Application of Tribbles homologous protein 3 pseudokinase gene TRIB3 in preparation of medicine for promoting nerve growth and regeneration

Abstract

The invention discloses an application of a Tribbles homologous protein 3 pseudokinase gene TRIB3 in preparation of a medicine for promoting nerve growth and regeneration. The invention proposes and verifies that the expression of the Tribbles homologous protein 3 pseudokinase gene TRIB3 can promote the growth of neuronal axons and the regeneration of damaged neuronal axons for the first time; the TRIB3 overexpression vector based on the adeno-associated virus can effectively treat nerve injury of rats, realizes regeneration of damaged axons, recovers sensory functions, and provides a new direction for research and development of drugs for promoting nerve growth and regeneration.

Description

Technical Field

[0001] The present invention relates to gene therapy, and in particular to the use of a Tribbles homologous protein 3 pseudokinase gene TRIB3 in the preparation of a drug for promoting nerve growth and regeneration. Background Art

[0002] Neuronal axons are the core structures for neural signal transmission, enabling precise communication between neurons and between neurons and effector organs through the directional conduction of action potentials. Axonal integrity relies on the dynamic assembly of cytoskeletal tubulin, mitochondrial energy supply, and the coordinated functioning of the axonal transport system, and is crucial for maintaining sensory, motor, and autonomic nervous system functions.

[0003] However, under external trauma such as car accidents, mechanical compression, or iatrogenic injuries, axons can rupture, leading to acute conduction block and triggering Wallerian degeneration - the collapse of distal axons and myelin sheaths, metabolic disorders of neuronal cell bodies, and ultimately causing limb paralysis, sensory loss, or autonomic nervous system disorders. In addition to trauma, axonal homeostasis imbalance is also a common pathological mechanism of many neurological diseases. For example, in Alzheimer's disease patients, abnormal aggregation of tau protein destroys microtubule structure, leading to obstruction of axonal transport; in Parkinson's disease, dopaminergic neuron axon terminals selectively degenerate, causing motor control disorders; glaucoma causes irreversible vision loss due to the progressive loss of retinal ganglion cell axons. These diseases are all characterized by axonal degeneration, suggesting that targeted axon protection and regeneration are key breakthroughs in treatment.

[0004] The core of nerve growth and regeneration lies in the reconstruction of functional neural circuits, which requires three key conditions: regenerated axons crossing the damaged area, reconnecting with target organs, and compensatory strengthening of synaptic function. Therefore, neuroregenerative drugs must simultaneously activate growth momentum and maintain the continuity of axonal extension, while also possessing the ability to guide axonal growth over long distances. Simultaneously, they must coordinate synaptic plasticity with overall neural network homeostasis, significantly increasing the difficulty of drug development. Summary of the Invention

[0005] Purpose of the invention: The purpose of the present invention is to provide a use of Tribbles homologous protein 3 pseudokinase gene TRIB3 in the preparation of drugs for treating diseases caused by nerve damage or preventing neurodegenerative diseases, and promoting nerve growth and regeneration.

[0006] Technical solution: Use of the Tribbles homologous protein 3 pseudokinase gene TRIB3 described in the present invention in the preparation of drugs that promote nerve growth and regeneration.

[0007] Preferably, the application is the application of the TRIB3 expression enhancer in the preparation of drugs for promoting nerve growth and regeneration.

[0008] Preferably, the TRIB3 expression enhancer is an overexpression vector containing a TRIB3 expression cassette.

[0009] Preferably, the TRIB3 expression cassette contains a neuron-specific promoter.

[0010] Preferably, the neuron-specific promoter is Syn1 or hSyn.

[0011] Preferably, the overexpression vector is a viral vector or a non-viral vector.

[0012] Preferably, the application is application in the preparation of medicines for treating diseases caused by nerve damage.

[0013] Preferably, the diseases caused by nerve damage include spinal cord injury, peripheral nerve rupture, stroke, multiple sclerosis, traumatic brain injury, diabetic peripheral neuropathy, and hereditary peripheral neuropathy.

[0014] Preferably, the application is application in the preparation of a drug for preventing neurodegenerative diseases.

[0015] Preferably, the neurodegenerative diseases include Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis.

