Recombinant IV type collagen as well as preparation method and application thereof

Abstract

The invention discloses a recombinant IV-type collagen as well as a preparation method and application thereof. The recombinant IV-type collagen is prepared by repeating a sequence as shown in SEQ ID NO.1 for n times (1lt; the recombinant IV-type collagen can effectively promote skin basilar membrane cells to express IV, VII and XVII-type collagen, can repair and reinforce skin barriers, so that the compactness and elasticity of skin are improved, basilar membrane repair is facilitated, the recombinant IV-type collagen can be effectively used for preparing anti-aging products, and the anti-aging effect is good. Wide application prospects are realized in the fields of medical instruments, beauty and skin care and the like. The invention also discloses a method for expressing the recombinant IV type collagen by recombinant escherichia coli, and the method provided by the invention has the advantages of high protein yield, high purity and high yield, and lays a foundation for industrial large-scale production.

Description

Technical Field

[0001] The present invention belongs to the technical field of synthetic biology, and in particular relates to a recombinant type IV collagen and a preparation method and application thereof. Background Art

[0002] Collagen is a core component of the extracellular matrix (ECM), providing structural support and signaling for cells. The collagen superfamily includes 28 types (types I-XXVIII) in vertebrates (Ricard-Blum S. The collagen family. Cold Spring Harb Perspect Biol. 2011 Jan 1; 3(1):a004978. doi:10.1101 / cshperspect.a004978. PMID:21421911; PMCID:PMC3003457.). Due to its biodegradability, low immunogenicity, and ability to promote cell proliferation and differentiation, it is highly favored in biomedical and cosmetic applications. Type IV collagen is a special type of collagen. Unlike collagen types I, II, and III, it forms a macromolecular network through cross-linking of similar ends. Currently, there are six known chains, α1(IV) to α6(IV). According to the arrangement of their genes, different heterotrimers are formed: α1α1α2, α3α4α5, α5α5α6, which can be selectively expressed in different membranes in specific tissues at different stages and play different biological functions (Kühn K. Basement membrane (type IV) collagen. Matrix Biol. 1995 Feb; 14(6): 439-45. doi: 10.1016 / 0945-053x(95)90001-2. PMID: 7795882.).

[0003] Type IV collagen is primarily found in the basement membrane and is an important structural protein connecting the epidermis and dermis. It plays a key role in maintaining the structural integrity of the skin, promoting cell adhesion, and signal transduction. With skin aging and the influence of external environmental factors, the synthesis of type IV collagen gradually decreases, leading to a weakening of the skin's barrier function, decreased elasticity and firmness, and the appearance of signs of aging such as fine lines and sagging. In the field of skin care products, type IV collagen has become a highly effective and cutting-edge potential anti-aging ingredient due to its unique biological functions and molecular properties. Due to its low content in organisms, the extraction of type IV collagen is relatively difficult. Using genetic recombination technology to express type IV collagen can promote its application in skin care products.

[0004] With the rapid development of synthetic biology, some research institutions at home and abroad have created recombinant collagen by recombining human collagen genes into human cells. This protein, obtained through high-density fermentation and subsequent purification, is known as recombinant collagen. However, recombinant collagen generally faces high technical barriers, low expression yields, and high production costs, making it difficult to meet the needs of industrial mass production. Therefore, the market is in urgent need of a collagen material with an amino acid sequence highly homologous to that of the human body, excellent biological properties, and the ability to be industrially mass-produced. Summary of the Invention

[0005] In response to the shortcomings of the existing technology, the present invention provides a recombinant humanized type IV collagen, its encoding gene, and its application. The specific scheme of the present invention is as follows:

[0006] In a first aspect of the present invention, a recombinant type IV collagen is provided, wherein the amino acid sequence of the recombinant type IV collagen comprises at least one or more repeating units of amino acid residues, wherein the repeating unit comprises the amino acid sequence shown in SEQ ID NO.1 (GEFYFDLRLKGDK), and the number of repetitions is n, where n is a natural number and the value range of the number of repetitions n can be 1 <n≤20。

