A polypeptide specifically targeting vascular marker molecule vegfr2 and application thereof

Abstract

The application belongs to the technical field of biological medicine, and discloses a polypeptide specifically targeting a vascular marker molecule VEGFR2 and application thereof, wherein the amino acid sequence of the polypeptide is as follows: i) an amino acid sequence as shown in SEQ ID NO. 1; or ii) an amino acid sequence obtained by connecting a label to the N terminal or the C terminal of i); or iii) a functional polypeptide obtained by substituting, deleting and / or adding one or more amino acids in the amino acid sequence of i) or ii). The polypeptide provided by the application can target VEGFR2 positive cells, has high selectivity, and can be used as a target head of a targeted drug to increase the content of the drug in human tumor vascular marker molecule VEGFR2 positive cells. The polypeptide has high targeting property, simple preparation method and low cost, and therefore has good practical application value.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to a polypeptide specifically targeting a vascular marker molecule VEGFR2 and application thereof. BACKGROUND

[0002] Malignant tumors seriously threaten human life and health, and are one of the main causes of human abnormal death in the world. In recent decades, the incidence and mortality rate of malignant tumors continue to rise. Traditional treatments such as surgery, radiotherapy and chemotherapy can kill most tumor cells, but are prone to recurrence and metastasis, and have great toxic side effects, resulting in low quality of life of patients.

[0003] Tumor angiogenesis plays a key role in the development process of tumors. In the early stage of tumor growth, the tumor mainly relies on diffusion to obtain nutrients, grows slowly and is not easy to metastasize; when the speed of nutrient acquisition is lower than the required consumption, the tumor and its surrounding interstitial cells will express vascular growth factors to induce endothelial cells to generate microvessels to the tumor cell site to meet the growth needs of the tumor and promote tumor invasion. As a key pathway for the metabolism of solid tumors, tumor blood vessels are also the basis for tumor growth and metastasis, and the number of microvessels is closely related to the growth and metastasis of tumors. Based on the theory of “starving the tumor”, anti-angiogenic therapy has become a new field of tumor treatment, and targeted therapy for tumor neovasculature has become a popular field of research on malignant solid tumors.

[0004] Vascular endothelial growth factor receptor 2 (VEGFR2) is a transmembrane tyrosine kinase receptor encoded by the human KDR gene, and its molecular structure includes 7 extracellular immunoglobulin-like domains, a single transmembrane region and an intracellular kinase activity region. As a cell surface receptor for VEGF and a core mediator of signal transduction, VEGFR2 activates downstream PI3K-AKT, RAS-MAPK and other key pathways through ligand-induced dimerization, and plays a crucial role in angiogenesis, vascular development, vascular permeability and regulation of embryonic hematopoiesis. In pathological conditions, abnormal activation of VEGFR2 is closely related to solid tumor angiogenesis, and its overexpression level has been confirmed to be positively correlated with poor prognosis of patients with lung cancer, colorectal cancer and the like.

[0005] Traditional antibody drugs have a large number of applications in the field of cancer diagnosis and treatment, but their further development is limited due to inherent defects.

[0006] First, traditional VEGFR2 inhibitors have inherent pharmacodynamic defects. Monoclonal antibodies (such as ramucirumab) can specifically bind to the extracellular domain of VEGFR2, but their large molecular weight (> 150 kDa) leads to poor tissue penetration, making it difficult to penetrate the dense stroma of solid tumors to reach the target, resulting in uneven drug distribution within the tumor, especially in the hypoxic core region, significantly affecting efficacy; complement-dependent cytotoxicity (CDC) and antibody-dependent cellular phagocytosis (ADCP) effects mediated by the Fc segment can trigger unintended immune clearance, increasing the burden on liver and kidney function; in addition, antibody drugs are difficult to perform site-specific chemical modification, limiting their application in multi-modal diagnosis and treatment integration. Second, existing small molecule tyrosine kinase inhibitors (TKIs) face the problems of insufficient selectivity and drug resistance. TKIs such as sunitinib can inhibit the intracellular kinase activity of VEGFR2, but their target points cover PDGFR, c-kit and other pathways, leading to serious off-target toxicities such as hypertension and hand-foot syndrome; at the same time, tumor cells develop acquired resistance through VEGFR2 gene amplification or ATP-binding pocket mutations (such as V848I, R1051Q), resulting in a decrease in drug response rate of more than 50% within 6 months of treatment. Third, targeted diagnostic probes cannot balance high sensitivity and treatment expandability. Current clinical VEGF / VEGFR2 detection tools (such as ELISA kits, fluorescently labeled antibodies) can only achieve static concentration monitoring and cannot track receptor activation status in real time; while nanobody-based molecular imaging probes have higher tissue resolution, but their rigid structure makes it difficult to modularly couple with chemotherapy drugs or radionuclides, restricting the development of "diagnosis-treatment" combined systems.

