Application of masitinib, C22H17N3 and risedronic acid in preparation of medicines for treating enterovirus infection

Abstract

The invention discloses an application of masitinib, C22H17N3 and risedronic acid in preparation of a medicine for treating enterovirus infection. The invention discloses masitinib, C22H17N3, risedronic acid or derivatives thereof or pharmaceutically acceptable salts thereof or prodrugs thereof, or any one of the following applications of substances taking masitinib, C22H17N3, risedronic acid or derivatives thereof or pharmaceutically acceptable salts thereof as active ingredients in preparation of drugs for inhibiting enteroviruses; a2) a medicine for preventing and / or treating diseases caused by enterovirus infection; and A3) a medicine for improving symptoms caused by enterovirus infection. On the basis of an enterovirus type 71 and / or coxsackie virus drug screening model, an active drug masitinib capable of resisting enterovirus type 71, coxsackie virus group A type 9 and / or coxsackie virus group B type 3 is screened from listed drugs, and effect verification is carried out on a type 1 poliovirus model and / or an echovirus type 11 model.

Description

[0001] This application claims the right to the patent application filed by the applicant Beijing University of Chemical Technology on February 29, 2024, entitled "Masitinib in The Chinese patent application number for the preparation of drugs for treating enterovirus infection is 202410227952.0, 2024 The Chinese patent application titled "Application of C22H17N3 in the Preparation of Drugs for Treating Enterovirus Infections" was filed on 29th of this month. Application number 202410227953.5 and submitted on February 29, 2024 is entitled "References on the use of risedronate in the preparation of drugs for the prevention and / or treatment of intestinal The Chinese patent application number for the application of the invention in the drug for the treatment of viral infection is 202410228230.7, and the full application number of the invention is The entire contents are incorporated herein by reference. Technical Field

[0002] The present invention belongs to the field of medicine, and particularly relates to the application of masitinib, C22H17N3 and risedronic acid in the preparation of medicines for treating enterovirus infection. Background Art

[0003] Enteroviruses are single-stranded, positive-sense RNA viruses belonging to the Picornaviridae family and the Enterovirus genus. They are highly infectious and cause a high rate of morbidity. Enterovirus particles are icosahedral, spherical structures with a diameter of approximately 24 to 30 nm. They lack an envelope and protrusions, making them highly resistant to the surrounding environment and tolerant to gastric acid and ethanol. Enteroviruses primarily include poliovirus (PV), coxsackievirus (CV), echovirus, and the newer digital enteroviruses (including enteroviruses 68-71, 73-91, and 100-101). Enteroviruses are among the leading pathogens causing childhood infections, causing a wide range of illnesses, ranging from mild symptoms such as respiratory and gastrointestinal infections, herpetic pharyngitis, and hand, foot, and mouth disease in children, to severe conditions such as pleurisy, hepatitis, myocarditis, aseptic meningitis, and neonatal sepsis. The clinical and epidemiological characteristics of poliomyelitis were identified in the 19th century. In 1948, the first non-polio human enterovirus was isolated, capable of causing aseptic meningitis. In 1969, enterovirus 71 (EV71) was isolated from the stool of an infant with aseptic meningitis in the United States. It can cause both hand, foot, and mouth disease and aseptic meningitis. Furthermore, researchers identified another pathogen from an enteric isolate, initially named an "orphan" echovirus because it initially failed to produce disease in mice. This virus also causes aseptic meningitis. While poliovirus (PV) primarily affects children under five years of age, it can infect anyone of any age who is not vaccinated. Irreversible paralysis occurs in one in every 200 cases of infection. Of these cases, 5-10% of patients die from respiratory muscle paralysis. Despite the World Health Assembly's 1988 resolution to eradicate polio worldwide, two endemic countries remain. Enterovirus 71 is a virus that can cause hand, foot, and mouth disease (HFMD) and central nervous system infections. It is primarily transmitted through fecal-oral transmission, resulting in low-grade fever, mouth soreness, vomiting, and diarrhea. Due to its high central nervous system infectivity, EV71 can cause clinical symptoms such as aseptic meningitis, myocarditis, and muscle stiffness. Although asymptomatic or mildly symptomatic patients may recover spontaneously and develop antibodies, those who develop severe EV71 infection still face a high risk of death from cardiopulmonary failure and extensive brainstem damage. CV-A9, CVB1-B6, and echoviruses are the main pathogens of aseptic meningitis and several other acute illnesses. Among them, Coxsackievirus A9 (CV-A9) and Coxsackievirus B3 (CVB3) can cause a variety of clinical symptoms, including aseptic meningitis, hand, foot and mouth disease, acute flaccid paralysis and persistent diarrhea, myocarditis, and aseptic meningitis.Furthermore, CVB3 can cause type 1 diabetes through persistent infection and inflammation of pancreatic beta cells. Echovirus is classified into over 30 subtypes, with type 11 (E11) being the most common. E11 causes a wide spectrum of diseases. Some individuals infected with E11 experience no clinical symptoms, representing a latent infection. Symptoms are generally mild, such as rash, fever, and cough. In a minority of individuals, infection can lead to hand, foot, and mouth disease, and in very rare cases, enteroviral uveitis, aseptic meningitis, encephalitis, and acute flaccid paralysis. Neonatal infection with E11 is susceptible to involvement of the digestive, nervous, and cardiovascular systems, potentially causing severe jaundice, liver failure, shock, and multisystem bleeding.

