Construction and application of bacillus subtilis for synthesizing high-activity heme protein

Abstract

The invention discloses construction and application of bacillus subtilis for synthesizing high-activity heme protein, and belongs to the technical field of genetic engineering. By enhancing globin gene transcription and optimizing heme prothetic group supply, the synthesis capability of heme proteins is improved, so that the titers of soybean hemoglobin, clover hemoglobin, bovine myoglobin, porcine myoglobin and P450-BM3 of the constructed bacillus subtilis respectively reach 0.81 g / L, 0.82 g / L, 1.11 g / L and 1.01 g / L under the condition of fed-batch fermentation, and the bacillus subtilis can be used for preparing the recombinant bacillus subtilis. The heme binding rate and peroxidase activity of Hb and Mb produced by fed-batch fermentation can be similar to those of naturally extracted standard substances H-Mb and B-Hb.

Description

Technical Field

[0001] The invention relates to the construction and application of Bacillus subtilis for synthesizing highly active heme proteins, and belongs to the technical field of genetic engineering. Background Art

[0002] Heme proteins, formed by the combination of globin and heme, carry out crucial functions in the body, including oxygen transport, energy metabolism, and antioxidant defense, making them essential molecules for life. They carry out key physiological functions in the body, including oxygen transport, energy metabolism, and antioxidant defense, and are an important molecular foundation for maintaining life. This protein family, which includes members such as hemoglobin, myoglobin, cytochrome P450 enzymes, catalase, and nitric oxide synthase, has a wide range of applications in emergency medicine (acellular oxygen carriers), healthcare (iron supplements), the food industry (coloring and flavor enhancement), and biocatalysis (synthesis of high-value-added compounds). Market demand for heme proteins, including soy leghemoglobin (S-Hb), clover hemoglobin (C-Hb), bovine myoglobin (B-Mb), porcine myoglobin (P-Mb), and cytochrome P450-BM, continues to grow, and microbial synthesis technology, due to its potential for large-scale production, is an ideal solution.

[0003] The selection of a microbial synthesis system must take into account both expression efficiency and safety. Although Escherichia coli has the characteristics of efficient expression, its endotoxin contamination risk restricts its application in the pharmaceutical and food fields. Safe strains such as Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces and Corynebacterium glutamicum are limited by defects such as low growth rate, insufficient protein expression efficiency, methanol-dependent induction or complex process control. In contrast, the "Generally Recognized as Safe" (GRAS) strain certified by the U.S. Food and Drug Administration (FDA) - Bacillus subtilis shows significant advantages: it not only has rapid proliferation characteristics (fermentation cycle of about 24 hours) and high-density fermentation capacity, but also can use cheap carbon sources to achieve efficient heterologous protein expression, while avoiding endotoxin risks and meeting food-grade protein production standards. Therefore, it is regarded as a synthetic biology chassis with great development potential.

[0004] However, Bacillus subtilis still faces two challenges in synthesizing highly active heme proteins: insufficient globin expression levels and limited heme cofactor supply. At the globin expression level, there is currently a lack of optimized expression systems for this strain, and there is an urgent need to establish an expression system with strong adaptability. In terms of cofactor supply, although exogenous supplementation of 5-aminolevulinic acid (ALA) can partially alleviate heme deficiency, it significantly increases production costs and is difficult to meet industrial needs. It is more feasible to achieve continuous supply by strengthening the endogenous heme synthesis pathway, but traditional strategies such as overexpression of the entire pathway or empirical regulation of key genes can easily lead to metabolic imbalance, accumulation of toxic intermediates, and excessive consumption of cellular resources. Therefore, it is urgent to develop precise metabolic engineering strategies based on the unique heme metabolic network of Bacillus subtilis to optimize the heme supply capacity of the strain. Summary of the Invention

[0005] The present invention provides a recombinant plasmid pMINI-gntK with improved expression ability, which is based on the pP43NMK plasmid. 43 The promoter was replaced by P lytE -gntR C102T , and in P 3-srfAA The promoter 3' end is connected to the repressor protein GntR recognition sequence ATACTTGTATACAAGTATACTTAT; the P lytE -gntR C102T It is P lytE The coding fragment of the gluconic acid repressor protein gntR (base C at position 120 changed to T) driven by the promoter.

[0006] In one embodiment, the P lytE -gntR C102T The nucleotide sequence of the promoter is shown in SEQ ID NO.19; 3-srfAA The nucleotide sequence of the promoter is shown in SEQ ID NO.20.

[0007] The present invention also provides an engineered Bacillus subtilis strain, which has at least one of the following improvements on the basis of the starting strain:

[0008] (1) Overexpression of glutamyl-tRNA reductase and glutamate-1-semialdehyde aminotransferase to increase the supply of ALA;

[0009] (2) Knockout or silencing of the hemX gene (Gene ID: 937489) to eliminate the negative effects of HemX protein on HemA protein;

[0010] (3) Overexpression of the rate-limiting enzymes porphobilinogen deaminase and uroporphyrinogen III synthase to reduce the spontaneous conversion of unstable hydroxymethylbilin to uroporphyrinogen I, thereby enhancing the production of uroporphyrinogen III;

[0011] (4) Knockout or silencing of the hemC gene (Gene ID: 937488) to reduce the proportion of HemC protein without RIAD peptide linkage;

[0012] (5) The coproporphyrin ferrochelatase gene hemH (Gene ID: 939772) and the heme synthase gene hemQ (Gene ID: 936512) were integrated into the genome to enhance the conversion of coproporphyrinogen III to heme;

[0013] (6) Knockout or silence the heme farnesyltransferase ctaO (Gene ID: 939825) gene to prevent the downstream conversion of heme.

[0014] In one embodiment, the glutamyl-tRNA reductase is (a) or (b):

[0015] (a) Glutamyl-tRNA reductase encoded by gene hemA, whose nucleotide sequence is shown in Gene ID: 937443;

[0016] (b) HemA, a mutant of glutamyl-tRNA reductase encoded by (a), in which two lysines are inserted between the second and third amino acids. KK .

[0017] In one embodiment, two lysines are inserted between the second and third amino acids of the HemA protein.

[0018] In one embodiment, the nucleotide sequence of the glutamate-1-semialdehyde aminotransferase gene heml is shown as GeneID:937490.

[0019] In one embodiment, the hemA gene and the heml gene are integrated and expressed in the genome, or the hemA gene is integrated and expressed in the genome. KK and gene heml.