[0007] Optionally, the value range of the repetition number n can be 1<n≤20, 2<n≤20, 3<n≤20, 4<n≤20, 5<n≤20, 6<n≤20, 7<n≤20, 8<n≤20, 9<n≤20, 10<n≤20, 11<n≤20, 12<n≤20, 13<n≤20, 14<n≤20, 15<n≤20, 16<n≤20, 17<n≤20, 18<n≤20, 19<n≤20, 1<n≤19, 2<n≤19, 3<n≤19, 4<n≤19, 5<n≤19, 6<n≤19, 7<n≤19, 8<n≤19 , 9<n≤19, 10<n≤19, 11<n≤19, 12<n≤19, 13<n≤19, 14<n≤19, 15<n≤19, 16<n≤19, 17<n≤19, 18<n≤19, 1<n≤18, 2<n≤18, 3<n≤18, 4<n≤18, 5<n≤18, 6<n≤18, 7<n≤18, 8<n≤18, 9<n≤18, 10<n≤18, 11<n≤18, 12<n≤18, 13<n≤18, 14<n≤18, 15<n≤18, 16<n≤18, 17<n≤18, 1<n≤17, 2 <n≤17、3<n≤17、4<n≤17、5<n≤17、6<n≤17、7<n≤17、8<n≤17、9<n≤17、10<n≤17、11<n≤17、12<n≤17、13<n≤17、14<n≤17、15<n≤17、16<n≤17、1<n≤16、2<n≤16、3<n≤16、4<n≤16、5<n≤16、6<n≤16、7<n≤16、8<n≤16、9<n≤16、10<n≤16、11<n≤16、12<n≤16、13<n≤16、14<n≤16、 15<n≤16, 1<n≤15, 2<n≤15, 3<n≤15, 4<n≤15, 5<n≤15, 6<n≤15, 7<n≤15, 8<n≤15, 9<n≤15, 10<n≤15, 11<n≤15, 12<n≤15, 13<n≤15, 14<n≤15, 1<n≤14, 2<n≤14, 3<n≤14, 4<n≤14, 5<n≤14, 6<n≤14, 7<n≤14, 8<n≤14, 9<n≤14, 10<n≤14, 11<n≤14, 12<n≤14, 13<n≤14 and any range therebetween.

[0008] Optionally, the value of n, or the upper limit value of n, or the lower limit value of n, the repetition number n can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or any value therebetween.

[0009] Preferably, the repetition number n is in the range of 2≤n≤12.

[0010] In one embodiment, the repeating unit comprises the amino acid sequence shown in SEQ ID NO.1, and the repeating number n ranges from 2≤n≤20.

[0011] In one embodiment, the repeating unit comprises the amino acid sequence shown in SEQ ID NO.1, and the repeating number n ranges from 3≤n≤18.

[0012] In one embodiment, the repeating unit comprises the amino acid sequence shown in SEQ ID NO.1, and the repeating number n ranges from 4≤n≤16.

[0013] Alternatively, the recombinant type IV collagen may comprise repeating units of a sequence shown in SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 5, or a sequence thereof having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity. The repeating units may be directly linked.

[0014] Optionally, the amino acids of the collagen comprise the amino acid sequence shown in SEQ ID NO.2 or an amino acid sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO.2.

[0015] Optionally, the amino acids of the collagen comprise the amino acid sequence shown in SEQ ID NO.3 or an amino acid sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO.3.

[0016] Optionally, the amino acids of the collagen comprise the amino acid sequence shown in SEQ ID NO.5 or an amino acid sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO.5.

[0017] It is understandable that those skilled in the art can select a suitable gene editing system and gene editing method according to actual conditions to complete the construction of the above-mentioned recombinant type IV collagen.

[0018] In a second aspect, the present invention provides a biomaterial, wherein the biomaterial is selected from any one of the following:

[0019] A1) a nucleic acid molecule encoding any of the recombinant type IV collagen;

[0020] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0021] A3) a recombinant vector containing the nucleic acid molecule described in A1) or the expression cassette described in A2);

[0022] A4) a recombinant microorganism containing the nucleic acid molecule described in A1), the expression cassette described in A2), or the recombinant vector described in A3);

[0023] A5) A recombinant cell containing the nucleic acid molecule described in A1), the expression cassette described in A2) or the recombinant vector described in A3).

[0024] Furthermore, the nucleic acid molecule described in A1) includes: a nucleotide sequence as shown in SEQ ID NO.4 or a nucleotide sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to SEQ ID NO.4, and / or a nucleotide sequence as shown in SEQ ID NO.6 or a nucleotide sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to SEQ ID NO.6.