[0004] Masitinib is a specific Ckit inhibitor, primarily used to treat gastrointestinal stromal tumors caused by Ckit mutations. However, because it can inhibit mast cell activity, it can now also be used to treat asthma, multiple sclerosis, and mast cell leukemia. Risedronic acid is a calcium regulator. Risedronic acid sodium can bind to hydroxyapatite in bone and inhibit bone resorption. At the cellular level, risedronate sodium can inhibit osteoclasts. Osteoclasts are normally present on the surface of bone but do not have significant resorption activity. Histomorphometric measurements of rats, dogs, and piglets have shown that this product can reduce bone turnover (activation frequency, that is, the rate at which bone tissue remodeling sites are activated) and resorption at bone remodeling sites.

[0005] There are currently no reports on the inhibition of enterovirus infection by masitinib, C22H17N3, and risedronic acid. Summary of the Invention

[0006] The present invention aims to provide the use of masitinib, C22H17N3 and risedronic acid in the preparation of a drug for treating enterovirus infection.

[0007] The present invention provides the use of masitinib, C22H17N3, risedronic acid or its derivatives or pharmaceutically acceptable salts or prodrugs thereof, or a substance containing masitinib, C22H17N3, risedronic acid or its derivatives or pharmaceutically acceptable salts thereof as an active ingredient in the preparation of any of the following:

[0008] A1) Drugs that inhibit enterovirus;

[0009] A2) Medicinal products for the prevention and / or treatment of diseases caused by enterovirus infections;

[0010] A3) Drugs that improve symptoms caused by enterovirus infection;

[0011] Wherein, the structural formula of the C22H17N3 is shown in Formula II:

[0012]

[0013] The structural formula of risedronic acid is shown in the following formula III:

[0014]

[0015] In the present invention, the structural formula of masitinib is as shown in Formula I:

[0016]

[0017] In the above application, the enterovirus is at least one of poliovirus, coxsackievirus, echovirus and digital enterovirus;

[0018] The digital enterovirus is selected from at least one of enteroviruses 68-71, enteroviruses 73-91 and enteroviruses 100-101.

[0019] In the above application, the enterovirus includes at least one of poliovirus type 1, enterovirus type 71, coxsackievirus group A type 9, coxsackievirus group B type 3 and echovirus type 11.

[0020] In the present invention, the Genbank accession number of the amino acid sequence encoded by the full gene of enterovirus 71 is AEU10773.1; the Genbank accession number of the full genome sequence is JN230523.1;

[0021] The Genbank accession number of the amino acid sequence of the protein encoded by the full gene of the Coxsackievirus group A type 9 is UJG81396.1; the Genbank accession number of the full genome sequence is MW192795.1;

[0022] The Genbank accession number of the amino acid sequence of the protein encoded by the full gene of the Coxsackievirus group B type 3 is AEH42467.1; the Genbank accession number of the full genome sequence is JN048468.1;

[0023] The Genbank accession number of the amino acid sequence encoded by the full gene of Echovirus type 11 is QNS36366.1; the Genbank accession number of the full genome sequence is MN817130.1;

[0024] The Genbank accession number of the amino acid sequence encoded by the full gene of the type 1 poliovirus is CAA24465.1; the Genbank accession number of the full genome sequence is V01150.1.

[0025] In the above application, the inhibiting of enterovirus is inhibiting enterovirus at the organism level or the cell level;

[0026] The inhibiting of enterovirus refers to inhibiting the replication of enterovirus.

[0027] In the above application, the inhibition of enterovirus plays a role in the whole process of its entry into the host or host cell and the genome replication stage after entry into the cell.

[0028] In the above application, the disease caused by enterovirus infection is selected from at least one of the following: hand, foot and mouth disease, herpangina, encephalitis, aseptic meningitis, acute weak limb paralysis, acute hemorrhagic conjunctivitis, myositis, muscle calcification, motor end plate abnormalities, pleural ulcer, myocarditis, pericarditis and hepatitis.

[0029] In the above application, the symptoms caused by enterovirus infection include at least one of headache, fever, vomiting, sneezing, coughing, rash and muscle stiffness.

[0030] The present invention also provides a drug, the active ingredients of which are masitinib, C22H17N3 and risedronic acid or its derivatives or pharmaceutically acceptable salts or prodrugs thereof, or a substance containing the active drugs or their derivatives or pharmaceutically acceptable salts as active ingredients; the active drugs are selected from masitinib, C22H17N3 and / or risedronic acid; the drug has any of the following uses:

[0031] A1) Inhibit enterovirus;

[0032] A2) Prevention and / or treatment of diseases caused by enterovirus infection;

[0033] A3) Improve symptoms caused by enterovirus infection.

