lactobacillus plantarum, Lactobacillus acidophilus, Streptococcus thermophilus, Lactobacillus gasseri, Bifidobacterium and Lactobacillus reuteri.

5. The preparation process of the sauce-flavored roxburghii according to claim 1, wherein The one-year fermentation cycle is that the materials are added for fermentation from August to October each year, and the fermentation is completed from August to October of the second year, which requires a one-year cycle.

6. The preparation process of the sauce-flavored roxburghii according to claim 1, wherein The two fermentation methods are liquid fermentation and solid fermentation.

7. The preparation process of the sauce-flavored roxburghii according to claim 1, wherein The eight fermentation environment parameters are the temperature, latitude, air cleanliness, wind speed, concentration of negative oxygen ions in the air, altitude, water cleanliness, and ultraviolet radiation of the open-air fermentation drying yard during the fermentation process of the sauce-flavored sea buckthorn; among them, the annual average temperature of the open-air fermentation drying yard environment is 20-25°C; the latitude is 26-28° north latitude; the air cleanliness is the excellent rate of the air quality of the open-air fermentation drying yard environment, which is 98-99% on average throughout the year; the wind speed is 2-3 meters per second on average throughout the year; the concentration of negative oxygen ions in the air is 20,000 to 30,000 negative oxygen ions per cubic meter of air; the altitude is 800-1500 meters above sea level; the water cleanliness is 100%; and the ultraviolet radiation is 3600-3900 megajoules per square meter on average throughout the year.

8. A sauce-flavored roxburghii drink, characterized in that: The fermented roxburghii sauce-flavored liquor prepared by the preparation process according to any one of claims 1 to 7 is prepared by adding food processing auxiliary materials; The sauce-flavored roxburghii drink has a sauce-flavored flavor that is expressed by the synergistic effect of 30-40% ester compounds, 33-38% alcohol compounds, and 20-25% acid compounds. The active ingredients in the sauce-flavored sea buckthorn beverage are any one or more of quercetin, ellagic acid and gallic acid.

9. An application of the sauce-flavored roxburghii drink according to claim 8, characterized in that: The sauce-flavored roxburghii beverage is used in the preparation of health foods, health products, and medicines for regulating or improving non-alcoholic fatty liver disease.

Images