[0020] In one embodiment, the self-assembling polypeptides RIDD (encoded by SEQ ID NO. 6) and RIAD (encoded by SEQ ID NO. 7) are fused to the rate-limiting enzymes HemD (Gene ID: 937287) and HemC (Gene ID: 937488), respectively, and integrated into the genome.

[0021] In one embodiment, the fusion is fusion of RIDD to the N-terminus of HemD and RIAD to the C-terminus of HemC.

[0022] In one embodiment, the nucleotide sequence encoding the fusion protein RIDD-HemD-HemC-RIAD is shown as SEQ ID NO.8.

[0023] In one embodiment, the hemA and heml genes are expressed via promoter P veg Regulate expression; the RIAD-hemD-RIDD-hemC is expressed by promoter P yvyD Regulate expression; the hemH and hemQ genes are expressed by promoter P 333 Regulate expression.

[0024] In one embodiment, the hemA, heml, hemC, hemD, hemQ and hemH genes are integrated into the genomic amyE locus (Gene ID: 938356).

[0025] In one embodiment, knockout or silencing of the gluconate kinase gene gntK (Gene ID: 937713) reduces sodium gluconate inducer consumption.

[0026] In one embodiment, the Bacillus subtilis engineered bacteria express heme proteins, and the heme proteins include one or more of soy leghemoglobin S-Hb (SEQ ID NO.1), clover hemoglobin C-Hb (SEQ ID NO.2), bovine myoglobin B-Mb (SEQ ID NO.3), porcine myoglobin P-Mb (SEQ ID NO.4) and cytochrome P450-BM3 (SEQ ID NO.5).

[0027] In one embodiment, the pHT01 or pMINI-gntK plasmid is used to express the heme protein.

[0028] In one embodiment, the engineered Bacillus subtilis bacteria uses Bacillus subtilis 168 as a host.

[0029] The present invention also provides a method for preparing heme proteins by fermentation using the Bacillus subtilis engineered bacteria.

[0030] In one embodiment, the engineered Bacillus subtilis is used as a fermentation microorganism, and protein expression is induced using IPTG or gluconic acid after fermentation at 30-37° C. for 2-12 hours.

[0031] In one embodiment, the engineered Bacillus subtilis is inoculated into the fermentation medium at a concentration of 1%-5% (v / v), cultured at 30-37° C. for 2 h-12 h, and fermented with IPTG or gluconic acid at 30-37° C. and 100-600 rpm for at least 24 h to induce protein expression.

[0032] In one embodiment, the fermentation medium includes but is not limited to LB medium and BSM medium.

[0033] In one embodiment, feeding is also performed during the fermentation process.

[0034] In one embodiment, the feed is glucose, ammonium sulfate, and yeast extract.

[0035] The present invention also provides the application of the Bacillus subtilis engineered bacteria as chassis cells in the development of artificial meat, high cell density fermentation or whole-cell catalytic synthesis of high value-added compounds.

[0036] In one embodiment, the artificial meat includes but is not limited to plant protein meat.

[0037] In one embodiment, the application includes, but is not limited to, the preparation of hemoglobin or a product containing hemoglobin.

[0038] Beneficial effects:

[0039] (1) The present invention enhances the precursor supply of 5-aminolevulinic acid (ALA) by relieving the feedback inhibition of Heme on HemA and the negative effect of HemX on HemA, identifies HemD as the main uroporphyrinogen III synthase, and reduces the production of the byproduct uroporphyrinogen I by self-assembling it with HemC, selects the coproporphyrin-dependent pathway as the dominant downstream route for heme synthesis, and blocks the consumption of heme in other metabolic directions by knocking out the proheme IX farnesyltransferase gene. In addition, accompanied by the genomic integration expression and fine regulation of key genes, the heme supply capacity of the engineered strain is increased by 221 times compared with the original strain.

[0040] (2) The present invention uses the gluconic acid-inducible pMINI-gntR plasmid as the best quality plasmid for expressing hemoglobin protein, and knocks out the gluconic acid kinase gene gntK to reduce inducer consumption. Using the final Heme-K2-ΔgntK chassis cells, 54.00 mg / L of P450-BM3 was synthesized at the shake flask level, increasing its whole-cell catalytic activity by 3.64 times; high-level expression of S-Hb (0.81 g / L), C-Hb (0.82 g / L), B-Mb (1.11 g / L) and P-Mb (1.01 g / L) was successfully achieved at the 5L fermenter level, reaching the highest yield reported in the prokaryotic system. The physicochemical properties of the produced hemoglobin protein are comparable to those of the natural standard, and the synthesized S-Hb and B-Mb show excellent application potential as colorants and flavor enhancers in plant-based meat substitutes.

[0041] (3) The present invention lays a foundation for achieving high-yield and high-activity heme protein synthesis in Bacillus subtilis by enhancing the heme supply of Bacillus subtilis and optimizing the expression strategy of heme protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 To optimize the expression levels of Hb and Mb in wild-type Bacillus subtilis; A is the preliminary expression attempt of Hb and Mb using pHT01 plasmid; B is the optimization of plasmid copy number and expression type for S-Hb expression; C and D are the expression of Hb and Mb in wild-type Bacillus subtilis using the optimal pMINI-gntR plasmid backbone; E is the heme binding rate of Hb and Mb expressed in wild-type Bacillus subtilis; the band indicated by the black arrow is the target protein band.

[0043] Figure 2 To enhance ALA supply and redirect HMB intermediates; A is hemA and heml genes from different strains screened by plasmid overexpression; B is hemA from Corynebacterium glutamicum ATCC 13032 or 14067 KK -hemL genome integration of the optimal promoter screening; C is the identification of the true UroS in Bacillus subtilis; D is the screening of the connection direction of the short peptide and enzyme by exogenous addition of 2g / L ALA; E is the optimization of the promoter for RIDD-hemD-hemC-RIAD genome integration.

[0044] Figure 3 To solve the rate-limiting step of the CPD pathway and inhibit the downstream utilization of heme; A compares the conversion efficiency of the CPD and PPD pathways and identifies the key rate-limiting enzymes of the CPD pathway; B optimizes the promoter for genome integration of hemQ; C optimizes the promoter for genome integration of hemH-hemQ; D evaluates the accumulation of key intermediate metabolites and heme in the Heme-I6 strain at different times; E evaluates the effect of knocking out heme utilization-related genes on heme titer; F evaluates the total heme concentration and the concentration of heme secreted outside the cell of the engineered strain Heme-K2.