[0034] In the above-mentioned medicine, the enterovirus is at least one of poliovirus, coxsackievirus, echovirus and digital enterovirus;

[0035] The digital enterovirus is selected from at least one of enteroviruses 68-71, enteroviruses 73-91 and enteroviruses 100-101.

[0036] In the above-mentioned medicine, the enterovirus includes at least one of poliovirus type 1, enterovirus type 71, coxsackievirus group A type 9, coxsackievirus group B type 3 and echovirus type 11.

[0037] In the above-mentioned medicine, the Genbank accession number of the amino acid sequence encoded by the full gene of enterovirus 71 is AEU10773.1; the Genbank accession number of the full genome sequence is JN230523.1;

[0038] The Genbank accession number of the amino acid sequence of the protein encoded by the full gene of the Coxsackievirus group A type 9 is UJG81396.1; the Genbank accession number of the full genome sequence is MW192795.1;

[0039] The Genbank accession number of the amino acid sequence of the protein encoded by the full gene of the Coxsackievirus group B type 3 is AEH42467.1; the Genbank accession number of the full genome sequence is JN048468.1;

[0040] The Genbank accession number of the amino acid sequence encoded by the full gene of Echovirus type 11 is QNS36366.1; the Genbank accession number of the full genome sequence is MN817130.1;

[0041] The Genbank accession number of the amino acid sequence encoded by the full gene of the type 1 poliovirus is CAA24465.1; the Genbank accession number of the full genome sequence is V01150.1.

[0042] In the above-mentioned medicines, the inhibition of enterovirus refers to the inhibition of enterovirus at the organism level or the cellular level;

[0043] The inhibiting of enterovirus refers to inhibiting the replication of enterovirus.

[0044] In the above-mentioned medicines, the inhibition of enterovirus plays a role in the whole process of its entry into the host or host cells and the genome replication stage after entry into the cell.

[0045] Among the above-mentioned medicines, the diseases caused by enterovirus infection are selected from at least one of the following: hand, foot and mouth disease, herpangina, encephalitis, aseptic meningitis, acute weak limb paralysis, acute hemorrhagic conjunctivitis, myositis, muscle calcification, motor end plate abnormalities, pleural ache, myocarditis, pericarditis and hepatitis.

[0046] In the above-mentioned medicine, the symptoms caused by enterovirus infection include at least one of headache, fever, vomiting, sneezing, coughing, rash and muscle stiffness.

[0047] In the present invention, the masitinib, C22H17N3 and risedronic acid are derived from a listed drug library (drug number L1000, containing 2080 drugs already on the market, Shanghai Taosu Biochemical Technology Co., Ltd.).

[0048] The present invention has the following beneficial effects:

[0049] Based on the enterovirus 71 and coxsackievirus drug screening model, the present invention screened out masitinib and C22H17N3, active drugs against enterovirus 71, coxsackievirus group A type 9, and coxsackievirus group B type 3, from marketed drugs. Their efficacy was verified in a poliovirus type 1 model and an echovirus type 11 model. Furthermore, based on the enterovirus 71 drug screening model, risedronate was screened out from marketed drugs, active against enterovirus 71. The present invention has important clinical application value for the treatment of diseases caused by enterovirus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 The cells were cultured for 24 hours. After 24 hours of infection with EV71 at MOI = 0.1, the EC of masitinib (i.e., the compound shown in Formula I) against EV71 in RD cells was 50 、CC 50 and SI.

[0051] Figure 2 The cells were cultured for 24 h and infected with CV-A9 at MOI = 0.001 for 36 h. The EC value of masitinib (i.e., the compound shown in Formula I) against CV-A9 in RD cells was 50 、CC 50 and SI.

[0052] Figure 3 The cells were cultured for 24 h. After 24 h of infection with PV1 at an MOI of 0.003, the EC value of masitinib (i.e., the compound shown in Formula I) against PV1 in RD cells was 50 、CC 50 and SI.

[0053] Figure 4 The cells were cultured for 24 hours and infected with E11 at MOI = 0.005 for 24 hours. The EC of masitinib (i.e., the compound shown in Formula I) against E11 in RD cells was 50 、CC 50 and SI.

[0054] Figure 5 The cells were cultured for 24 h. After 24 h of infection with CVB3 at an MOI of 0.1, the EC value of masitinib (i.e., the compound shown in Formula I) in Vero E6 cells was 50 、CC 50 and SI.

[0055] Figure 6 These are the experimental results of the administration time of masitinib at 15 μM for EV71.

[0056] Figure 7 The experimental results of the administration time of masitinib at 10 μM for CV-A9.

[0057] Figure 8 These are the experimental results of the administration time of masitinib at 6.25 μM on PV1.

[0058] Figure 9 The experimental results of the administration time of masitinib at 12.5 μM for E11.