[0025] Optionally, the expression cassette refers to DNA capable of expressing the above-mentioned proteins in a host cell. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule containing all regulatory sequences necessary for expressing any of the above-mentioned proteins. The regulatory sequences are capable of directing the coding sequence to express any of the above-mentioned proteins in a suitable host cell under compatible conditions. The regulatory sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, the regulatory sequences include a promoter and termination signals for transcription and translation. To introduce specific restriction enzyme sites into the vector for ligating the regulatory sequences to the coding region of the protein-encoding nucleic acid sequence, the regulatory sequences may be provided with linkers. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence recognized by the host cell in which the nucleic acid sequence is to be expressed. The promoter sequence contains transcriptional regulatory sequences that mediate protein expression. The promoter may be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutant, truncated, and hybrid promoters, and may be derived from genes encoding extracellular or intracellular proteins that are homologous or heterologous to the host cell. A regulatory sequence may also be a suitable transcription terminator sequence, i.e., a sequence recognized by the host cell to terminate transcription. The terminator sequence may be operably linked to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that is functional in the selected host cell may be used in the present invention. A regulatory sequence may also be a suitable leader sequence, i.e., an untranslated region of an mRNA that is important for translation in the host cell. The leader sequence may be operably linked to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that is functional in the selected host cell may be used in the present invention. A regulatory sequence may also be a signal peptide coding region, which encodes an amino acid sequence attached to the amino terminus of the protein that directs the encoded protein into the cell's secretory pathway. Any signal peptide coding region that directs the expressed protein into the secretory pathway of the selected host cell may be used in the present invention. It may also be desirable to add regulatory sequences that can regulate protein expression based on the growth conditions of the host cells. Examples of regulatory systems are those that can turn gene expression on or off in response to chemical or physical stimuli (including in the presence of regulatory compounds). Other examples of regulatory sequences are those that enable gene amplification. In these instances, the protein-encoding nucleic acid sequence should be operably linked to the regulatory sequences.

[0026] Alternatively, the vector may include a nucleic acid molecule encoding the above-mentioned protein, a promoter, and transcription and translation termination signals. When preparing a recombinant vector, the nucleic acid molecule encoding the above-mentioned protein may be located in the vector so as to be operably linked to an appropriate expression control sequence. The recombinant vector may be any vector (e.g., a plasmid or virus) that is convenient for recombinant DNA manipulation and expression of the nucleic acid sequence. The choice of vector generally depends on the compatibility of the vector with the host cell into which it is to be introduced. The vector may be a linear or closed-loop plasmid. The vector may be an autonomously replicating vector (i.e., a complete structure present outside the chromosome that can be replicated independently of the chromosome), such as a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may include any mechanism that ensures self-replication. Alternatively, the vector may be a vector that, when introduced into a host cell, will be integrated into the genome and replicated together with the chromosome into which it is integrated. In addition, a single vector or plasmid may be used, or two or more vectors or plasmids, or transposons, that collectively comprise the entire DNA that will be introduced into the host cell genome may be included. The vector may contain one or more selectable markers that are convenient for selecting transformed cells. A selectable marker is a gene whose product confers resistance to biocides or viruses, resistance to heavy metals, or prototrophy to an auxotroph. Examples of bacterial selectable markers include the dal genes of Bacillus subtilis or Bacillus licheniformis, or resistance markers for antibiotics such as ampicillin, kanamycin, chloramphenicol, or tetracycline. Vectors contain elements that enable the vector to be stably integrated into the host cell genome or to ensure autonomous replication of the vector in the cell, independent of the cellular genome. In the case of autonomous replication, the vector may also contain an origin of replication that enables the vector to replicate autonomously in the target host cell. The origin of replication may contain a mutation that renders it temperature-sensitive in the host cell (see, for example, Ehrlich, 1978, Proceedings of the National Academy of Sciences of the United States of America 75:1433). One or more copies of a nucleic acid molecule encoding any of the above-described proteins of the present invention may be inserted into the host cell to increase the production of the gene product. The number of copies of the nucleic acid molecule can be increased by inserting at least one additional copy of the nucleic acid molecule into the host cell genome, or by inserting an amplifiable selectable marker along with the nucleic acid molecule, and then selecting cells containing amplified copies of the selectable marker gene and, thereby, the additional copies of the nucleic acid molecule by culturing the cells in the presence of a suitable selective agent. The procedures used to connect the above-mentioned elements to construct the recombinant expression vector of the present invention are well known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).

[0027] The term "operably linked" is defined herein as a configuration in which a regulatory sequence is appropriately positioned relative to the coding sequence of a DNA sequence such that the regulatory sequence directs the expression of a protein.

[0028] Alternatively, the microorganism comprises a polynucleotide of the present invention operably linked to one or more control sequences that direct the production of the collagen protein of the present invention. The construct comprising the polynucleotide is introduced into the microorganism so that the construct is maintained as a chromosomal integrant or as an autonomously replicating extrachromosomal vector. The term "microorganism" encompasses any parent cell progeny that is not identical to the parent cell due to mutations that occur during replication. The selection of microorganisms will depend to a large extent on the gene encoding the collagen protein or polypeptide and its source.