[0045] Figure 4 To evaluate the biochemical properties of Hb and Mb synthesized by the engineered strain; A and B show the expression of Hb and Mb in the Heme-K2 strain using the optimal pMINI-gntR plasmid backbone, and the bands indicated by black arrows are the target protein bands; C is the spectral characteristics of purified Hb and Mb in the range of 280-700nm; D is the heme binding rate of purified Hb and Mb; E, F, G, H are the peroxidase activities of purified Hb and Mb using TMB, ABTS, guaiacol and OPA as substrates, respectively.

[0046] Figure 5 is the large-scale biosynthesis of Hb and Mb; A is the effect of knocking out the gntK gene on gluconate consumption and OD 600 B, C, D, and E are the titers of S-Hb, C-Hb, B-Hb, and P-Mb in the fed-batch fermentation of strain Heme-K2-ΔgntK, respectively; F is the heme binding rate of purified Hb and Mb; G, H, I, and J are the peroxidase activities of purified Hb and Mb using TMB, ABTS, guaiacol, and OPA as substrates, respectively; K is the expression level and whole-cell catalytic activity of P450-BM3 in the Heme-K2-ΔgntK strain, and the band indicated by the black arrow is the target protein band. DETAILED DESCRIPTION

[0047] Culture medium:

[0048] BSM medium: 12 g / L yeast extract, 6 g / L tryptone, 6 g / L ammonium sulfate, 12.5 g / L potassium dihydrogen phosphate tetrahydrate, 2.5 g / L potassium dihydrogen phosphate, 3 g / L magnesium sulfate heptahydrate, and 60 g / L glucose.

[0049] LB medium: 10 g / L peptone, 5 g / L yeast powder, 10 g / L sodium chloride.

[0050] TB medium: 11.8 g / L yeast extract, 23.6 g / L tryptone, 4 mL / L glycerol, 9.4 g / L dipotassium hydrogen phosphate, and 2.2 g / L potassium dihydrogen phosphate.

[0051] Heme protein purification and quantification

[0052] 25 mL of fermentation sample was centrifuged at 4,000 rpm for 15 minutes, and the supernatant was separated and discarded. The cell pellet was resuspended in 50 mL of phosphate buffered saline (PBS, pH 7.4) to ensure sufficient dispersion. A high-pressure homogenizer (UH-06, Union-Biotech, China) was used to break the resuspended pellet to release intracellular components. After breaking, the mixture was centrifuged at 10,000 rpm for 15 minutes at 4°C, and the supernatant was separated and analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE, for protein separation and visualization), Bradford method (for protein quantification) and ImageJ software (for optical density analysis). BeaverBeads was then used. TM Hb and Mb were purified using the His-tag protein purification system (Beaver Biomedical Engineering) according to the manufacturer's instructions. Finally, the purified Hb and Mb were desalted using Amicon Ultra 10K ultrafiltration centrifuge tubes (Millipore).

[0053] Heme protein heme binding rate test

[0054] The UV-visible absorption spectra of the purified heme protein were recorded from 280 to 700 nm using a microplate reader (Benton Synergy H1). The correct incorporation of heme into the heme protein was investigated using the difference spectra between the reduced and oxidized samples. 100 μL of purified heme protein was mixed with 100 μL of solution I (40% (v / v) pyridine, 0.2 M NaOH, and 500 μM potassium ferricyanide) in a 96-well microplate. The mixture was scanned (500-600 nm) to obtain the oxidation spectrum. Then, 2 μL of solution II (0.5 M sodium dithionite in 0.5 M NaOH) was added to the oxidized sample. The mixture was scanned (500-600 nm) to obtain the reduction spectrum. The heme content in the heme protein was calculated by Beer-Lambert quantification using the extinction coefficient of pyridine hemochromagen, 23.98 L / (mmol·cm). The heme binding rate was expressed as ([mol of heme] / [mol of globin])×100%.

[0055] HPLC analysis of ALA and PBG (porphobilinogen):

[0056] The fermentation broth containing bacterial cells was ultrasonically disrupted and then analyzed by HPLC. The sample was pre-column derivatized with OPA (o-phthalaldehyde). Mobile phase A consisted of 36 mM sodium acetate buffer (pH 7.2) containing 0.2‰ (v / v) triethylamine and 5‰ (v / v) tetrahydrofuran. Mobile phase B consisted of a ternary mixture of 180 mM sodium acetate buffer (pH 7.2), methanol, and acetonitrile in a 1:2:2 v / v ratio. The gradient elution program was as follows: initial 8% B (0-5 minutes), a linear gradient to 60% B (5-27 minutes), followed by a gradient to 100% B (27-31.5 minutes), a hold at 100% B (31.5-36.5 minutes), and finally a return to 8% B (36.5-40 minutes). The flow rate was set at 0.8 mL / min, the column temperature was maintained at 40°C, and the detection wavelength was 338 nm.

[0057] HPLC analysis of UPI (uroporphyrin I), UPIII (uroporphyrin III) and CPIII (coproporphyrin III):

[0058] 1 M ammonium acetate (pH 5.15) containing 8% (v / v) acetonitrile and 100 mg / L EDTA was used as mobile phase A, and methanol-acetonitrile (92:8, v / v) was used as mobile phase B. A linear gradient program was applied: 0% B (0-8 min), 0-65% B (8-38 min), hold 65% B (38-48 min), 65-0% B (48-49 min), hold 0% B (49-55 min), with a flow rate of 0.8 mL / min, a column temperature of 40°C, and fluorescence detection with an excitation wavelength of 365 nm and an emission wavelength of 625 nm. To obtain a clear separation of UP I and UP III, a special gradient elution program was used: 23% mobile phase B for 5 min, 23% B to 30% B in 10 min, 30% B to 90% B in 5 min, 90% B to 80% B in 1 min, 80% B to 65% B in 5 min, 65% B to 23% B in 4 min, and finally hold at 23% B for 5 min.