[0059] Figure 10 The results of the drug addition time experiment of masitinib at 12.5 μM on CVB3.

[0060] Figure 11 The cells were cultured for 24 hours. After 24 hours of infection with EV71 at MOI = 0.1, the EC of C22H17N3 (i.e., the compound shown in Formula II) against EV71 in RD cells was 50 、CC 50 and SI.

[0061] Figure 12 After 24 h of cell culture and 36 h of infection with CV-A9 at MOI = 0.001, the EC of C22H17N3 (i.e., the compound shown in Formula II) against CV-A9 in RD cells was 50 、CC 50 and SI.

[0062] Figure 13 The cells were cultured for 24 hours and infected with PV1 at MOI = 0.003 for 24 hours. The EC of C22H17N3 (i.e. the compound shown in formula II) against PV1 in RD cells was 50 、CC 50 and SI.

[0063] Figure 14 The cells were cultured for 24 hours and infected with E11 at MOI = 0.005 for 24 hours. The EC of C22H17N3 (i.e. the compound shown in formula II) against E11 in RD cells was 50 、CC 50 and SI.

[0064] Figure 15 The cells were cultured for 24 h. After 24 h of infection with CVB3 at MOI = 0.1, the EC of C22H17N3 (i.e., the compound shown in Formula II) in Vero E6 cells was 50 、CC 50 and SI.

[0065] Figure 16 The experimental results of the dosing time of C22H17N3 at 10μM for EV71.

[0066] Figure 17 The experimental results of the dosing time of C22H17N3 at 2μM for CV-A9.

[0067] Figure 18 These are the experimental results of the dosing time of C22H17N3 at 3.12 μM on PV1.

[0068] Figure 19 The experimental results of the addition time of C22H17N3 at 6.25μM for E11.

[0069] Figure 20 The experimental results of the addition time of C22H17N3 at 6.25μM for CVB3.

[0070] Figure 21 The cells were cultured for 24 hours. After 24 hours of infection with EV71 at an MOI of 0.1, the EC of risedronic acid (i.e., the compound shown in Formula III) against EV71 in RD cells was 50 、CC 50 and SI.

[0071] Figure 22 The experimental results of risedronic acid administration time on EV71 at 50 μM.

[0072] Figure 23 The results show that 10 μM masitinib and 5 μM C12H17N3 inhibited the activity of EV71 ribosome entry site.

[0073] Figure 24 The results show that 10 μM masitinib and 5 μM C12H17N3 inhibited the activity of CV-A9 ribosome entry site. DETAILED DESCRIPTION

[0074] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0075] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0076] Masitinib used in the present invention is in powder form and stored at -20°C. It is prepared into a solution with DMSO before use. Masitinib is obtained from a listed drug library (product number L1000, containing 2080 listed drugs, Shanghai Taosu Biochemical Technology Co., Ltd.).

[0077] The C22H17N3 used in the embodiment of the present invention is in the form of powder and is stored at -20°C in the dark. When used, it is prepared into a solution with DMSO.

[0078] The risedronic acid used in the embodiment of the present invention is in the form of powder and is stored at -20°C in the dark. When used, it is prepared into a solution with DMSO.

[0079] The following examples were processed using GraphPad-Prism 8.3.0 statistical software. The experimental results are expressed as mean values ​​and T-test was used. ns indicates no difference (P>0.5), * indicates a significant difference (P<0.1), ** indicates a significant difference (P<0.01), *** indicates a very significant difference (P<0.001), and **** indicates an extremely significant difference (P<0.0001).

[0080] Example 1. Cell culture, virus culture and plasmid amplification

[0081] The human rhabdomyosarcoma cell line RD was obtained from the American Type Culture Collection (ATCC, CRL-3216™) and cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS; Gibco Invitrogen) at 37°C in a 5% CO2 incubator.

[0082] Vero E6 African green monkey kidney cells were obtained from the American Type Culture Collection (ATCC, No. 1586) and cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS; Gibco Invitrogen) at 37°C in a 5% CO2 incubator.

[0083] EV71, CV-A9, PV1, and E11, members of the Picornaviridae family Enterovirus, were propagated in RD cells, and CVB3, a member of the Picornaviridae family Enterovirus, was propagated in Vero E6 cells. Plaque assay and TCID 50 Virus titer was determined by immunohistochemistry. All infection experiments were performed in a biosafety level 2 (BSL-2) laboratory.

[0084] Among the above viruses, CV-A9 is the Coxsackievirus group A type 9 strain BUCT01, which has a deposit number of CGMCC No. 20091 at the China General Microbiology Center of the China Culture Collection Administration, and a deposit date of October 28, 2020. EV71 (C4 subtype, Xiangyang-Hubei-09 strain), PV1 (Sabin vaccine strain), E11, and CVB3 (Nancy strain) were kindly provided by Professor Luo Zhen's laboratory at the Institute of Pathogenic Microbiology, Jinan University (Inhibition of PIKFYVE kinase interferes with the ESCRT pathway to suppress RNA virus replication, doi:10.1002 / jmv.28527.).