[0007] Moreover, the preparation of monoclonal antibodies is complicated, requiring mammalian cell expression systems, involving complex cell culture, glycosylation modification and multi-step purification processes, requiring long-term cell culture and multi-step purification, with a production cycle of 3-6 months and high single-batch cost. To improve the specificity and accuracy of cancer diagnosis and treatment, and to compensate for the shortcomings of antibodies, new solutions are urgently needed.

[0008] Polypeptide-based targeting small molecule drugs and diagnostic probes have shown great advantages. They have small and controllable molecular weights, can be produced in large quantities by solid-phase synthesis of short peptide chains of 12-18 amino acids (molecular weight <2 kDa), do not require cell culture, have short synthesis cycles (1-2 weeks), high purity (more than 95%), and only 1 / 10-1 / 20 of the cost of antibodies, greatly reducing production costs. Polypeptides have good biocompatibility, strong penetration, and no immunogenicity. Polypeptides have significantly better penetration than antibodies, can quickly and evenly distribute in tumor vascular endothelial cells, and improve the target coverage of VEGFR2-positive cells. Polypeptides have no Fc segment and very low immunogenicity; they can be coupled with fluorescent groups, radionuclides, or liposomes and other drug carriers through the N / C terminal to achieve intraoperative navigation + targeted drug delivery and other "diagnosis-treatment" integrated designs. Polypeptides can be optimized for pharmacokinetic properties through rational design, such as using non-natural amino acid substitution and disulfide bond cyclization strategies to eliminate protease cleavage sites, extend the plasma half-life to >8 hours, and significantly improve plasma stability; modular structures support multifunctional integration, allowing different functional groups to be coupled at the ends of the targeting sequence to achieve intraoperative navigation and prodrug system construction. Therefore, using high-throughput polypeptide libraries to screen specific targeting polypeptides and developing them into tumor diagnosis and targeted therapy drugs has wide application value. SUMMARY

[0009] The present application aims to overcome the deficiencies in the prior art and provide a polypeptide specifically targeting the vascular marker molecule VEGFR2 and its application.

[0010] The technical solution adopted by the present application to solve its technical problems is:

[0011] A polypeptide specifically targeting the vascular marker molecule VEGFR2, the amino acid sequence of the polypeptide is as follows:

[0012] i) the amino acid sequence shown in SEQ ID NO. 1;

[0013] or ii) a polypeptide with the same function obtained by substituting, deleting, and / or adding one or more amino acids to the amino acid sequence of i).

[0014] A divalent / multivalent body formed by the polypeptide.

[0015] A biological material containing the divalent / multivalent body, the biological material being a transgenic cell line, an engineered bacterium, a viral vector, a plasmid vector, an expression cassette, a recombinant DNA, or a transposon.

[0016] The application of the polypeptide and / or the divalent / multivalent body as described above, which is one or more of the following:

[0017] 1) Use in the preparation of drugs for preventing and / or treating diseases related to abnormal VEGFR2 expression;

[0018] 2) Application in the preparation of detection reagents for diseases related to abnormal VEGFR2 expression;

[0019] 3) Application in the preparation of molecular imaging agents for diseases associated with abnormal VEGFR2 expression.