[0059] LC-MS analysis of heme:

[0060] A two-component mobile phase was used: (A) 10 mM ammonium formate solution containing 0.1% (v / v) formic acid, and (B) acetonitrile containing 0.1% (v / v) formic acid. Chromatographic separation was achieved at a flow rate of 0.4 mL / min using the following gradient program (total run time 5.2 minutes): 30% B (0-0.1 minutes), 30%-40% B (0.1-0.4 minutes), 40%-55% B (0.4-3.0 minutes), 55%-100% B (3.0-4.0 minutes), 100%-30% B (4.0-4.8 minutes), and a hold of 30% B (4.8-5.2 minutes). Heme was specifically monitored via a mass transition from m / z 616.2 to 557.2. Other mass spectrometry parameters included: capillary voltage 2.5 kV, nitrogen flow rate 14 L / min (200°C), and nebulizer pressure 24 psi.

[0061] HPLC analysis of Hydroquinone:

[0062] The flow rate was 0.6 mL / min; the mobile phase was methanol and water, with a methanol ratio of 45%; the column temperature was 35°C; and the detection wavelength was 220 nm.

[0063] Bacterial growth and glucose concentration detection:

[0064] The bacterial growth was measured by spectrophotometer (Shimadzu Corporation UVmini-1240) at a wavelength of 600 nm. 600The glucose concentration was detected by a Silman M-100 biosensor analyzer.

[0065] Example 1 Optimization of Globin Expression System

[0066] The heme protein encoding genes S-Hb (SEQ ID NO. 1), C-Hb (SEQ ID NO. 2), B-Mb (SEQ ID NO. 3), and P-Mb (SEQ ID NO. 4), each containing a 6×His tag, were constructed onto the pHT01 plasmid. Gibson Assembly was used to generate the plasmids pHT01-S-Hb, pHT01-C-Hb, pHT01-P-Mb, and pHT01-B-Mb. The resulting plasmids were transformed into Bacillus subtilis. Colony PCR and sequencing confirmed the correct positive clones. A single correct clone was inoculated into 2 mL of LB medium and shaken at 37°C and 220 rpm for 12 hours for pre-culture. Subsequently, the pre-cultured cells were inoculated into a 250 mL baffled shake flask containing 25 mL of BSM medium at a 2% (v / v) inoculum. Then, IPTG inducer was added to the culture medium 6 h after inoculation and cultured at 37°C and 220 rpm for 24 h.

[0067] like Figure 1 As shown in A, S-Hb, C-Hb, B-Mb, and P-Mb can all be expressed in Bacillus subtilis. To further improve the expression levels of these proteins, the plasmid copy number (low, medium, and high) and expression type (inducible and constitutive) were optimized using S-Hb as a model.

[0068] S-Hb (SEQ ID NO. 1) was constructed onto the following plasmid backbones (pMINI-gntR, pBMB-gntR, pBMB-lacl, pHK-gntR, pP43NMK), respectively, wherein:

[0069] pMINI-gntR plasmid: P of pP43NMK plasmid 43 The promoter was replaced by P lytE The gluconic acid repressor protein gntR (base C at position 120 changed to T) and P 3-srfAA Promoter (3' end carries the repressor protein GntR recognition sequence ATACTTGTATACAAGTATACTTAT);

[0070] pBMB-gntR plasmid: the replicon repB of the pMINI-gntR plasmid was replaced with the replicon ORFA-ORFB (SEQ ID NO. 21) of the pBMB2062 plasmid;

[0071] pBMB-lacl plasmid: P lytE -gntR and P 3-srfAA The promoter was replaced with the P of pHT01 plasmid lacIq -lacI and P grac100 ;

[0072] pHK-gntR plasmid: P lacIq -lacI and P grac100 Replaced with P of pBMB-gntR plasmid lytE -gntR (SEQ ID NO. 19) and P 3-srfAA Promoter (SEQ ID NO. 20).

[0073] S-Hb (SEQ ID NO.1) was constructed onto different plasmid backbones (pMINI-gntR, pBMB-gntR, pBMB-lacl, pHK-gntR, pP43NMK) using Gibson Assembly to obtain plasmids pMINI-gntR-S-Hb, pBMB-gntR-S-Hb, pBMB-lacl-S-Hb, pHK-gntR-S-Hb and pP43NMK-S-Hb, respectively. The correct single clone was picked and cultured in BSM medium at 37°C and 220 rpm for 6 h under the same conditions as above. Different inducers were used according to the characteristics of the plasmid (strains containing pMINI-gntR-S-Hb, pBMB-gntR-S-Hb, and pHK-gntR-S-Hb plasmids were added with a final concentration of 40 g / L sodium gluconate inducer, strains containing pBMB-lacl-S-Hb were added with a final concentration of 1 mM IPTG inducer, and strains containing pP43NMK-S-Hb plasmids were not added with inducers) at 37°C and 220 rpm for induction. The fermentation broth was collected after 24 hours of fermentation and the expression of S-Hb protein was detected. The results showed that the pMINI-gntR plasmid (high copy, sodium gluconate inducible) showed the best expression effect ( Figure 1 B).

[0074] According to the same method as above, S-Hb, C-Hb, B-Mb and P-Mb were expressed respectively using pMINI-gntR plasmid and cultured at 37°C and 220 rpm for 24 h. The hemoglobin content in the fermentation broth after 24 h of fermentation was detected. The results are as follows: Figure 1As shown in C and 1D, the expression levels of S-Hb, C-Hb, B-Mb, and P-Mb reached 187.36±4.05 mg / L, 200.65±10.11 mg / L, 227.09±7.53 mg / L, and 276.98±15.78 mg / L, respectively. After protein purification, the heme binding rate was tested, and their heme binding rates were 15.59±2.02%, 13.72±1.34%, 22.37±1.91%, and 15.33±0.42%, respectively. Figure 1 E).

[0075] Example 2 Strengthening the C5 pathway to increase carbon flux for heme biosynthesis.