[0085] The pRHF plasmid was kindly provided by Professor Luo Zhen's laboratory at the Institute of Pathogenic Microbiology, Jinan University (SIRT1 inhibits EV71 genome replication and RNA translation by interfering with the viral polymerase and 5'UTR RNA, doi:10.1242 / jcs.193698). The empty vector was digested with Not I restriction endonuclease (NEB), and homologous recombination primers and homologous recombination reagents (Yisheng Biotechnology) were used to insert the EV71 and CV-A9 IRES sequences used in this experiment between the firefly luciferase and Renilla luciferase enzymes. Homologous recombination primers were used to transform the vector into DH5α competent cells (Beijing Quanshijin Biotechnology). Band size was confirmed by agarose gel electrophoresis, and suitable clones were selected for sequencing to further confirm the success of homologous recombination. The plasmids were designated pRHF-5'UTR-EV71 and pRHF-5'UTR-CV-A9.

[0086] Example 2: Real-time fluorescence quantitative PCR

[0087] In the present invention, the primers used in real-time fluorescence quantitative PCR are shown in Table 1, the SYBR-Green method amplification procedure is shown in Table 2, and the reaction system is shown in Table 3.

[0088] Table 1 Primer sequences used in the study

[0089] Primer name Sequence (5'-3') EV71-F CCCTTTAGTGGTTAGGATTT EV71-R CACCAGTTGGTTTAATGGAG CV-A9-F TCATGACACCAGCTGATAAGG CV-A9-R TGCTCATCTGCTCTGAAGTATC E11-F CGGCCCCTGAATGCGGCTAA E11-R GAAACACGGACACCCAAAGTA PV1-F CCGTATTGAGCCAGTATGTTTGT PV1-R TAGCGAGTAGGTGGAGGTGTTCT CVB3-F CGGTACCTTTGTGCGCCTGTT CVB3-R GCGGTGCTCATCGACCTGA GAPDH-F AGCCTCAAGATCATCAGCAATG GAPDH-R ATGGACTGTGGTCATGAGTCCTT

[0090] Table 2 Dye-based qPCR amplification procedures

[0091]

[0092] Table 3 Dye method reaction system

[0093]

[0094] In the present invention, GraphPad-Prism 8.3.0 software was used for data analysis.

[0095] Example 3: Masitinib, C22H17N3, and Risedronate inhibit enterovirus EC 50 and CC 50 Determination of EC 50 Detection: When testing EV71, CV-A9, PV1 and E11, 2.5×10 4 RD cells were seeded into 96-well plates. When testing CVB3, 2.5×10 4Vero E6 cells were seeded into 96-well plates and cultured in a 37°C, 5% CO2 incubator for 24 h.

[0096] Masitinib, C22H17N3, and risedronate were each diluted to 200 μM in DMEM medium containing 2% FBS (i.e., maintenance medium). Subsequently, the drugs were diluted two-fold in the cell maintenance medium to obtain 10 concentrations of masitinib solution. Each concentration was inoculated into two wells (50 μl / well). Simultaneously, the virus dilution was added to the cell wells (50 μl / well) to achieve an MOI of 0.1 for EV71, 0.001 for CV-A9, 0.003 for PV1, 0.1 for CVB3, and 0.005 for E11.

[0097] The test was continued for about 24 hours until the negative control group (i.e., the group with virus added but no reagents added) showed obvious lesions under the microscope and took a photo. A blank group was also set up. The expression of intracellular viral RNA and the intracellular reference gene GAPDH was quantitatively detected by RT-qPCR. GraphPad-Prism 8 software was used for data analysis and calculation of EC 50 (Among them, the EC of masitinib against EV71 was tested 50 The drug inlet concentrations were 50 μM, 40 μM, 30 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, 1.56 μM, 0.78 μM, and 0.39 μM, respectively, to test the EC values ​​of masitinib against CV-A9, CVB3, PV1, and E11. 50 The drug inlet concentrations were 100μM, 50μM, 25μM, 12.5μM, 6.25μM, 3.12μM, 1.56μM, 0.78μM, 0.39μM, and 0.2μM, respectively.

[0098] CC 50 Detection: CC was performed using the Cell Titer-Blue method 50Detection. RD cells and Vero E6 cells were seeded into 96-well cell culture plates, and the test was carried out when the cell density reached 60%-80%. After the RD cells and Vero E6 cells were replaced with the diluted drugs, the final concentrations were 50μM, 40μM, 30μM, 25μM, 12.5μM, 6.25μM, 3.125μM, 1.56μM, 0.78μM, 0.39μM, or 100μM, 50μM, 25μM, 12.5μM, 6.25μM, 3.12μM, 1.56μM, 0.78μM, 0.39μM, 0.2μM, and 2 wells were inoculated for each concentration. The cells were cultured at 37℃ with 5% CO2 for 48h, and the luminescence intensity at 593nm was detected using Cell Titer-Blue reagent. The data were analyzed and calculated using GraphPad-Prism 8 software. 50 .