[0029] Furthermore, the recombinant microorganism includes at least one of Streptococcus, Bacillus, Escherichia coli, Saccharomyces cerevisiae, and Pichia pastoris. Preferably, the recombinant microorganism includes Escherichia coli.

[0030] In a preferred embodiment, the Escherichia coli is BL21 (DE3). It will be appreciated by those skilled in the art that conventional fermentation strains or any known industrial strains can be used as the starting strain, as long as they can achieve the expression of the recombinant type IV collagen described in this application, and the specific strain is not limited herein.

[0031] In a third aspect, the present invention provides a method for preparing recombinant type IV collagen, comprising the step of expressing the recombinant type IV collagen using the biomaterial.

[0032] Alternatively, the method of obtaining the recombinant collagen may be to ferment the biomaterial with microorganisms. For example, the nucleic acid molecule encoding the recombinant type IV collagen is introduced into a blank vector and then transferred into host cells, and the host cells are cultured for expression.

[0033] Preferably, the amino acids of the collagen protein comprise the amino acid sequence shown in SEQ ID NO.3 or an amino acid sequence having at least 90% identity with SEQ ID NO.3, and / or the amino acid sequence shown in SEQ ID NO.5 or an amino acid sequence having at least 90% identity with SEQ ID NO.5.

[0034] More preferably, the nucleic acid molecule encoding the collagen includes: a nucleotide sequence as shown in SEQ ID NO.4 or a nucleotide sequence having at least 90% identity with SEQ ID NO.4, and / or a nucleotide sequence as shown in SEQ ID NO.6 or a nucleotide sequence having at least 90% identity with SEQ ID NO.6.

[0035] Preferably, the recombinant microorganism is selected from one or more of Streptococcus, Bacillus, Escherichia coli, Saccharomyces cerevisiae, and Pichia pastoris; more preferably, the recombinant microorganism includes Escherichia coli.

[0036] In one embodiment, a method for preparing recombinant type IV collagen comprises: step 1, constructing a recombinant expression engineering bacterium expressing the recombinant type IV collagen; step 2, culturing the recombinant expression engineering bacterium at 25°C-37°C for 10-12h, and when OD 600 When the pH reaches 0.6-1.0, IPTG is added for induction. After induction at 25°C-37°C for 3-4 hours, the fermentation is terminated, the bacterial precipitate is collected, and the supernatant is obtained by crushing. In step 3, the crushed supernatant is subjected to nickel column affinity chromatography and ion exchange chromatography to elute and collect the protein corresponding to the elution peak to obtain recombinant type IV collagen.

[0037] In a fourth aspect, the present invention provides a composition comprising the recombinant type IV collagen or the recombinant type IV collagen obtained by the method for preparing the recombinant type IV collagen.

[0038] Furthermore, the composition also includes additives acceptable in the fields of medicine, pharmacy, food, health care products, and skin care products.

[0039] In a fifth aspect, the present invention provides the use of the recombinant type IV collagen, the biomaterial, the recombinant type IV collagen prepared by the preparation method, or the composition in any of the following aspects:

[0040] B1) Application in the preparation of products for promoting the production of type IV collagen;

[0041] B2) Application in the preparation of products for promoting the production of type VII collagen;

[0042] B3) Application in the preparation of products for promoting the production of type XVII collagen.

[0043] Furthermore, collagen type IV, collagen type VII and collagen type XVII all have the effects of firming and anti-wrinkle, barrier repair, soothing and anti-inflammatory, and can also promote wound healing.

[0044] Therefore, the recombinant type IV collagen of the present invention, or the biomaterial, or the recombinant type IV collagen prepared by the preparation method, or the composition can achieve the effects of firming and anti-wrinkle, barrier repair, soothing and anti-inflammatory, and promoting wound healing by promoting the production of basement membrane collagen, especially type IV collagen, type VII collagen, and type XVII collagen.

[0045] In a sixth aspect, the present invention provides the use of the recombinant type IV collagen, the biomaterial, the recombinant type IV collagen prepared by the preparation method, or the composition in any of the following aspects:

[0046] C1) Application in the preparation of skin repair products;

[0047] C2) Application in the preparation of anti-inflammatory products;

[0048] C3) Application in the preparation of anti-aging products.

[0049] Furthermore, the anti-aging product has the effects of promoting basement membrane repair, improving skin elasticity, and reducing fine lines and wrinkles.