[0020] A polypeptide conjugate targeting the vascular marker molecule VEGFR2, wherein the polypeptide conjugate is obtained by coupling a polypeptide and / or a bivalent / multivalent with a carrier and / or a signaling unit;

[0021] Wherein, the polypeptide is the polypeptide according to claim 1; the bivalent / multivalent is a bivalent / multivalent formed by the polypeptide according to claim 1;

[0022] The carrier and / or signal unit is selected from at least one of quantum dots, ultrasonic microbubbles, magnetic nanoparticles, superparamagnetic materials, lectins, drugs, toxins, cytokines, radioisotopes, carrier proteins, antibodies, enzymes or high-absorption coefficient chromophores.

[0023] Furthermore, the carrier is a fluorescent group; preferably, the fluorescent group is fluorescein isothiocyanate and / or tetramethylrhodamine isothiocyanate.

[0024] A pharmaceutical composition comprises a preparation capable of killing cancer cells and the polypeptide and / or the bivalent / multivalent.

[0025] A kit for detecting vascular cells on the surface of human solid tumors or the vascular marker molecule VEGFR2, comprising the polypeptide or the bivalent / multivalent or the polypeptide conjugate.

[0026] Use of the polypeptide or bivalent / multivalent as described above in the preparation of an imaging preparation for treating and / or preventing and / or diagnosing cancer.

[0027] Furthermore, the cancer is a cancer in which the vascular marker molecule VEGFR2 protein is overexpressed.

[0028] The advantages and positive effects achieved by the present invention are:

[0029] 1. The polypeptides provided by this invention can target VEGFR2-positive cells with strong selectivity and can be used as target heads for targeted drugs to increase drug levels in cells positive for VEGFR2, a human tumor vascular marker. The polypeptides provided by this invention have strong targeting, simple preparation methods, and low cost, thus possessing excellent practical application value.

[0030] 2. The polypeptide of the present invention can achieve efficient orthogonal coupling with different chemical groups (such as infrared fluorescent dye DiD).

[0031] 3. The polypeptide of the present invention utilizes solid phase synthesis technology to synthesize a short peptide chain of 12-18 amino acids (molecular weight <2kDa) with strong cell penetrating ability. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Schematic diagram of the construction of a peptide library for screening peptides targeting the vascular marker molecule VEGFR2 in the present invention;

[0033] Figure 2 This is a hydrophilicity analysis diagram of the VEGFR2-1 polypeptide of the present invention;

[0034] Figure 3 This is a surface plasmon resonance imaging sensorgram of the interaction between the VEGFR2-1 polypeptide and VEGFR2 in the present invention;

[0035] Figure 4 This is a diagram of the endocytosis of the VEGFR2-1 polypeptide covalently coupled to the DiD fluorescent dye in the present invention in HUVEC cells and A549 cells. DETAILED DESCRIPTION

[0036] The present invention will be further described below with reference to the following examples. The following examples are descriptive rather than restrictive, and the scope of protection of the present invention cannot be limited by the following examples.

[0037] The various experimental operations involved in the specific embodiments are all routine techniques in the field. For parts not specifically annotated in this document, ordinary technicians in this field can refer to various commonly used reference books, scientific literature or related instructions, manuals, etc. before the filing date of this invention to implement them.

[0038] In a first aspect, a polypeptide VEGFR2-1 targeting the vascular marker molecule VEGFR2 has more than 8 consecutive amino acid residues in the amino acid sequence shown in SEQ ID NO.1, and the polypeptide contains no more than 24 amino acid residues.

[0039] LSLGRFDVRLNQ (SEQ ID NO. 1).

[0040] In some embodiments, the amino acid sequence of the polypeptide targeting the vascular marker molecule VEGFR2 provided by the present invention or a pharmaceutically acceptable salt thereof has at least 70% or 75% or 80% or 85% or 90% or 95% sequence identity with the amino acid sequence of SEQ ID NO.1; preferably, it has 95% sequence identity.