[0099] EC 50 It refers to the drug concentration that can effectively inhibit 50% of cells from being infected with the virus. The smaller the value, the better the inhibitory effect on the virus.

[0100] CC 50 It is the drug concentration that causes 50% of cells to become diseased. The higher the value, the lower the toxicity to cells.

[0101] SI: Selectivity index, CC 50 With EC 50 The larger the value, the higher the possibility of drug development.

[0102] EC of masitinib against EV71 50 and CC 50 The results of the test are as follows Figure 1 As shown, the EC of CV-A9 50 and CC 50 The results of the test are as follows Figure 2 As shown, the EC of PV1 50 and CC 50 The results of the test are as follows Figure 3 As shown, EC of E11 50 and CC 50 The results of the test are as follows Figure 4 As shown, the EC of CVB3 50 and CC 50 The results of the test are as follows Figure 5 The left vertical axis in the figure represents the inhibition rate of masitinib on the virus, the right vertical axis represents the toxicity of masitinib on RD cells or Vero E6 cells, and the horizontal axis represents the concentration Log10 (μM) of masitinib.

[0103] Figure 1The results showed that masitinib had an effect on the EC of EV71 in RD cells. 50 =4.02μM, CC 50 =25.65 μM, SI =6.38; Figure 2 The results showed that the EC of masitinib against CV-A9 in RD cells 50 =0.58μM, CC 50 =19.31 μM, SI = 33.29; Figure 3 The results showed that masitinib had an effect on the EC of PV1 in RD cells. 50 =0.25μM, CC 50 =19.31 μM, SI =77.24; Figure 4 The results showed that masitinib had an effect on the EC of E11 in RD cells. 50 =0.36μM, CC 50 =19.31 μM, SI = 53.64; Figure 5 The results showed that the EC50 of masitinib for CVB3 in Vero E6 cells was 1.83 μM, CC50 was 28.29 μM, and SI was 15.46. For EV71, the drug concentration in the range of 12.5-25 μM has a good antiviral effect (99%-90%); for CV-A9, the drug concentration in the range of 12.5-25 μM has a good antiviral effect (99%-90%); for PV1, the drug concentration in the range of 1.56-25 μM has a good antiviral effect (99%-90%); for E11, the drug concentration in the range of 6.25-25 μM has a good antiviral effect (99%-90%); for CVB3, the drug concentration in the range of 6.25-25 μM has a good antiviral effect (99%-90%); from the above results, it can be seen that masitinib is a potential inhibitor of EV71, CV-A9, PV1, E11 and CVB3 infected cells.

[0104] EC of C22H17N3 against EV71 50 and CC 50 The results of the test are as follows Figure 11 As shown, the EC of CV-A9 50 and CC 50 The results of the test are as follows Figure 12 As shown, the EC of PV1 50 and CC 50 The results of the test are as follows Figure 13 As shown, EC of E11 50 and CC 50 The results of the test are as follows Figure 14 As shown, the EC of CVB3 50 and CC 50 The results of the test are as follows Figure 15 The left vertical axis in the figure represents the inhibition rate of C22H17N3 on the virus, the right vertical axis represents the toxicity of C22H17N3 on RD cells or Vero E6 cells, and the horizontal axis represents the concentration Log10 (μM) of C22H17N3.

[0105] Figure 11 The results showed that C22H17N3 had an EC 50 =0.92μM, CC 50 =15.36 μM, SI=16.70; Figure 12 The results showed that the EC of C22H17N3 to CV-A9 on RD cells was 50 =0.84μM, CC 50 =15.43 μM, SI=18.29; Figure 13 The results showed that the EC of C22H17N3 to PV1 in RD cells 50 =0.73μM, CC 50 =15.36 μM, SI=21.04; Figure 14 The results showed that C22H17N3 had an EC effect on E11 in RD cells. 50 =0.76μM, CC 50 =15.36 μM, SI=21.04; Figure 15 The results showed that the EC of C22H17N3 to CVB3 was 50 =0.38μM, CC 50 =11.98μM, SI=31.53. For EV71, the drug concentration ranged from 3.12 to 12.5μM, exhibiting a strong antiviral effect (99%-90%); for CV-A9, the drug concentration ranged from 1.56 to 12.5μM, exhibiting a strong antiviral effect (99%-90%); for PV1, the drug concentration ranged from 0.78 to 12.5μM, exhibiting a strong antiviral effect (99%-90%); for E11, the drug concentration ranged from 3.12 to 12.5μM, exhibiting a strong antiviral effect (99%-90%); for CVB3, the drug concentration ranged from 1.56 to 6.25μM, exhibiting a strong antiviral effect (99%-90%). These results suggest that C22H17N3 is a potential inhibitor of EV71, CV-A9, PV1, E11, and CVB3-infected cells.