[0050] In a seventh aspect, the present invention provides the use of the recombinant type IV collagen, the biomaterial, the recombinant type IV collagen prepared by the preparation method, or the composition in any of the following aspects:

[0051] D1) Application in the preparation of skin care products;

[0052] D2) Application in the preparation of medicines;

[0053] D3) Application in the preparation of medical devices.

[0054] The skin care products, medicines and medical devices have the effects of promoting basement membrane repair, firming and anti-wrinkle, barrier repair, soothing and anti-inflammation, and promoting wound healing.

[0055] The beneficial effects of the present invention include but are not limited to:

[0056] The recombinant type IV collagen prepared by the present invention can effectively promote the expression of types IV, VII and XVII collagen in skin basement membrane cells, can repair and strengthen the skin barrier, thereby improving the firmness and elasticity of the skin, and is beneficial to basement membrane repair. It can be effectively used in the preparation of anti-aging products and has broad application prospects in the fields of medical devices, beauty and skin care.

[0057] The present invention also provides a method for expressing the recombinant type IV collagen using recombinant Escherichia coli. The method of the present invention has high protein output, high purity and high yield, laying a foundation for industrial large-scale production. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0059] Figure 1 Schematic diagram of the electrophoresis detection results of IV-3 and IV-4 in the embodiment of the present invention;

[0060] Figure 2Schematic diagram of the adhesion promotion results of recombinant type IV collagen in the examples of the present invention, where * indicates a significant difference compared with IV-1, P < 0.05; ** indicates a more significant difference compared with IV-1, P < 0.01; *** indicates a very significant result compared with IV-1, P < 0.001;

[0061] Figure 3 Schematic diagram of the effect of recombinant type IV collagen on promoting type IV collagen production in an embodiment of the present invention, wherein * indicates a significant difference compared with IV-1, P < 0.05;

[0062] Figure 4 This is a schematic diagram of the effect of recombinant type IV collagen on the production of type VII collagen in an embodiment of the present invention, wherein * indicates a significant difference compared with IV-1, P < 0.05;

[0063] Figure 5 Schematic diagram of the effect of recombinant type IV collagen on the production of type XVII collagen in an embodiment of the present invention, wherein * indicates a significant difference compared with IV-1, P < 0.05; ** indicates a more significant difference compared with IV-1, P < 0.01. DETAILED DESCRIPTION

[0064] The present invention is described in detail below with reference to the examples, but the present invention is not limited to these examples. Unless otherwise specified, the raw materials and catalysts in the examples of the present invention are purchased through commercial channels.

[0065] Example 1 Obtaining the repeating unit

[0066] The design of recombinant humanized type IV collagen involved obtaining the amino acid sequence of natural human type IV collagen α1 chain (P02462) from the Uniprot database. Bioinformatics and other methods were used to conduct in-depth amino acid analysis, resulting in a highly active and water-soluble collagen amino acid sequence. The following different recombinant humanized type IV collagens were obtained through repeated concatenation. The specific amino acid sequences are as follows:

[0067] IV-1 amino acid sequence: GEFYFDLRLKGDK (SEQ ID NO. 1)

[0068] IV-2 amino acid sequence: GEFYFDLRLKGDKGEFYFDLRLKGDK (SEQ ID NO. 2)

[0069] IV-3 amino acid sequence:

[0070] GEFYFDLRLKGDKGEFYFDLRLKGDKGEFYFDLRLKGDKGEFYFDLRLKGDK(SEQ ID NO.3)

[0071] The base sequence of IV-3 is:

[0072] GGAGAATTTTATTTCGACCTGCGTTTTGAAGGGTGATAAAGGTGAGTTTTACTTCGACC TGCGTCTGAAGGGCGATAAAGGCGAGTTCTACTTTGATCTGCGTTTAAAAGGTGACAAAGGTGAATTTTATTTCGATCTGCGCTTGAAGGGCGACAAGTAA(SEQ ID NO.4)

[0073] IV-4 amino acid sequence:

[0074] GEFYFDLRLKGDKGEFYFDLRLKGDKGEFYFDLRLKGDKGEFYFDLRLKGDKGEFYFDL RLKGDKGEFYFDLRLKGDKGEFYFDLRLKGDKGEFYFDLRLKGDK(SEQ ID NO.5)

[0075] The base sequence of IV-4:

[0076] GGAGAATTTTACTTTGATCTCCGCCTGAAAGGCGACAAAGGTGAGTTCTACTTCGACCTGCGTCTGAAAGGTGATAAGGGCGAATTTTATTTTGACCTGCGCCTTAAGGGCGACAAGGGTGAATTTTACTTCGACCTGCGTTTGAAGGGCGATAAAGGT GAGTTCTATTTTGATTTACGTTTGAAGGGCGACAAGGGTGAATTCTATTTCGATTTGCGTCTGAAAGGTGACAAAGGTGAGTTTTACTTCGACCTGCGTCTGAAAGGCGATAAAGGCGAGTTTTACTTCGACTTGCGCCTGAAGGGTGATAAGTAA(SEQ ID NO.6)

[0077] Furthermore, to facilitate subsequent separation and purification after biosynthesis, an enterokinase tag was added to the amino terminus of the above amino acid sequence, and the sequence of the enterokinase tag was DDDDK.

[0078] Example 2 Construction, expression and purification of recombinant humanized type IV collagen

[0079] 1. The amino acid sequences SEQ ID NO. 1 and SEQ ID NO. 2 were synthesized by GenScript with a purity of >98%. The coding nucleotide sequences SEQ ID NO. 4 and SEQ ID NO. 6 were also synthesized by GenScript. The nucleotide synthesis vector was the pET32a plasmid, and the N-terminal amino acid sequence was DDDDK. The nucleotide sequence was inserted between the KpnI and XhoI restriction sites to generate the pET32a-IV-3 and pET32a-IV-4 recombinant plasmids.

[0080] 2. Protein expression:

[0081] (1) Take out the E. coli competent cells BL21 (DE3) from the ultra-low temperature refrigerator and place them on ice. Take 2 μl of the recombinant plasmid obtained in step 1 and add it to the E. coli competent cells BL21 (DE3). Mix gently 2-3 times.

[0082] (2) Place the mixture on ice for 30 minutes, then heat shock in a 42°C water bath for 45-90 seconds, remove it and place it on ice for 2 minutes.

[0083] (3) Transfer the tube to a biosafety cabinet and add 700 μl of liquid LB medium (tryptone 10 g, yeast extract 5 g, NaCl 10 g), then incubate at 37°C and 220 rpm for 60 min.

[0084] (4) Take 200 μl of bacterial solution and evenly spread it on the LB plate containing Amp resistance.

[0085] (5) Incubate the plate in a 37°C incubator for 15-17 hours until colonies of uniform size grow.

[0086] (6) Pick 5-6 single colonies from the transformed LB plate and place them in a shake flask containing LB medium containing antibiotic stock solution and culture at 37°C until the OD 600 When the pH value is about 0.8-1.0, add IPTG to induce expression for a period of time, then divide the bacterial solution into centrifuge bottles, centrifuge at 8000 rpm and 4°C for 10 min, collect the bacteria, record the cell weight, and take samples for electrophoresis detection.

[0087] 3. Resuspend the collected cells in balanced working solution (20 mM PB phosphate buffer, pH 8.0) and disrupt them by sonication. Collect the cell suspension. Centrifuge the disrupted cell suspension at 12,000 rpm and 4°C for 30 minutes. Collect the supernatant and perform electrophoresis on the supernatant (labeled "S") and the disrupted whole cells (labeled "T").

[0088] 4. Electrophoresis detection: Take 40 μl of sample solution, add 10 μl 5× protein loading buffer (250 mM Tris-HCl (pH: 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol), place in 100°C boiling water for 10 min, then add 10 μl per well to SDS-PAGE protein gel, run at 80 V for 2 h, and then use Coomassie Brilliant Blue staining solution (0.1% Coomassie Brilliant Blue R-250, 25% isopropanol, 10% glacial acetic acid) for protein staining for 30 min, and then use protein decolorization solution (1% acetic acid, 0.5% ethanol) for decolorization.

[0089] Figure 1 The electrophoresis results of IV-3 and IV-4 are shown. The actual molecular weights of IV-3 and IV-4 are consistent with their corresponding expected molecular weights, indicating that the proteins are correctly expressed.

[0090] 5. Purification: The cell supernatant was purified using a nickel ion affinity chromatography column on an AKTA pure purification system. The Ni 2+ Equilibrate the chelating affinity chromatography column with Binding Buffer (20 mM PB buffer, 250 mM NaCl, 10 mM imidazole, pH = 8.0) for 5-10 column volumes. Set the sample injection pump to a column flow rate of 1.0 mL / min. Equilibrate with Binding Buffer for another 10-15 column volumes. Elute the target protein using a linear elution with Elution Buffer (20 mM PB, 250 mM NaCl, 500 mM imidazole, pH = 8.0) for 20 column volumes.