[0041] Furthermore, the amino acid residues constituting the polypeptide are L-type and / or D-type. Preferably, the amino acid residues are L-type.

[0042] In a second aspect, the present invention provides a polypeptide derivative, which is a modified product of the polypeptide described in the first aspect or a variant obtained by adding and / or replacing one or more amino acids.

[0043] Furthermore, the polypeptide of the present invention further contains a substituent, which is one or more of an acetyl group, an amino group, an alkanoyl group, an alkoxy group, an aromatic group, a fatty acid group, a sugar group, a phosphate group, a sulfate group, an amide group or a peptide linking group.

[0044] In a third aspect, the present invention provides bivalents and / or multivalents formed by the aforementioned polypeptides.

[0045] The bivalent and / or multivalent body has the characteristic of targeting the vascular marker molecule VEGFR2. The targeted vascular marker molecule VEGFR2 is mainly the vascular marker VEGFR2 protein on the surface of endothelial vascular cells and tumor cells.

[0046] In some embodiments, the bivalent and / or multivalent bodies can be formed by covalently linking linker molecules.

[0047] In some embodiments, the bivalent and / or multivalent bodies described in the present invention can also be mixed with polymers to form polypeptide assemblies through hydrophilic and hydrophobic non-covalent linkages.

[0048] Furthermore, the polymer is selected from polylactic acid-ethanol (PLGA), polyvinyl alcohol (PVA), amine polyethylene glycol (PEG)

[0049] and at least one of liposomes or micelles.

[0050] The polypeptides, bivalents and / or multivalents described in the present invention have the property of targeting the vascular marker molecule VEFGR2, and can be used as target heads to increase the content of drugs or drug-loaded carriers such as nanomaterials, liposomes, etc. in VEGFR2-positive cells, and then added with pharmaceutically acceptable excipients or adjuvants to produce new and more effective targeted anti-cancer drugs.

[0051] Furthermore, the pharmaceutical excipients may be excipients, such as solubilizers (polysorbate, etc.), disintegrants (microcrystalline cellulose, etc.), binders (sodium carboxymethyl cellulose, etc.), preservatives (benzyl alcohol, etc.), fillers (starch, etc.); they may also be small molecule organic materials (stearic acid, etc.), synthetic polymer materials (polycyanoacrylate, etc.), natural polymer materials (lipids, etc.), etc.

[0052] In a fourth aspect, a polypeptide targeting the vascular marker molecule VEGFR2 is used in the preparation of a drug, wherein the drug is an anti-angiogenic drug or an anti-tumor drug.

[0053] Furthermore, the drug is any one of biological drugs, chemical drugs, radioactive drugs, nano drugs, photodynamic therapy drugs or photothermal therapy drugs that can kill cancer cells, or carriers encapsulating these drugs.

[0054] Furthermore, the dosage form of the drug is tablets, lyophilized powder injections, granules, injections, etc.

[0055] Furthermore, the drug is administered orally, intramuscularly, intravenously, subcutaneously, and the like.

[0056] In a fifth aspect, the present invention further provides an imaging preparation comprising an imaging agent and the aforementioned polypeptide and / or the aforementioned bivalent and / or multivalent.

[0057] Furthermore, the imaging agent is any one of a molecular imaging agent, a radionuclide marker or a radionuclide.

[0058] In a sixth aspect, the present invention further provides a polypeptide conjugate, which is obtained by conjugating the aforementioned polypeptide with a carrier.

[0059] Furthermore, the carrier may be one or more of a fluorescent group, a toxin, a carrier protein, an antibody, a cytokine or a high absorption coefficient chromophore.

[0060] Furthermore, the fluorescent group is fluorescein isothiocyanate, tetramethylrhodamine or tetramethylrhodamine isothiocyanate.

[0061] Specifically, the relevant preparation and detection are as follows:

[0062] Example 1 Construction of a peptide library and screening of VEGFR2-targeting peptides

[0063] 1. Selection

[0064] Using VEGFR2 protein, screen the NEB random peptide library: Ph.D.-12 phage display peptide library kit (#E8110S) to obtain 1-5 or more positive clones.