[0076] To enhance the endogenous heme supply in Bacillus subtilis, we first needed to address the insufficient supply of ALA, the precursor for heme synthesis. Therefore, we screened C5 pathways from different species. Using the genomes of Escherichia coli BL21 (DE3), Bacillus subtilis 168 and Corynebacterium glutamicum ATCC 14067 as templates, the hemA genes of Escherichia coli BL21 (DE3), Bacillus subtilis 168 and Corynebacterium glutamicum ATCC 14067 (sequences shown in GenBank: ACT43077.1, Gene ID: 937443, SEQ ID NO. 9, respectively) and the heml genes of Escherichia coli BL21 (DE3), Bacillus subtilis 168 and Corynebacterium glutamicum ATCC 14067 (sequences shown in GenBank: ACT42054.1, Gene ID: 937490, SEQ ID NO. 10, respectively) were amplified and then constructed into the pHT01 plasmid by Gibson Assembly to obtain plasmids pHT01-hemAL-E. coli, pHT01-hemAL-B. subtilis and pHT01-hemAL-C. glutamicum, respectively. Since GsaB may have similar catalytic function to HemA, recombinant plasmids pHT01-hemAgsaB-B.subtilis and pHT01-hemA expressing gsaB (Gene ID: 936194) were also constructed. KK In addition, to prevent proteolysis-mediated feedback inhibition, two lysine residues KK (nucleotide sequence AAGAAG) were inserted between the second and third residues of HemA to generate HemA KK Thus, plasmid pHT01-hemA was constructed. KK LE.coli, pHT01-hemA KK LC.glutamicum, pHT01-hemAKK LB.subtilis. After the above recombinant plasmids were transformed into Bacillus subtilis 168 respectively, the correct single clone was inoculated into 2 mL LB medium and pre-cultured at 37 ° C and 220 rpm for 12 hours. Subsequently, the pre-cultured cells were inoculated into a 250 mL baffled shake flask containing 25 mL BSM medium with an inoculation volume of 2% (v / v). Then, 6 hours after inoculation, IPTG inducer with a final concentration of 1 mM was added to the culture medium and cultured at 37 ° C and 220 rpm for 24 hours. The results showed that the plasmid pHT01-hemA KK The ALA production of LB.subtilis strain was the highest, reaching 26.63±1.96 mg / L ( Figure 2 A).

[0077] Using the CRISPR-Cas9 system, we constructed sdhB (nucleotide sequence is shown in SEQ ID NO.9), P 43 (nucleotide sequence is shown in SEQ ID NO.10), P veg (nucleotide sequence shown in SEQ ID NO.11) and P yvyD (The nucleotide sequence is shown in SEQ ID NO.12) regulated hemA KK and heml gene tandem expression cassette (P veg -hemA KK -hemL), and the constructed expression cassettes were integrated into the amyE gene locus of Bacillus subtilis (Gene ID: 938356), respectively, to obtain strains ALA-I1 to ALA-I4. Strains ALA-I1 to ALA-I4 were fermented in BSM medium at 37°C and 220 rpm for 24 hours, and the ALA production in the fermentation broth was detected. The results showed that the ALA production in the fermentation broth was significantly improved by the use of P veg Promoter expression hemA KK and heml genes (strain ALA-I3) produced the highest ALA accumulation, reaching 13.13±0.72mg / L ( Figure 2 B).

[0078] In addition, the membrane protein HemX has a negative impact on the HemA concentration of Bacillus subtilis. Based on the strain ALA-I3, the hemX gene was knocked out using the CRISPR / CAS9 method. The correct strain ALA-K1 was fermented in BSM medium at 37°C and 220 rpm under shaking conditions for 24 hours. The ALA production in the fermentation broth was detected. The results showed that ( Figure 2B), the ALA production could be further increased to 26.84±1.12 mg / L, which was 2.11 times that of strain ALA-I3.

[0079] Example 3. Attenuation of competing pathways to divert metabolic flux toward heme biosynthesis.

[0080] According to the annotation of the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, there are three proteins in Bacillus subtilis that may have authentic uroporphyrinogen III synthase activity: HemD, NasF (Gene ID: 938324) and YjjA (Gene ID: 939823).

[0081] A three-enzyme reaction system (comprising porphobilinogen synthase, hydroxymethylbilin synthase, and uroporphyrinogen III synthase) was constructed to identify authentic uroporphyrinogen III synthase. Using the genome of Bacillus subtilis 168 as a template, the hemB (Gene ID: 936972), hemC (Gene ID: 937488), and hemD (Gene ID: 937287) genes were amplified and inserted into the pETDuet-1 plasmid using Gibson Assembly, resulting in pETDuet-hemB, pETDuet-hemC, pETDuet-hemD, pETDuet-nasF, and pETDuet-yjjA, respectively. These recombinant plasmids were transformed into Escherichia coli BL21(DE3) strains to construct recombinant strains. Correct single colonies were inoculated into 2 mL of LB medium and pre-cultured at 37°C with shaking at 220 rpm for 12 hours. The pre-cultured cells were then inoculated into TB medium at a 2% (v / v) inoculation ratio and shake-cultured at 37°C until an OD600 of 0.6 was reached. IPTG was added at a final concentration of 1 mM and induced at 19°C for 20 hours. The cells were collected by centrifugation at 4000 rpm for 15 minutes at 4°C. The cell pellet was resuspended in 50 mL of resuspension buffer (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 5 mM imidazole) (the resuspension concentration was OD600). 600 =20) and crushed using a high pressure homogenizer. TMProtein purification was performed using the His-Tag protein purification system. The magnetic beads were washed with a resuspension buffer containing 50 mM imidazole and eluted with a buffer containing 400 mM imidazole. The purified protein was desalted using an AmiconUltra 10K centrifugal filter. Purified HemB and HemC were heated at 60°C for 10 minutes to inactivate any uroporphyrinogen III synthase. Each uroporphyrinogen III synthase (HemD, YjjA, or NasF) was incubated at 0.1 mM in 0.1 M Tris-HCl buffer (pH 8.0) containing 0.5 mM HemB, 0.5 mM HemC, and 0.1 M DTT. Finally, 50 mM ALA was added to the reaction mixture. After reacting at 37°C for 15 minutes, the reaction was stopped with trichloroacetic acid. HPLC analysis results showed that the reaction system containing HemD produced the highest UP III accumulation, while the other groups had almost no UP III accumulation, indicating that HemD has uroporphyrinogen III synthase activity ( Figure 2 C).