[0091] The protein solution after nickel column purification was purified using different ion chromatography columns according to the predicted isoelectric point. The pH and conductivity of the protein solution were adjusted to the same as those of the buffer solution for loading. The target protein was linearly eluted over 20 column volumes. The protein sample was obtained after nickel column affinity chromatography and ion chromatography.

[0092] Example 3 Cytotoxicity test of recombinant humanized type IV collagen

[0093] HaCaT cells in logarithmic growth phase were taken and 1×10 5Cells were seeded in 96-well plates at a density of 100 μL per well in MEM medium supplemented with 10% fetal bovine serum (FBS). The cells were incubated overnight in a CO2 incubator at 37°C and 5% CO2. Sample solutions were prepared in serum-free medium at concentrations of 0.0024 mg / mL, 0.012 mg / mL, 0.06 mg / mL, and 0.3 mg / mL. These solutions were sterilized by filtration through a 0.22 μm filter. After 24 hours of standard culture, the culture medium was discarded and 100 μL of collagen sample of varying concentrations was added to the experimental groups. The negative control group received an equal volume of serum-free medium. Six replicate wells were plated in each well. After an additional 24 hours of culture, the relative cell proliferation rate was determined using the CCK-8 assay. The culture medium was discarded and 100 μL of CCK-8 diluted 10-fold in serum-free medium was added to each well. The cells were incubated in a cell culture incubator for another 2 hours. The absorbance was measured at 450 nm using a microplate reader.

[0094] The relative proliferation rate was the ratio of the absorbance of the experimental group to that of the negative control group, and the values ​​were expressed as mean ± SD (n = 3).

[0095] The experimental results are shown in Table 1. According to the standard of non-cytotoxicity determined by a relative proliferation rate of 70% or more, samples IV-1, IV-2, IV-3, and IV-4 had no potential cytotoxicity within the test concentration range and had good cell viability.

[0096] Table 1 Relative cell proliferation rate

[0097] Recombinant type IV collagen Negative control 0.0024mg / ml 0.012mg / ml 0.06mg / ml 0.3mg / ml IV-1 100％ 101％ 104％ 100％ 95％ IV-2 100％ 103％ 102％ 99％ 96％ IV-3 100％ 106％ 102％ 104％ 108％ IV-4 100％ 102％ 106％ 98％ 95％

[0098] Example 4 Recombinant humanized type IV collagen promotes cell adhesion experiment

[0099] Take the lyophilized product of recombinant humanized type IV collagen, prepare it into 0.2mg / ml and 0.1mg / ml with PBS solution, and act on HaCaT cells to promote cell adhesion experiment. The specific steps are as follows: prepare each sample solution with PBS and add it to a 96-well plate. The negative control group only adds PBS, and the positive control is bovine type I collagen (about 0.0152mg / ml), which is placed at 4°C overnight. Aspirate the sample solution and block it with 1% BSA in a 37°C incubator for 1h. Aspirate the blocking solution and wash 3 times with serum-free medium. Take cells in the logarithmic growth phase, digest them with trypsin, centrifuge and resuspend them in serum-free medium at 1x10 6 Cells were added to the wells at a density of 1 cell / well and incubated in a 37°C incubator for 1 hour. The culture medium was discarded, and the cells were washed four times with PBS. 100 μL of CCK-8 was added to each well and the cells were incubated in a cell incubator for another 2 hours. The absorbance was measured at a wavelength of 450 nm using a microplate reader.

[0100] Relative cell adhesion rate (%) = Mean value of sample group / Mean value of control group × 100%.

[0101] The experimental results are as follows Figure 2 As shown, recombinant humanized IV collagen proteins IV-1, IV-2, IV-3, and IV-4 all promoted cell adhesion. Compared to IV-1, IV-3 showed significant differences at a concentration of 0.1 mg / ml, while both IV-2 and IV-3 showed significant differences at a concentration of 0.2 mg / ml. These results indicate that proteins IV-1, IV-2, IV-3, and IV-4 all contribute to promoting cell renewal and metabolism, maintaining the structural integrity of the skin.

[0102] Example 5 Recombinant humanized type IV collagen promotes the activity of basement membrane collagen types IV, VII, and XVII

[0103] HaCaT cells in the logarithmic growth phase were seeded into 6-well plates and cultured in a constant temperature incubator at 37°C, 5% CO2, and 95% humidity for 24 hours. The cells were treated with serum-free medium to prepare each sample solution (three replicates were performed for each sample, and the sample concentration was 0.01 mg / ml). After 8 hours of culture, the cells were washed 2-3 times with PBS and then analyzed using RNA-easy TM Cells were collected using Isolation Reagent, transferred to a centrifuge tube, and frozen at -80°C. Total RNA was extracted and reverse transcribed from the collected cells. Real-time fluorescence quantitative PCR was then performed using SYBR Green I, and the results were analyzed using Excel.