[0065] Phage panning data:

[0066]

[0067] 2. Phage ELISA identification

[0068] 2.1 Preparation of Phage supernatant

[0069] (1) Take 10 μL of overnight cultured ER2738 bacterial solution (OD 600 ≈3.0) was added to 990 μL LB liquid medium (formula: 10 g tryptone, 5 g yeast extract, 10 g NaCl / L, pH 7.0) and diluted at 1:100 (v / v, volume ratio) and dispensed into centrifuge tubes (1 mL each).

[0070] (2) Pick a single clone and place it in a centrifuge tube.

[0071] (3) Incubate at 37°C, 220 rpm for 4.5-5 h.

[0072] (4) Centrifuge at 14,000 rpm for 30 s at 4°C and transfer the supernatant to a new centrifuge tube. Centrifuge again at 14,000 rpm for 30 s and transfer 80% of the supernatant to a new centrifuge tube, which is the Phage supernatant.

[0073] 2.2 Phage ELISA

[0074] (1) Coating: Dilute VEGFR2 protein to a concentration of 2 μg / mL using 0.05 M carbonate coating buffer (pH 9.6), add it to a 96-well plate, and incubate overnight at 4°C for coating.

[0075] (2) Blocking: Block with 2% skim milk powder, 200 μL / well, incubate at 37°C for 1 h.

[0076] (3) Primary antibody: Add Phage supernatant, 100 μL / well, and incubate at 37°C for 1 h.

[0077] (4) Secondary antibody: Add anti-M13 antibody (HRP), dilute 1:20,000 (diluent: 1% BSA / TBST), 100 μL / well, and incubate at 37°C for 1 h.

[0078] (5) Color development: Add 100 μL / well of TMB color development solution and incubate at 37°C for 15 min.

[0079] (6) Stop: Add 100 μL / well of stop solution.

[0080] (7) Plate reading: Read the absorbance at 450 nm using a microplate reader.

[0081] (8) Fifteen positive clones were selected from the Ph.D.-12 library and tested for His-tagged protein Phage ELISA.

[0082] (9) Five positive clones that did not react with the His-tagged protein were selected from the 15 positive clones for single-stranded DNA extraction and sequencing.

[0083] 3. Single-stranded DNA extraction and sequencing

[0084] 3.1 Single-stranded DNA extraction and sequencing

[0085] (1) Take 10 μL of overnight cultured ER2738 bacterial solution (OD 600 ≈3.0) was added to 990 μL LB liquid medium (formula: 10 g tryptone, 5 g yeast extract, 10 g NaCl / L, pH 7.0) at a dilution ratio of 1:100 (v / v) and aliquoted into centrifuge tubes (1 mL each).

[0086] (2) Pick a single clone and place it in a centrifuge tube.

[0087] (3) Incubate at 37°C, 220 rpm for 4.5-5 h.

[0088] (4) Centrifuge at 14,000 rpm for 30 s at 4°C and transfer the supernatant to a new centrifuge tube; centrifuge again at 14,000 rpm for 30 s and transfer 500 μL of the supernatant to a new centrifuge tube.

[0089] (5) Add 200 μL of 20% polyethylene glycol / 2.5 M NaCl solution, mix thoroughly by inverting, and let stand at room temperature for 20 min.

[0090] (6) Centrifuge at 4°C, 14,000 rpm for 10 min and discard the supernatant (phage precipitate may not be visible).

[0091] (7) Centrifuge briefly and discard the supernatant.

[0092] (8) Add 100 μL of Iodide Buffer (NaI buffer), resuspend and mix to lyse the phage and release the single-stranded DNA. Add 250 μL of ethanol and incubate at room temperature for 20 min.

[0093] (9) Centrifuge at 4°C, 14000 rpm for 10 min and discard the supernatant. Wash twice with 0.5 mL of 70% ice ethanol and

[0094] Centrifuge at 14,000 rpm for 10 min, discard the supernatant, and dry for 3-5 min.