[0016] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: 1. The present invention proposes and verifies for the first time that the expression of Tribbles homologous protein 3 pseudokinase gene TRIB3 can promote the growth of neuronal axons and the regeneration of damaged neuronal axons; 2. The TRIB3 overexpression vector based on adeno-associated virus can effectively treat nerve damage in rats, achieve regeneration of damaged axons, and restore sensory function, providing a new direction for the research and development of drugs that promote nerve growth and regeneration. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The expression levels of Trib3 gene and protein in dorsal root ganglion (DRG) neurons after transfection of Trib3 AAV overexpression virus or control;

[0018] Figure 2 Figure 2 shows the results of Tuj1 immunofluorescence staining of neuronal axons after transfection of Trib3 AAV overexpression virus or control into DRG neurons. Figure 2 A is a microscopic image, the scale bar is 100 μm, Figure 2 B is the statistics of neuronal axon length;

[0019] Figure 3 Figure 2 shows the results of Tuj1 immunofluorescence staining of neuronal axons grown on culture dishes with or without myelin coating after transfection of Trib3 AAV overexpression virus or control into DRG neurons. Figure 3 A is a microscopic image, scale bar is 100 μm; Figure 3 B is the statistics of neuronal axon length;

[0020] Figure 4 Figure 2 shows the results of Tuj1 immunofluorescence staining of regenerated axons after axon injury using a microfluidic cell culture system after transfection of Trib3 AAV overexpression virus or control into DRG neurons. Figure 4 A is a microscopic image, the scale bar is 100 μm, Figure 4 B is the statistics of the average length of regenerated axons;

[0021] Figure 5 The immunofluorescence staining results of Trib3 and Tuj1 in DRG of SD rats 14 days after intrathecal injection of Trib3 AAV overexpression virus or control (scale bar is 100 μm);

[0022] Figure 6 The results of SCG10 immunofluorescence staining of regenerated axons in SD rats 14 days after intrathecal injection of Trib3 AAV overexpression virus or control and 3 days after sciatic nerve crush. Figure 6 A is a microscopic image, the scale bar is 1000 μm, Figure 6 B is the relative regeneration length statistics;

[0023] Figure 7 The results of muscle action potential detection in SD rats 14 days after intrathecal injection of Trib3 AAV overexpression virus or control and 21 days after sciatic nerve crush. Figure 7 A is the electrophysiological signal diagram of compound muscle action potential measurement, Figure 7 B is the muscle action potential amplitude statistics;

[0024] Figure 8 The results of the sensory function recovery at different stages after sciatic nerve crush in SD rats were measured 14 days after intrathecal injection of Trib3 AAV overexpression virus or control. Figure 8 A is the statistical time of the rats' paw withdrawal reaction when the rats were exposed to heat radiation from the thermal hyperalgesia tester; Figure 8 B is the statistics of the rat paw withdrawal time threshold when Von Frey fibers stimulated the rat medulla skin. DETAILED DESCRIPTION

[0025] The technical solution of the present invention is further described below.

[0026] Example 1: Preparation of Trib3-AAV overexpression virus

[0027] Based on the rat Tribbles homologous protein 3 pseudokinase gene Trib3 mRNA sequence provided by NCBI Reference Sequence: NM_144755.2, Shanghai Heyuan Biotechnology Co., Ltd. was commissioned to design and prepare Trib3-AAV overexpression virus and control virus.

[0028] Example 2: Culture and transfection of rat DRG neurons

[0029] 1. Culture of rat DRG neurons

[0030] Eight-week-old male Sprague Dawley rats were obtained. The dorsal lamina was cut horizontally along the back from the head of the rat with surgical scissors to remove the spinal cord. The DRG tissue was removed from the intervertebral foramen with microtweezers and the axons were cut off. The tissue was placed in a small dish containing dissection fluid and kept on ice throughout the process. The removed DRG tissue was cut into small pieces, digested with collagenase for 1.5 hours and trypsin for 10 minutes, and then the cells were resuspended in 15% BSA. After centrifugation, a pellet containing DRG neurons was obtained. Cell culture was performed using Neurobasal A medium containing B27 and L-glutamine, and DRG neurons were seeded on poly-L-lysine-coated culture dishes for cell culture.

