Lactobacillus plantarum MB02 with moisturizing and tightening effects and application of lactobacillus plantarum MB02

Abstract

The invention belongs to the technical field of probiotics, and particularly relates to lactobacillus plantarum MB02 with moisturizing and tightening effects and application of the lactobacillus plantarum MB02. According to the invention, a new lactobacillus plantarum MB02 strain is separated from feces of a healthy infant in Guangzhou city, Guangdong province, a zebra fish dehydration model is established through a sodium chloride hypertonic solution, and research finds that the lactobacillus plantarum MB02 strain can realize moisturizing and tightening effects through regulation and control of various genes and material synthesis; comprising the following steps: obviously improving the expression quantity of collagen genes col1a1a and col1a1b, an elastin gene eln1, a hyaluronic acid synthetase gene has3 and an aquaporin gene aqp3; the contents of hyaluronic acid and equol are obviously increased. Therefore, the lactobacillus plantarum MB02 strain has high application value in the field of cosmetics and can be used for developing products for moisturizing, resisting wrinkles and tightening skin.

Description

Technical Field

[0001] The present invention belongs to the technical field of probiotics, and particularly relates to a Lactobacillus plantarum MB02 with moisturizing and firming effects and an application thereof. Background Art

[0002] The term "probiotics" originates from Greek. As our understanding of probiotics deepens, keywords such as regulating intestinal flora, native bacteria, live microorganisms, and viable bacterial count have also been incorporated into the concept. Currently, the widely accepted definition of probiotics is based on the Food and Agriculture Organization of the United Nations / World Health Organization: live microorganisms that, when administered in adequate quantities, exert a beneficial effect on the host. In recent years, probiotic bacteria and their lysates have also been shown to provide beneficial effects on the human body.

[0003] Currently, there are a wide variety of skincare products available on the market, with varying efficacy. However, many of these products are prone to safety issues such as skin allergies due to their ingredients. This is particularly true for pregnant women and children. Pregnant women experience an accelerated metabolism, and coupled with the unique effects of pregnancy, their skin condition can deteriorate dramatically, leading to dryness, roughness, sagging skin, dark spots, stretch marks, and other issues. With increasing awareness of skincare product safety, the safety and efficacy of these products are receiving significant attention. Probiotics, on the other hand, are mostly naturally derived and are resident beneficial bacteria on the surface of human skin, or their metabolites. They exhibit good skin compatibility and are less likely to cause allergic reactions. Furthermore, they undergo rigorous screening and testing to ensure stable and safe performance in skincare products. Consequently, consumers are increasingly favoring green skincare products formulated with probiotics.

[0004] Lactobacillus plantarum is a Gram-positive bacterium in the genus Lactobacillus. It is commonly found in fermented foods such as kimchi, fermented soy products, and yogurt, as well as on the surfaces of fruits and vegetables. The bacterium is rod-shaped and often occurs singly, in pairs, or in short chains. It is highly acid-resistant and can survive in low pH environments. In the food industry, it is a key fermentation agent, fermenting sugars to produce lactic acid, which lowers the pH of food, inhibits harmful microorganisms, and extends shelf life. It also converts vegetable sugars into lactic acid, giving kimchi its distinctive sour flavor and creating an acidic environment that allows it to be stored for a long time and maintain its flavor. Furthermore, it can colonize the intestines, competing with harmful bacteria for nutrients and adhesion sites, maintaining the intestinal barrier and boosting immunity. In skincare, it can regulate the skin microbiome, provide anti-inflammatory and antioxidant benefits, inhibit Propionibacterium acnes, slow aging, and maintain skin health. However, research on Lactobacillus plantarum is still at a relatively early stage, and relatively little research has been conducted on its use in moisturizing and firming skincare products.

[0005] In summary, based on the increasing demand for green skin care products, and the differences in the probiotic properties of probiotics at the strain level, different strains of the same probiotic strains have different effects and mechanisms of action. Screening for probiotic strains with outstanding moisturizing and firming effects and clear mechanisms of action is still a difficulty and hot topic in current research. Summary of the Invention

[0006] To overcome the shortcomings of the above-mentioned prior art, the present invention isolated a new Lactobacillus plantarum (Lactiplantibacillus plantarum) MB02 strain from the feces of a healthy infant in Guangzhou, Guangdong Province. This strain has moisturizing and firming effects, has high application value in the cosmetics field, and can be used to develop moisturizing, anti-wrinkle, and skin-firming products.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] In a first aspect, the present invention provides a Lactobacillus plantarum MB02 strain, which is isolated from the feces of a healthy infant in Guangzhou, Guangdong Province, and has a preservation number of CCTCC NO: M 20242116.