[0106] EC of risedronate against EV71 50 and CC 50 The results of the test are as follows Figure 21As shown in the figure, the left vertical axis represents the inhibition rate of risedronic acid on viruses, the right vertical axis represents the toxicity of risedronic acid on RD cells, and the horizontal axis represents the concentration Log10 (μM) of risedronic acid.

[0107] Figure 21 The results showed that risedronate had an effect on the EC of EV71 in RD cells. 50 =11.2μM, CC 50 >100μM, SI>8.93. For EV71, the drug concentration in the range of 50-100μM has a good antiviral effect (99% to 90%), suggesting that risedronic acid is a potential inhibitor of EV71-infected cells.

[0108] Example 4, dosing time experiment

[0109] 2.5×10 cells were seeded in 24-well plates. 5 RD cells were infected with EV71 at an MOI of 0.1, CV-A9 at an MOI of 0.001, PV1 at an MOI of 0.003, and E11 at an MOI of 0.005 after 24 hours. Or 2.5×10 5 Vero E6 cells were infected with CVB3 at an MOI of 0.1 24 hours later. Masitinib (15 μM for EV71, 10 μM for CV-A9, 6.25 μM for PV1, 12.5 μM for E11, and 12.5 μM for CVB3) or C22H17N3 (10 μM for EV71) were added to the three experimental groups at the time of virus addition and 2 hours after virus incubation. The cells were treated with C22H17N3 (a final concentration of 5 μM C22H17N3 was added to CV-A9, a final concentration of 3.12 μM C22H17N3 was added to PV1, a final concentration of 6.25 μM C22H17N3 was added to E11, and a final concentration of 6.25 μM C22H17N3 was added to CVB3), or the corresponding concentration of risedronate (a final concentration of 50 μM risedronate was added). After further incubation for 12 hours, RNA was extracted from the cells in the culture wells, and RT-qPCR was used to determine viral replication in the cells and the expression of the cellular reference gene GAPDH. A drug-treated control group was also set up, in which no drug was added during the entire viral infection process, and only the corresponding volume of DMEM medium containing 2% fetal bovine serum was added.

[0110] The results are as follows Figure 6、 Figure 7 、 Figure 8 、 Figure 9 、 Figure 10 、 Figure 16 、 Figure 17 、 Figure 18 、 Figure 19 、 Figure 20 and Figure 22 As shown. Each of the above bar graphs from left to right shows the relative expression levels of viral mRNA in the poisoned control group, the entire time course, before entry, and after entry. The results of the drug addition time experiment showed that Masitinib had an inhibitory effect on EV71 both before and after entry ( Figure 6 ); Masitinib has an inhibitory effect on CV-A9 during its entry into the cell and a partial inhibitory effect after its entry ( Figure 7 ); Masitinib has an inhibitory effect on PV1 both during and after cytosolic entry ( Figure 8 ); Masitinib has a partial inhibitory effect on E11 mainly after it enters the cell ( Figure 9 ); Masitinib has an inhibitory effect on CVB3 both during and after its entry into the cell ( Figure 10 C22H17N3 has an inhibitory effect on EV71 both during and after its entry into the cell ( Figure 16 ); C22H17N3 has an inhibitory effect on CV-A9 after cytosolic entry and has a partial inhibitory effect on cytosolic entry ( Figure 17 ); C22H17N3 has an inhibitory effect on PV1 mainly after it enters the cell ( Figure 18 ); C22H17N3 has a partial inhibitory effect on E11 mainly after it enters the cell ( Figure 19 ); C22H17N3 has an inhibitory effect on CVB3 both during and after its entry into the cell ( Figure 20 Risedronate has an inhibitory effect on EV71 both during and after its entry into the cell ( Figure 22 ).

[0111] Example 5: Experiment on drug inhibition of viral ribosome entry site activity

[0112] pRHF-5'UTR-EV71 or pRHF-5'UTR-CVA9 and pRHF empty vector were respectively transformed into 293T cells. Transfection was performed using a universal transfection reagent (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., product catalog number 40808ES03). 4 hours after transfection, the DNA-liposome complex was removed, washed once with PBS, and drugs diluted with maintenance medium were added (masitinib concentration was 10 μM; C22H17N3 concentration was 5 μM; positive control drug apigenin was 50 μM). After incubation at 37°C for 24 hours, a dual-luciferase reporter gene detection kit was used (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., product catalog number 11402ES80). The luciferase expression ratio relative to the negative control group was calculated by the formula: [(firefly luciferase value 实验组 - background) / (Renilla luciferase value 实验组 -background)] / [(firefly luciferase value 阴性对照组 - background) / (Renilla luciferase value 阴性对照组 -background)].

[0113] The results showed that the EV71 IRES activity decreased by 28.02% after the addition of 10 μM masitinib ( Figure 23 , formula: 1-relative luciferase expression ratio, i.e. inhibition rate = 1-71.98% = 28.02%), CV-A9 IRES activity decreased by 71.86% ( Figure 24 , formula: 1-relative luciferase expression ratio, i.e. inhibition rate = 1-28.14% = 71.86%); after adding 5μM C22H17N3, EV71 IRES activity decreased by 37.35% ( Figure 23 , formula: 1-relative luciferase expression ratio, i.e. inhibition rate = 1-62.65 = 37.35%), CV-A9 IRES activity decreased by 47.81% ( Figure 24 , formula: 1-relative luciferase expression ratio, that is, inhibition rate = 1-52.19 = 47.81%).