[0031] 2. Viral Transfection of Rat DRG Neurons

[0032] The cultured DRG neurons were seeded into poly-L-lysine-coated 12-well plates. After the cells adhered to the wall, they were transfected with the Trib3-AAV overexpression virus obtained in Example 1 and the control virus at a multiplicity of infection (MOI) of 50,000 vg / cell.

[0033] 2.1. Detection of Trib3 expression level after transfection

[0034] 36 hours after transfection, total RNA was extracted and reverse transcribed, and RT-PCR was performed using the SYBR Green Premix Ex Taq system. The primer sequences for the target gene Trib3 and the internal reference gene GAPDH are shown in Table 1 below, and the reaction conditions are shown in Table 2 below:

[0035] Table 1 Primer sequences for target gene Trib3 and internal reference gene GAPDH

[0036] Primer name Primer sequence 5'→3' Trib3 upstream primer GGCACAGAGTACACCTGCAA Trib3 downstream primers AGGCAGTCTTGCATACGGTG GAPDH upstream primer ACAGCAACAGGGTGGTGGAC GAPDH downstream primers TTTGAGGTGCAGCGAACTT

[0037] Table 2 RT-PCR reaction conditions

[0038]

[0039] Fluorescence values ​​were collected during the extension phase of each cycle. After the amplification reaction, a melting curve analysis was performed to ensure the quality of the PCR product. Using GAPDH as an internal reference, the Ct values ​​of the target gene Trib3 and the internal reference GAPDH were measured, and the relative expression of Trib3 was calculated using the ΔΔCt method.

[0040] 60 hours after transfection, the protein was extracted and quantified, and the concentration was adjusted to 3 mg / mL. 10 μL of protein was loaded onto SDS gel, and the gel was run before transfer to the membrane. After the membrane was blocked, the target protein Trib3 and the internal reference protein β-actin antibodies were incubated, developed, and the protein gray value was quantified.

[0041] The results are as follows Figure 1 As shown, compared with DRG neurons transfected with the control virus (NC-Trib3), both RT-PCR and Western blot results showed that the expression level of Trib3 in neurons was upregulated after transfection with the overexpression virus (OE-Trib3).

[0042] 2.2. Detection of neuronal neurite outgrowth after viral transfection

[0043] Myelin was extracted from whole brain of adult rats.

[0044] (1) Add 20 mL of 0.30 M sucrose solution to a beaker and place it on ice for pre-cooling. Then add the whole brains of three adult rats and record the brain weight.

[0045] (2) Grind the brain tissue using a clean, sterile glass homogenizer. Place the ground tissue in a 100 mL graduated cylinder and dilute to 72 mL with 0.30 M sucrose solution. Add equal amounts of brain tissue homogenate and 0.83 M sucrose solution to an ultracentrifuge tube and centrifuge at 75,000 g at 4°C for 30 min. After centrifugation, the liquid will separate into three phases. Discard the upper 0.30 M sucrose solution and collect the crude myelin layer formed at the interface between the two sucrose solutions.

[0046] (3) Resuspend the crude myelin in 20 mL of Tris-HCl buffer, homogenize, and centrifuge at 75,000 g at 4°C for 15 min. Discard the supernatant. Add Tris-HCl buffer to a volume of 228 mL and centrifuge at 12,000 g at 4°C for 15 min.

[0047] (4) The collected precipitate was suspended in 72 mL of 0.30 M sucrose solution, and steps 2-3 were repeated to obtain purified myelin with a concentration of 4.7 μg / μL, which was then stored at -20°C.

[0048] (5) 1 μL of the myelin obtained above was added to 470 μL of a 100 μg / mL poly-L-lysine solution and mixed evenly. The mixture was added to a 12-well cell culture plate and placed in an incubator for 2 h to obtain a myelin-coated poly-L-lysine-coated cell culture plate for later use.

[0049] 36 hours after transfection, the cells were seeded into 12-well cell culture plates coated with poly-L-lysine without or with myelin. After the cells climbed onto the plates, they were fixed with 4% paraformaldehyde and stained with immunofluorescence. Tuj-1 was labeled with green fluorescence to observe the length of Tuj-1-labeled neuronal processes and to detect the effect of Trib3 overexpression on the growth of rat DRG neuronal processes.