[0095] (10) Resuspend in 30 μL of TE buffer and store at -20°C.

[0096] (11) Use 96 sequencing primer to sequence and verify the single-stranded DNA.

[0097] 3.2 Sequencing results analysis

[0098] The single-stranded DNA of the positive clones obtained by screening was sequenced and analyzed to verify the sequencing results and perform hydrophilicity analysis.

[0099] Figure 1 This is a schematic diagram of peptide library construction. Figure 2 This is a hydrophilicity analysis chart. The base sequence of the target peptide LSLGRFDVRLNQ (12 aa) is CTTAGTCTGGGGCGTTTTGATGTGCGGCTGAATCAG, which completely matches the Ph.D.-12 library (NNK). 12 GGT GGA GGT Frame Design ( Figure 1 ), and shows the accuracy of sequence design. Among them, the NNK codon (K=G / T) successfully avoids the stop codon (for example, the 7th Val is encoded by GTA, corresponding to CAT in the complementary chain NNM, avoiding TAG / TGA). The glycine triplet (GGT-GGA-GGT) is located at the C-terminus, showing flexible structural characteristics. Moreover, the hydrophobic residues in the sequence account for only 25% (Leu2 / Val7), which is different from Figure 2 The hydrophilicity analysis results are consistent. The sequence length is strictly controlled below 24 aa (actually 12 aa), the solid phase synthesis efficiency is high, and the cost is significantly reduced compared to peptides over 30 aa. Hydrophilicity analysis chart ( Figure 2 ) shows a Kyte-Doolittle range of 4.5 to -4.5, indicating the presence of alternating hydrophilic and hydrophobic regions, which can enhance the peptide's solubility and binding ability. The Antigenic Index ranges from 1.7 to -1.7, indicating the presence of highly antigenic regions, making them suitable as epitopes. The Emini Surface Probability ranges from 1 to 6, indicating that certain regions are more likely to be exposed on the protein surface, enhancing binding to the target.

[0100] Example 2 SPR experiment of protein-protein interaction

[0101] (1) The peptide of the successfully sequenced VEGFR2-1 phage clone was synthesized (SEQ ID NO.1: LSLGRFDVRLNQ), and the affinity of VEGFR2-1 peptide at different concentrations to VEGFR2 was determined using surface plasmon resonance (SPR) technology.

[0102] (2) Add the diluted antibodies, negative controls, antigens, and buffer to the well plate and arrange them at 100 μL / well to avoid bubbles. The specific process is as follows:

[0103] Definition of experimental groups and concentration requirements: Antibody group: anti-His tag monoclonal antibody, concentration of 10 μg / mL, dissolved in 1× PBS (pH 7.4), used to capture His-tag antigen; Antigen group: recombinant human VEGFR2-His protein, concentration gradient of 0.5 μg / mL, dissolved in PBS + 0.05% Tween 20 (pH 7.4); Negative control group: BSA-His (concentration 0.5 μg / mL, consistent with the antigen group buffer), used to exclude nonspecific binding; Buffer group: PBS + 0.05% Tween 20 + 1 mM EDTA (pH 7.4), used for baseline balance and non-binding signal subtraction; Analyte group: VEGFR2-1 polypeptide (SEQ ID NO.1), serial dilution concentration gradient of 3.125-200 nM (dissolved in running buffer).

[0104] (3) Install the pre-activated NTA sensor; select the program sensor ID that is consistent with the sensor and match the well position, and set the program as follows: Baseline 3 (buffer) 60 s, 1000 speed; Loading (antibody) 120 s, 1000 speed; Baseline 3 (buffer) 60 s, 1000 speed; Association (antigen) 180 s, 1000 speed; Dissociation (buffer) 360 s, 1000 speed;

[0105] (4) Click Start to run; calibrate the data and export the binding curve

[0106]

[0107] Figure 3 The sensorgrams show the interaction between VEGFR2-1 peptide and VEGFR2 at different concentrations. The affinity of the intermolecular interaction was determined by measuring the binding ability of the VEGFR2-1 peptide to a fixed concentration of the target (VEGFR2 protein). The highest affinity was achieved at appropriate concentrations (e.g., 12.5 nM and 25 nM), with KD values ​​of 1789 nM. This indicates that the VEGFR2-1 peptide has a strong affinity for VEGFR2. These results suggest that the provided VEGFR2 targeting peptide has a strong affinity for the target protein.