[0082] To accelerate the conversion of HMB to UPG III, short peptides RIAD and RIDD, capable of scaffold-free self-assembly, were used to narrow the spatial distance between HemC and HemD. The short peptides RIAD and RIDD were fused to HemC and HemD, respectively, via a flexible linker (G4S)2G4CG. First, the question of whether the short peptides should be fused to the N-terminus or C-terminus of the target protein was explored. The hemC and hemD genes were amplified using the genome of Bacillus subtilis 168 as a template. The RIDD (SEQ ID NO. 6) and RIAD (SEQ ID NO. 7) fragments were obtained by gene synthesis. These fragments were then constructed into the pHT01 plasmid using Gibson Assembly in different ligation schemes, resulting in the plasmids pHT01-RIDD-hemD-RIAD-hemC, pHT01-RIDD-hemD-hemC-RIAD, pHT01-hemD-RIDD-RIAD-hemC, and pHT01-hemD-RIDD-hemC-RIAD. The above plasmids were transformed into wild-type Bacillus subtilis 168, and strains UP-P2 to UP-P5 were constructed. The correct single clones were inoculated into 2 mL LB medium and pre-cultured at 37°C and 220 rpm for 12 hours. Subsequently, the pre-cultured cells were inoculated into 250 mL baffled shake flasks containing 25 mL BSM medium, with an inoculation amount of 2% (v / v). Then, 6 hours after inoculation, IPTG inducer with a final concentration of 1 mM was added to the culture medium, and cultured at 37°C and 220 rpm for 36 hours, wherein 2 g / L LALA was added to the culture medium 12 hours after inoculation. Figure 2As shown in Figure 4, the RIDD-HemD-HemC-RIAD combination is the optimal connection mode. Compared with the tandem overexpression of hemC and hemD genes alone, this connection mode can reduce the accumulation of UP I by 32.58% and increase the accumulation of UP III by 1.64 times.

[0083] Subsequently, using the CRISPR-Cas9 system, RIDD-HemD-HemC-RIAD (nucleotide sequence shown in SEQ ID NO. 8) was integrated into the amyE site of strain ALA-K1 (Gene ID: 938356) in Example 2, and different constitutive promoters P sdhB (nucleotide sequence is shown in SEQ ID NO.9), P yvyD (nucleotide sequence shown in SEQ ID NO.12) and P 556 (The nucleotide sequence is shown in SEQ ID NO.13) and the constructed strains were named UP-I1 to UP-I3. The correct single clone was inoculated into 2 mL of LB medium and cultured at 37°C and 220 rpm for 12 hours for pre-culture. Subsequently, the pre-cultured cells were inoculated into a 250 mL baffled shake flask containing 25 mL of BSM medium at an inoculum size of 2% (v / v). Culture was carried out at 37°C and 220 rpm for 48 hours. Compared with the starting strain ALA-K1, P yvyD Promoter regulation of RIDD-hemD-hemC-RIAD (strain UP-I2) can reduce the accumulation of UP I by 36.88% and increase the accumulation of UP III and CP III by 1.71 times and 17.37 times, respectively ( Figure 2 E).

[0084] Since endogenous HemC without RIAD short peptide tag cannot assemble with RIDD-HemD. In order to further reduce the conversion of HMB to UPG I, the endogenous hemC gene (GeneID: 937488) in strain UP-I2 was knocked out using the CRISPR-Cas9 system, and strain UP-K1 was constructed. The culture was carried out according to the same method as above, and the intermediate metabolites were detected after 48 hours of fermentation. The results showed that the accumulation of UP I in this strain was further reduced by 14.88%, while the accumulation of UP III and CP III increased by 1.40 times and 1.36 times, respectively ( Figure 2 E).

[0085] Example 4: Enhancement of the rate-limiting step of the coproporphyrin-dependent (CPD) pathway to enhance heme synthesis and attenuate heme consumption.

[0086] The heme conversion efficiency of the CPD and PPD pathways was characterized. Using the Bacillus subtilis 168 genome as a template, the hemY (Gene ID: 936311), hemH (Gene ID: 939772), and hemQ genes (Gene ID: 936512) were amplified and incorporated into the pMINI-gntR plasmid using Gibson Assembly, resulting in the plasmid pMINI-gntR-hemYHQ. Using the Escherichia coli BL21(DE3) genome as a template, the hemF (Gene ID: 8179868), hemG (Gene ID: 8181044), and hemH (Gene ID: 8179666) genes were amplified and incorporated into the pMINI-gntR plasmid using Gibson Assembly, resulting in the plasmid pMINI-gntR-hemFGH. The plasmid pMINI-gntR-hemFGH was transformed into the strain UP-I2 constructed in Example 3, and the verified correct single clone was inoculated into 2 mL LB medium and pre-cultured at 37°C and 220 rpm for 12 hours. Subsequently, the pre-cultured cells were inoculated into a 250 mL baffled shake flask containing 25 mL BSM medium with an inoculation volume of 2% (v / v). Then, sodium gluconate inducer with a final concentration of 40 g / L was added 6 hours after inoculation, and sodium gluconate inducer with a final concentration of 40 g / L was added to the culture medium at 36 hours of fermentation, and cultured at 37°C and 220 rpm for 72 hours. Figure 3 As shown in A, strain pMINI-gntR-hemYHQ exhibited higher heme synthesis, demonstrating that the CPD pathway has a higher heme conversion efficiency.

[0087] Subsequently, the hemH (Gene ID: 939772) and hemQ genes (Gene ID: 936512) were amplified using the Bacillus subtilis 168 genome as a template and constructed into the pMINI-gntR plasmid using Gibson Assembly to obtain plasmids pMINI-gntR-hemH, pMINI-gntR-hemQ, and pMINI-gntR-hemHQ. After the above plasmids were transformed into strain UP-I2, the correct single clones were cultured under similar fermentation conditions as above. The results are shown in Figure 2. Figure 3 As shown in A, strain pMINI-gntR-hemQ exhibited the highest heme synthesis, demonstrating that HemQ is the key rate-limiting enzyme in the CPD pathway. Because CPIII accumulated significantly in strain UP-K1, the hemH gene may also need to be overexpressed to alleviate CPIII accumulation.