[0050] The results are as follows Figure 2-3 As shown, in the well plate without myelin coating ( Figure 2 ), the mean total axon length increased by 1.87 times after overexpression of Trib3, and the mean length of the longest axon increased significantly; in the well plate coated with myelin ( Figure 3 ), the mean total axon length increased by 2.49 times after overexpression of Trib3, and the mean length of the longest axon increased significantly, with no significant difference compared with the well plate without myelin coating, indicating that in the presence of myelin, an inhibitory factor, overexpression of Trib3 can still promote the axon growth of adult rat DRG neurons.

[0051] 2.3. Detection of axonal regeneration in damaged neurons after viral transfection

[0052] (1) A sterile microfluidic chamber was placed on a culture dish coated with poly-L-lysine. The microfluidic chamber was rinsed with complete culture medium, and the culture medium was discarded. 3 μL of a cell suspension containing 20,000 cells was added to the well on the left side of the microfluidic chamber and allowed to flow into the axon chamber in the middle of the microfluidic chamber. The cells were cultured in a 5% CO2, 37°C incubator for 30 min.

[0053] (2) Add 50 μL of complete culture medium to each well. After culturing for 3 h, discard the complete culture medium and add 200 μL of neuronal culture medium containing b27 to each well.

[0054] (3) After 16 h of culture, AAV virus was transfected on the cell side with a multiplicity of infection of 50,000 vg / cell. After 12 h, the medium was changed and cultured with complete neuronal culture medium.

[0055] (4) Continue culturing for 24 h, observe the axonal growth under a microscope, and when the axon grows out of the right side of the microfluidic chamber, use a desktop vacuum pump to pump the axon side with a negative pressure of 0.025 MPa five times for 30 seconds each time, and observe under a microscope until all axons are severed;

[0056] (5) After culturing for 24 h, the culture dish was removed and 200 μL of 4% PFA was added to each well of the microfluidic chamber to fix the cells at room temperature.

[0057] (6) After fixation, the cells were immunofluorescently stained using green fluorescent marker Tuj-1. The length of Tuj-1-labeled neuronal axons regenerated after injury was observed on the axon side of the microfluidic cell culture system to detect the regeneration of neuronal axons.

[0058] The results are as follows Figure 4 As shown in the figure, the average regenerated axon length increased significantly after overexpression of Trib3, indicating that Trib3 can effectively promote the regeneration of damaged axons in rat DRG neurons.

[0059] Example 3: In vivo experiments in rats

[0060] Fifty 8-week-old male Sprague Dawley rats were housed in an SPF environment. The room temperature was maintained at 24 ± 2°C during the experiment. All rats had free access to food and water.

[0061] All rats were divided into Trib3-AAV overexpression virus or control virus treatment groups, with 25 rats in each group.

[0062] 1. Intrathecal injection of Trib3-AAV overexpression virus

[0063] After the rats were anesthetized, the hair near the spine of the hind limbs was shaved, and the skin corresponding to the L5-L6 DRG was cut open along the midline of the back with sterile surgical scissors. The muscles on both sides of the L5-L6 spine were removed with ophthalmic scissors to expose the vertebral lamina.

[0064] Use bone rongeurs to bite off the spinous process of the L6 segment to expose the space between the two vertebrae. Insert the glass electrode needle horizontally without resistance. Slightly move the glass electrode needle. If the rat's tail or hind legs bounce reflexively, it indicates that the needle is in the correct position.

[0065] The Trib3-AAV overexpression virus or the control virus was diluted with normal saline to a titer of 3×10 12 vg / mL, 10 μL was injected into each rat, and the needle was withdrawn after 2 minutes of treatment.

[0066] The injured area was sutured and disinfected with iodine, and the rat was returned to the cage after it woke up.

[0067] Fourteen days after injection, DRG tissues were obtained from five rats that were intrathecally injected with Trib3-AAV overexpression virus or control virus. The sections were sectioned and then subjected to tissue immunofluorescence staining. Red fluorescence was used to label Trib3 protein and green fluorescence was used to label Tuj-1. The infection of neuronal cells in DRG and the expression of Trib3 were observed after intrathecal injection of Trib3-AAV overexpression virus in rats.

[0068] The results are as follows Figure 5 As shown, DRG tissue-specific Trib3 overexpression can also be achieved in vivo by intrathecal injection of AAV-Trib3.