[0108] Example 3 VEGFR2-1 cell targeting experiment

[0109] (1) Human umbilical vein endothelial cells (HUVEC cells) with high expression of VEGFR2 and human non-small cell lung cancer epithelial cells (A549 cells) with low expression of VEGFR2 were cultured in 6-well plates, and 2 ml of DMEM medium containing 10% fetal bovine serum was added to each well. The initial cell seeding density was 1×10 4 The culture conditions were 5% CO2, 37℃ constant temperature incubator for 24h.

[0110] (2) DiD fluorescent dye labeling: NHS ester covalent coupling was used (molar ratio 1:5, VEGFR2-1 peptide:DiD), with labeling efficiency >90% (HPLC verification), and free DiD was filtered through an ultrafiltration column. Subsequently, 50 mM DiD-coupled peptide was added to each well and incubated at 37°C in the dark for 30 min.

[0111] (3) The cells were washed with 1× PBS pre-cooled at 4°C and fixed with 4% paraformaldehyde (PFA) at room temperature for 20 minutes, followed by DAPI nuclear staining.

[0112] (4) Fluorescence images were captured using a fluorescence microscope (Axio Imager M2, Zeiss, Germany) to detect the fluorescence distribution in the cells.

[0113] The experimental results are as follows Figure 4 As shown, the polypeptides provided by the present invention can efficiently bind to human umbilical vein endothelial HUVEC cells that highly express VEGFR2 and enter the cells through endocytosis; however, they show little binding to human non-small cell lung cancer epithelial A549 cells that lowly express VEGFR2. These experiments demonstrate that the targeting peptides provided by the present invention can specifically target vascular endothelial cells and bind efficiently.

[0114] In summary, the polypeptides of the present invention have excellent VEGFR2 targeting and penetration into cells expressing high VEGFR2. Furthermore, through covalent coupling with fluorescent dyes, they enable highly sensitive in vivo imaging of microscopic tumor vascular tissue. In practical applications, the polypeptides of the present invention can be combined with anticancer drugs or imaging agents for targeted tumor therapy and imaging.

[0115] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A polypeptide that specifically targets the vascular marker molecule VEGFR2, characterized by: The amino acid sequence of the polypeptide is as follows: i) The amino acid sequence shown in SEQ ID NO.

1.

2. The use of the polypeptide according to claim 1, characterized in that: The application is: use in preparing a detection reagent for cancers in which VEGFR2 protein is overexpressed.

3. The use of the polypeptide according to claim 1, characterized in that: The application is: use in preparing a molecular imaging agent for cancers with overexpression of VEGFR2 protein.

4. A polypeptide conjugate targeting the vascular marker molecule VEGFR2, characterized by: The polypeptide conjugate is obtained by coupling the polypeptide with a carrier and / or a signal unit; Wherein, the polypeptide is the polypeptide described in claim 1; The carrier is selected from lectins and carrier proteins, and the signal unit is selected from quantum dots, ultrasonic microbubbles, magnetic nanoparticles, superparamagnetic materials, radioisotopes, enzymes, and high absorption coefficient chromophores; at least one of the carriers and / or signal units is selected to be coupled with the polypeptide.

5. A kit for detecting vascular cells or vascular marker molecule VEGFR2 on the surface of human solid tumors, characterized in that: Comprising the polypeptide according to claim 1 or the polypeptide conjugate according to claim 3.

6. Use of the polypeptide according to claim 1 in the preparation of an imaging preparation for diagnosing cancer; The cancer is a cancer in which the vascular marker molecule VEGFR2 protein is overexpressed.

Images