[0104] The experimental results are as follows Figure 3 、 4 As shown in Figures 5 and 6, there was a significant difference in COL4A1 content between IV-3 and IV-1. There were also significant differences in COL7A1 content between IV-3 and IV-4 compared to IV-1. There were also significant differences in COL17A1 content between IV-3 and IV-4 compared to IV-1, with IV-3 showing the highest significance. In summary, recombinant type IV collagens IV-3 and IV-4 can help enhance the skin's barrier function by promoting the expression of basement membrane collagen, and have broad application prospects in improving skin elasticity and reducing fine lines and wrinkles.

[0105] The foregoing is merely an embodiment of the present invention. The scope of protection of the present invention is not limited by these specific embodiments but is determined by the claims of the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, improvements, etc. made within the technical concepts and principles of the present invention are intended to be included within the scope of protection of the present invention.

Claims

1. A recombinant type IV collagen, characterized in that The amino acid sequence of the recombinant type IV collagen contains at least one or more repeating units of amino acid residues, wherein the repeating unit contains the amino acid sequence shown in SEQ ID NO.1, the number of repetitions being n, 1<n≤20, and preferably, the range of the number of repetitions n being 2≤n≤12.

2. The recombinant type IV collagen according to claim 1, characterized in that The recombinant type IV collagen contains the amino acid sequence shown in SEQ ID NO.2 or an amino acid sequence that is at least 90% identical to SEQ ID NO.2, or contains the amino acid sequence shown in SEQ ID NO.3 or an amino acid sequence that is at least 90% identical to SEQ ID NO.3, or contains the amino acid sequence shown in SEQ ID NO.5 or an amino acid sequence that is at least 90% identical to SEQ ID NO.

5.

3. Biomaterial, characterized in that The biological material is selected from any one of the following: A1) a nucleic acid molecule encoding the recombinant type IV collagen according to any one of claims 1 to 2; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1) or the expression cassette described in A2); A4) a recombinant microorganism containing the nucleic acid molecule described in A1), the expression cassette described in A2), or the recombinant vector described in A3); A5) A recombinant cell containing the nucleic acid molecule described in A1), the expression cassette described in A2) or the recombinant vector described in A3).

4. The biomaterial according to claim 3, characterized in that The nucleic acid molecule described in A1) comprises the nucleotide sequence shown in SEQ ID NO.4 or a nucleotide sequence having at least 90% identity with SEQ ID NO.4, and / or the nucleotide sequence shown in SEQ ID NO.6 or a nucleotide sequence having at least 90% identity with SEQ ID NO.

6.

5. The biomaterial according to claim 3, characterized in that The recombinant microorganism described in A4) comprises at least one of Streptococcus, Bacillus, Escherichia coli, Saccharomyces cerevisiae, and Pichia pastoris.

6. A method for preparing recombinant type IV collagen, characterized in that: The method comprises the step of expressing the recombinant type IV collagen using the biomaterial according to any one of claims 3 to 5.

7. A composition, characterized in that The composition comprises the recombinant type IV collagen according to any one of claims 1 or 2, or the recombinant type IV collagen obtained by the method according to claim 6.

8. Use of the recombinant type IV collagen according to claim 1 or 2, or the biomaterial according to any one of claims 3 to 5, or the recombinant type IV collagen prepared by the preparation method according to claim 6, or the composition according to claim 7 in any of the following aspects: B1) Application in the preparation of products for promoting the production of type IV collagen; B2) Application in the preparation of products for promoting the production of type VII collagen; B3) Application in the preparation of products for promoting the production of type XVII collagen.

9. Use of the recombinant type IV collagen according to claim 1 or 2, or the biomaterial according to any one of claims 3 to 5, or the recombinant type IV collagen prepared by the preparation method according to claim 6, or the composition according to claim 7 in any of the following aspects: C1) Application in the preparation of skin repair products; C2) Application in the preparation of anti-inflammatory products; C3) Application in the preparation of anti-aging products.

10. Use of the recombinant type IV collagen according to claim 1 or 2, or the biomaterial according to any one of claims 3 to 5, or the recombinant type IV collagen prepared by the preparation method according to claim 6, or the composition according to claim 7 in any of the following aspects: D1) Application in the preparation of skin care products; D2) Application in the preparation of medicines; D3) Application in the preparation of medical devices.

Images