[0088] Subsequently, hemQ from Bacillus subtilis 168 was integrated into the amyE site of strain UP-K1 constructed in Example 3 (Gene ID: 938356) using the CRISPR-Cas9 system, and was expressed by different constitutive promoters P 333 (nucleotide sequence is shown in SEQ ID NO.14), P 43 (The nucleotide sequence is shown in SEQ ID NO.10), P 556 (nucleotide sequence is shown in SEQ ID NO.13), P TP2 (nucleotide sequence shown in SEQ ID NO.15) and P TP4 (nucleotide sequence as shown in SEQ ID NO.16) to obtain strains Heme-I1 to Heme-I5. HemH-hemQ from Bacillus subtilis 168 was integrated into the amyE site of strain UP-K1 constructed in Example 3 (Gene ID: 938356), and the expression was regulated by different constitutive promoters P 333 (nucleotide sequence is shown in SEQ ID NO.14), P 43 (The nucleotide sequence is shown in SEQ ID NO.10), P 556 (nucleotide sequence is shown in SEQ ID NO.13), P TP2 (nucleotide sequence shown in SEQ ID NO.15) and P TP4 (The nucleotide sequence is shown in SEQ ID NO.16) to regulate expression and obtain strains Heme-I6 to Heme-I10 respectively. The correct single clone was inoculated into 2 mL LB medium and cultured at 37°C and 220 rpm for 12 hours for pre-culture. Subsequently, the pre-cultured cells were inoculated into a 250 mL baffled shake flask containing 25 mL BSM medium with an inoculum volume of 2% (v / v). Cultured at 37°C and 220 rpm for 72 hours. The results are shown in FIG. Figure 3 As shown in B and 3C, the heme titer of strain Heme-I6 reached 14.91±0.80 mg / L, which increased by 13.55 times compared with the starting strain UP-K1 ( Figure 2 E) To verify the metabolic engineering effect of the heme biosynthesis pathway, various intermediate metabolites of strain Heme-I6 were detected at 24, 48 and 72 hours. Figure 3 As shown in D, no porphobilinogen accumulation was detected, and the accumulation levels of ALA, UP III, and CP III were all at low levels at 72 h, indicating that the key bottleneck in the heme synthesis pathway had been resolved.

[0089] To further increase intracellular heme accumulation, efforts were made to prevent its downstream utilization. The CRISPR-Cas9 system was used to knock out the protoheme IX farnesyltransferase (encoded by the ctaB and ctaO genes) and heme monooxygenase (encoded by the hmoA and hmoB genes) in strain Heme-I6. The Gene IDs for ctaB and ctaO are 935922 and 939825, respectively, and the Gene IDs for hmoA and hmoB are 936085 and 939297, respectively. Strains Heme-K1 to Heme-K4 were constructed, each containing single knockouts of ctaB, ctaO, hmoA, and hmoB. Correct single clones were inoculated into 2 mL of LB medium and pre-cultured at 37°C and 220 rpm for 12 hours. Subsequently, the pre-cultured cells were inoculated into 250 mL baffled shake flasks containing 25 mL of BSM medium at a 2% (v / v) inoculum. Culture at 37°C and 220 rpm for 72 hours. Figure 3 As shown in E, the Heme-K2 strain exhibited the highest heme accumulation (22.06 ± 2.52 mg / L). This demonstrates that the protoheme IX farnesyltransferase encoded by the ctaO gene plays a key role in heme consumption in Bacillus subtilis. In addition, the extracellular heme concentration was only 0.37 mg / L ( Figure 3 F).

[0090] Example 5 Properties and applications of Hb and Mb synthesized by engineered Bacillus subtilis.

[0091] The recombinant plasmids pMINI-gntR-S-Hb, pMINI-gntR-C-Hb, pMINI-gntR-B-Mb and pMINI-gntR-P-Mb constructed in Example 1 were respectively transformed into the strain Heme-K2 constructed in Example 4. The correct single clone was inoculated into 2 mL of LB medium and pre-cultured at 37°C and 220 rpm for 12 hours. Subsequently, the pre-cultured cells were inoculated into a 250 mL baffled shake flask containing 25 mL of BSM medium with an inoculation amount of 2% (v / v). At 6 hours, sodium gluconate inducer with a final concentration of 40 g / L was added and cultured at 37°C and 220 rpm for 24 hours. The results are shown in FIG. Figure 4 As shown in A and 4B, the titers of S-Hb, C-Hb, B-Mb and P-Mb reached 212.93±9.92 mg / L, 218.34±2.39 mg / L, 315.44±2.50 mg / L and 335.72±7.73 mg / L, respectively, which were 1.14 times, 1.09 times, 1.39 times and 1.21 times higher than the corresponding titers of the wild-type strain containing the corresponding protein expression plasmid (pMINI-gntR-corresponding protein) constructed in Example 1.

[0092] The heme binding rate, spectral and enzymatic properties of the heme protein synthesized by the strain Heme-K2 were analyzed, and the intracellular synthesized heme protein was purified according to the method of Example 1. The UV-visible absorption spectrum of the purified heme protein at 280-700 nm was recorded using a microplate reader (Benteng Synergy H1). Figure 4 As shown in Figure C, the biosynthesized heme protein exhibited porphyrin-related Soret bands similar to those of the natural standard. Subsequently, the heme binding rate was detected using the pyridinium heme method. The results showed that the heme binding rates of S-Hb, C-Hb, B-Mb, and P-Mb increased by 3.66 times, 5.40 times, 1.81 times, and 2.81 times, respectively, from the wild-type Bacillus subtilis 168 containing the corresponding protein expression plasmids constructed in Example 1 to the Heme-K2 strain, reaching 54.58±2.41%, 74.03±4.13%, 40.51±4.17%, and 43.04±4.59% ( Figure 4 D). Peroxidase activity was determined in a 96-well plate using PBS buffer at pH 7.0 containing purified hemoglobin (0.8-1.2 mg / mL), 8 mM hydrogen peroxide (H2O2) and 4 mM substrate (2,2'-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS) or o-phenylenediamine (OPD) or guaiacol) at room temperature. The specific peroxidase activity of 3,3',5,5'-tetramethylbenzidine (TMB) was determined using TMB colorimetric solution (P0209, Beyotime, China). The total number of conversions of the enzymatic reaction was calculated based on the absorbance value of each substrate at a specific wavelength and its molar absorptivity. The results showed that when TMB ( Figure 4 E), ABTS( Figure 4 F), guaiacol ( Figure 4 G) and OPD( Figure 4 When H) was used as a substrate, the heme protein synthesized by the Heme-K2 strain exhibited peroxidase activity similar to that of the natural standard.

[0093] Example 6 Production of Hb and Mb by fed-batch fermentation.

[0094] The strain Heme-K2 constructed in Example 4 was used for fed-batch fermentation in a 5L bioreactor to verify its potential for large-scale production of Hb and Mb. Since the Heme-K2 strain continuously consumes the inducer sodium gluconate during the expression of Hb or Mb, this poses an obstacle to large-scale fermentation. Therefore, to reduce inducer consumption, we used CRISPR-Cas technology to knock out the gntK gene (Gene ID: 937713) related to gluconic acid utilization in the strain Heme-K2, constructing the Heme-K2-ΔgntK engineered strain.