[0114] In the present invention, the inventors found that masitinib and C22H17N3 exhibited good dose-dependent antiviral effects and low cytotoxicity against infections with enterovirus 71, coxsackievirus A9 strain BUCT01, poliovirus type 1, echovirus 11, and coxsackievirus B3 in RD cells. Risedronate also exhibited good dose-dependent antiviral effects and low cytotoxicity against infection with enterovirus 71. Currently, there are no specific drugs for enterovirus 71, coxsackievirus A9, poliovirus type 1, echovirus 11, coxsackievirus B3, or other enteroviruses. Therefore, the present invention provides important insights into the future clinical use of enterovirus 71, coxsackievirus A9, poliovirus type 1, echovirus 11, coxsackievirus B3, or other enteroviruses.

[0115] The above describes the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included in the scope of protection of the present invention.

Claims

1. Use of masitinib, C22H17N3, risedronic acid or its derivatives or pharmaceutically acceptable salts or prodrugs thereof, or a substance containing masitinib, C22H17N3, risedronic acid or its derivatives or pharmaceutically acceptable salts thereof as an active ingredient in the preparation of any of the following: A1) Drugs that inhibit enterovirus; A2) Medicinal products for the prevention and / or treatment of diseases caused by enterovirus infections; A3) Drugs that improve symptoms caused by enterovirus infection; in, The structural formula of the C22H17N3 is shown in Formula II: The structural formula of risedronic acid is shown in the following formula III:

2. The use according to claim 1, characterized in that The enterovirus is at least one of poliovirus, coxsackievirus, echovirus and digital enterovirus; The digital enterovirus is selected from at least one of enteroviruses 68-71, enteroviruses 73-91 and enteroviruses 100-101.

3. The use according to claim 1, characterized in that The enterovirus specifically includes at least one of poliovirus type 1, enterovirus type 71, coxsackievirus group A type 9, coxsackievirus group B type 3 and echovirus type 11.

4. The use according to claim 1 or 2, characterized in that The said inhibition of enterovirus is to inhibit enterovirus at the organism level or the cell level; The inhibiting of enterovirus refers to inhibiting the replication of enterovirus.

5. The use according to claim 1 or 2, characterized in that: The inhibition of enterovirus is to play a role in the whole process of its entry into the host or host cell and the genome replication stage after entry into the cell.

6. The use according to claim 1 or 2, characterized in that The disease caused by enterovirus infection is selected from at least one of the following: hand, foot and mouth disease, herpangina, encephalitis, aseptic meningitis, acute weakness and paralysis of limbs, acute hemorrhagic conjunctivitis, myositis, muscle calcification, motor end plate abnormalities, pleural ulcer, myocarditis, pericarditis and hepatitis; The symptoms caused by enterovirus infection include at least one of headache, fever, vomiting, sneezing, coughing, rash and muscle stiffness.

7. A drug, wherein the active ingredient is an active drug or its derivative or its pharmaceutically acceptable salt or prodrug, or a substance containing the active drug or its derivative or pharmaceutically acceptable salt as the active ingredient; the active drug is selected from masitinib, C22H17N3 and / or risedronic acid; The drug has any of the following uses: A1) Inhibit enterovirus; A2) Prevention and / or treatment of diseases caused by enterovirus infection; A3) Improve symptoms caused by enterovirus infection.

8. The medicine according to claim 7, characterized in that The enterovirus is at least one of poliovirus, coxsackievirus, echovirus and digital enterovirus; The digital enterovirus is selected from at least one of enteroviruses 68-71, enteroviruses 73-91 and enteroviruses 100-101.

9. The medicine according to claim 7, characterized in that The enterovirus includes at least one of poliovirus type 1, enterovirus type 71, coxsackievirus group A type 9, coxsackievirus group B type 3 and echovirus type 11.

10. The medicine according to claim 7, characterized in that The said inhibition of enterovirus is to inhibit enterovirus at the organism level or the cell level; The inhibiting of enterovirus is inhibiting the replication of enterovirus; The inhibition of enterovirus is to play a role in the whole process of its entry into the host or host cell and the genome replication stage after entry; The disease caused by enterovirus infection is selected from at least one of the following: hand, foot and mouth disease, herpangina, encephalitis, aseptic meningitis, acute weakness and paralysis of limbs, acute hemorrhagic conjunctivitis, myositis, muscle calcification, motor end plate abnormalities, pleural ulcer, myocarditis, pericarditis and hepatitis; The symptoms caused by enterovirus infection include at least one of headache, fever, vomiting, sneezing, coughing, rash and muscle stiffness.

Images