[0069] 2. Intrathecal injection of Trib3-AAV overexpression virus promotes neuronal regeneration after sciatic nerve crush

[0070] Fourteen days after injection, 15 rats each injected intrathecally with the Trib3-AAV overexpression virus or the control virus were selected. The SD rats' buttocks were obliquely cut to expose the nerves, and the sciatic nerve was clamped 1 cm above the bifurcation of the tibial nerve and the common peroneal nerve using hemostats to establish a rat sciatic nerve crush model.

[0071] 2.1 Immunofluorescence detection of nerve growth-related protein SCG10

[0072] Three days after sciatic nerve injury in rats, sciatic nerve tissues were collected from four rats in each group. The nerve growth-related protein SCG10 was stained by tissue immunofluorescence to observe the length of SCG10-labeled neuronal processes and to detect the effect of Trib3 on the growth of rat DRG neuronal processes.

[0073] The results are as follows Figure 6 As shown in the results, compared with the control group, overexpression of Trib3 upregulated the expression of nerve growth-related protein SCG10 and increased the length of new axons, indicating that overexpression of Trib3 in rats promoted the regeneration of damaged peripheral processes of DRG neurons.

[0074] 2.2 Compound muscle action potential measurement

[0075] 21 days after sciatic nerve injury in SD rats, 3 rats from each group were selected. Stimulating electrodes were placed on both sides of the injury site, and recording electrodes were inserted into the gastrocnemius muscle belly. Compound muscle action potentials were recorded, and nerve conduction velocity was calculated based on the distance between the stimulating electrodes and the stimulation latency.

[0076] The results are as follows Figure 7 As shown in the results, the nerve conduction velocity increased by about 1.5 times after overexpression of Trib3, indicating that overexpression of Trib3 promoted the recovery of myelin sheath surrounding damaged peripheral processes.

[0077] 2.3. Measurement of thermal pain response

[0078] Three rats from each group were examined for thermal allodynia after sciatic nerve injury using the IITC Life Science Model 390 Thermal Allodynia Tester. The skin at the base of the rats' paws was irradiated with thermal radiation. The time it took for the rats to withdraw their paws was recorded, and the withdrawal latency was calculated.

[0079] Three rats were selected from each group. Von Frey fibers were used to stimulate the skin at the base of the rats' groin. The rats' paw withdrawal, paw flicking, and paw licking reactions were observed. The paw withdrawal threshold was calculated using a threshold table to detect the mechanical pain response of the rats after sciatic nerve injury.

[0080] The results are as follows Figure 8 As shown in the data, at the 21st, 28th, and 35th day after intrathecal injection of Trib3 AAV overexpression virus, the paw withdrawal latency and paw withdrawal threshold of rats injected with Trib3 AAV overexpression virus were significantly lower than those of the control group, that is, the time for the paw withdrawal reaction to appear was shorter, indicating that the sensory function of rats injected with Trib3 AAV overexpression virus was better.

Claims

1. Application of a Tribbles homologous protein 3 pseudokinase gene TRIB3 in the preparation of drugs that promote nerve growth and regeneration.

2. The use according to claim 1, characterized in that The application is the use of a TRIB3 expression enhancer in the preparation of drugs that promote nerve growth and regeneration.

3. The use according to claim 2, characterized in that The TRIB3 expression enhancer is an overexpression vector containing a TRIB3 expression cassette.

4. The use according to claim 3, characterized in that The TRIB3 expression cassette contains a neuron-specific promoter.

5. The use according to claim 4, characterized in that The neuron-specific promoter is Syn1 or hSyn.

6. The use according to claim 3, characterized in that The overexpression vector is a viral vector or a non-viral vector.

7. The use according to claim 1, characterized in that The application is in the preparation of medicines for treating diseases caused by nerve damage.

8. The use according to claim 7, characterized in that The diseases caused by nerve damage include spinal cord injury, peripheral nerve rupture, stroke, multiple sclerosis, traumatic brain injury, diabetic peripheral neuropathy, and hereditary peripheral neuropathy.

9. The use according to claim 1, characterized in that The application is application in preparing medicine for preventing neurodegenerative diseases.

10. The use according to claim 9, characterized in that The neurodegenerative diseases include Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis.

Images