[0095] The Heme-K2-ΔgntK engineered strain containing the plasmid pMINI-gntR-S-Hb was cultured in BSM medium at 37°C and 220 rpm. 6 h after inoculation, 40 g / L sodium gluconate was used for induction and cultured at 37°C and 220 rpm for 48 h. Figure 5 As shown in A, the sodium gluconate consumption rate of the modified strain was significantly reduced, while cell growth was not affected. In the fed-batch fermentation production of Hb and Mb, the fermentation process used BSM medium, the temperature was 37°C, and NH4OH was used as a neutralizer to maintain the pH at 7.0. The initial glucose concentration was set at 60 g / L, and the glucose concentration was maintained between 5-10 g / L during the fermentation process. 40 g / L of sodium gluconate was added at 4.5 hours to induce the expression of Hb and Mb. At 6 hours, 24 g / L of ammonium sulfate and 48 g / L of yeast extract were added. The mixed feed solution of ammonium sulfate and yeast extract was added at a rate of 25 mL / h. The Heme-K2-ΔgntK engineered strain containing plasmids pMINI-gntR-S-Hb, pMINI-gntR-C-Hb, pMINI-gntR-B-Mb, and pMINI-gntR-P-Mb was fermented under these conditions. The results showed that the titers of S-Hb, C-Hb, B-Mb, and P-Mb reached peak values ​​of 0.81, 0.82, 1.11, and 1.01 g / L, respectively, at 15 hours. Figure 5 B~E), with corresponding productivity of 54.00, 54.67, 73.33 and 67.33 mg / (L·h) respectively. Although the scale-up to 5L bioreactor significantly increased the synthesis of hemoglobin, its heme binding rate and peroxidase activity were comparable to those of shake flask culture ( Figure 5 These results validated the industrial application potential of the HEME-ΔgntK strain and showed that the strain is suitable for large-scale production of functional heme proteins.

[0096] Example 7 Engineering of cytochrome P450-BM3 synthesized by Bacillus subtilis.

[0097] To verify the ability of strain Heme-K2 in Example 4 to synthesize other functional heme proteins as a chassis cell, the cytochrome P450-BM3 sequence shown in SEQ ID NO. 5 was expressed in strain Heme-K2 using the pMINI-gntK plasmid as a vector. The preparation method of the P450-BM3 whole-cell biocatalyst is as follows: First, 1 mL of fermentation broth cultured in BSM medium at 37°C and 220 rpm for 24 hours was taken and the cells were collected by centrifugation at 8,000 rpm for 10 minutes. Subsequently, the resting cell pellet was washed twice with 100 mM potassium phosphate buffer (pH 8.0) and resuspended in 100 mM potassium phosphate buffer (pH 8.0) containing 0.05 g mL-1 glucose. 1 mL of the cell suspension was added with a 0.5 M phenol solution prepared in potassium phosphate buffer to a final phenol concentration of 10 mM. The reaction was carried out in a 24-well plate at 30°C and 220 rpm for 1 hour. After the reaction, 200 μL of the reaction mixture was mixed with 800 μL of methanol and centrifuged at 14,000 rpm for 20 minutes. The supernatant was analyzed by HPLC to detect the amount of hydroquinone produced. Compared with the wild-type Bacillus subtilis 168 expressing P450-BM3, the P450-BM3 protein titer produced by strain Heme-K2 increased by 1.53 times (54.00 mg / L), and the whole-cell catalytic activity towards phenol increased by 3.64 times ( Figure 5 K). This suggests that the engineered Bacillus subtilis chassis cells can serve as a general platform for the synthesis of other heme proteins.

[0098] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An engineered Bacillus subtilis strain, characterized in that: At least one of the following improvements was made based on the starting strain: (1) Overexpression of glutamyl-tRNA reductase and glutamate-1-semialdehyde aminotransferase; (2) knockout or silencing of the hemX gene; (3) overexpression of the rate-limiting enzymes porphobilinogen deaminase and uroporphyrinogen III synthase; (4) knockout or silencing of the hemC gene; (5) overexpression of coproporphyrin ferrochelatase and heme synthase; (6) Knockout or silence the heme farnesyltransferase gene ctaO.

2. The Bacillus subtilis engineered bacteria according to claim 2, characterized in that The glutamyl-tRNA reductase is (a) or (b): (a) Glutamyl-tRNA reductase encoded by gene hemA, whose nucleotide sequence is shown in Gene ID: 937443; (b) HemA, a mutant of glutamyl-tRNA reductase encoded by (a), in which two lysines are inserted between the second and third amino acids. KK .

3. The Bacillus subtilis engineered bacteria according to claim 1, characterized in that The self-assembling polypeptides RIDD and RIAD were fused to the rate-limiting enzymes HemD and HemC, respectively.

4. The genetically engineered bacterium according to any one of claims 1 to 3, characterized in that With promoter P veg Regulate the expression of hemA and heml, using promoter P yvyD Regulate the expression of the RIDD-hemD-hemC-RIAD integration cassette using promoter P 333 Regulates the expression of hemH and hemQ.

5. The engineered Bacillus subtilis strain according to any one of claims 1 to 4, characterized in that Knockout or silencing of the gluconate kinase gene gntK.

6. The engineered Bacillus subtilis strain according to any one of claims 1 to 5, characterized in that Expressing heme proteins; the heme proteins include one or more of soy leghemoglobin S-Hb, clover hemoglobin C-Hb, bovine myoglobin B-Mb, porcine myoglobin P-Mb and cytochrome P450-BM3.

7. The Bacillus subtilis engineered bacteria according to claim 6, characterized in that The pHT01 or pMINI-gntK plasmid is used as an expression vector to express the heme protein.

8. A method for preparing heme protein, characterized in that: The engineered Bacillus subtilis according to any one of claims 1 to 7 is used as a fermentation microorganism, and after fermentation at 30 to 45° C. for 2 to 12 hours, IPTG or gluconic acid is used to induce protein expression.

9. The method according to claim 8, characterized in that Feed was also performed during the fermentation process; the feed consisted of glucose, ammonium sulfate and yeast extract.

10. Use of the engineered Bacillus subtilis according to any one of claims 1 to 7, or the method according to any one of claims 8 to 9, in the preparation of artificial meat, high cell density fermentation, or whole-cell catalytic synthesis of high value-added compounds.

Images