[0009] Preferably, the 16S rDNA of the Lactobacillus plantarum MB02 strain is shown as SEQ ID No: 1.

[0010] The second aspect of the present invention provides the use of the Lactobacillus plantarum MB02 strain in the preparation of skin care products.

[0011] Preferably, the skin care product is used for moisturizing, anti-wrinkle and skin firming.

[0012] Preferably, the Lactobacillus plantarum MB02 strain achieves the skin care effect by increasing the expression levels of collagen genes col1a1a and col1a1b, elastin gene eln1, hyaluronic acid synthase gene has3, and aquaporin gene aqp3, as well as increasing the contents of hyaluronic acid and equol.

[0013] Preferably, the skin care products include lotions, creams, essences, masks, toners, and gels.

[0014] A third aspect of the present invention provides a probiotic agent, wherein the probiotic agent uses the Lactobacillus plantarum MB02 strain as a main active ingredient.

[0015] Preferably, the number of MB02 strains in the bacterial agent is not less than 10 5 CFU / mL.

[0016] Preferably, the bacterial agent further comprises excipients acceptable in the cosmetic field.

[0017] More preferably, the excipients acceptable in the cosmetic field include moisturizers such as glycerin and hyaluronic acid, thickeners such as carbomer, emulsifiers such as Tween series, as well as preservatives, fragrances, and the like.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention isolated a new Lactobacillus plantarum (Lactiplantibacillus plantarum) MB02 strain from the feces of a healthy infant in Guangzhou, Guangdong Province. A zebrafish dehydration model was established using a hypertonic sodium chloride solution. Studies found that the strain can significantly increase the expression levels of the collagen genes col1a1a and col1a1b, the elastin gene eln1, the hyaluronic acid synthase gene has3, and the aquaporin gene aqp3, and significantly increase the content of hyaluronic acid and equol, thereby exerting a moisturizing and firming effect. This suggests that the Lactobacillus plantarum MB02 strain can achieve moisturizing and firming effects through multiple gene regulation and substance synthesis. These include boosting the expression of the col1a1a and col1a1b genes, promoting collagen synthesis, providing firm support for the skin and enhancing firmness; increasing eln1 gene expression, aiding elastin production and making the skin more elastic; upregulating has3 gene expression, leading to the synthesis of hyaluronic acid, which, with its powerful water-locking ability, firmly locks in moisture and keeps the skin hydrated; increasing aqp3 gene expression, optimizing water transport in the skin; and increasing equol content, exerting antioxidant effects and maintaining good skin condition, thereby achieving a comprehensive moisturizing and firming effect. This suggests that this strain has high application value in the cosmetics field and can be used to develop moisturizing, anti-wrinkle, and skin-firming products. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the phylogenetic tree of Lactobacillus plantarum MB02 strain (the strain was derived from the Genome database of NCBI);

[0021] Figure 2 The visual diagram (A) and statistical diagram (B) of the effect of Lactobacillus plantarum MB02 on the tail area of ​​zebrafish (n=6);

[0022] Figure 3 The effect of Lactobacillus plantarum MB02 on the expression of zebrafish collagen genes col1a1a and col1a1b (n=3);

[0023] Figure 4 The effect of Lactobacillus plantarum MB02 on the expression of zebrafish elastin gene eln1 (n=3);

[0024] Figure 5 The effect of Lactobacillus plantarum MB02 on the expression of zebrafish aquaporin gene aqp3 (n=3);

[0025] Figure 6 The effect of Lactobacillus plantarum MB02 on the expression of hyaluronan synthase gene has3 in zebrafish (n=3);

[0026] Figure 7 is the effect of Lactobacillus plantarum MB02 on the hyaluronic acid concentration in zebrafish (n=3);

[0027] Figure 8 Effects of Lactobacillus plantarum MB02 on equol content in zebrafish (n=3). DETAILED DESCRIPTION

[0028] The following is a further description of specific embodiments of the present invention. It should be noted that the description of these embodiments is intended to facilitate understanding of the present invention and does not constitute a limitation of the present invention. In addition, the technical features involved in the various embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

[0029] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0030] In the following examples, E3 aquaculture water is prepared as follows: 11.7 g of sodium chloride, 0.506 g of potassium chloride, 1.465 g of anhydrous magnesium sulfate, and 1.584 g of anhydrous calcium chloride are weighed and mixed, and then an appropriate amount of pure water is added and stirred evenly, and then an appropriate amount of pure water is added to dilute to 4 L to prepare 10 × E3 aquaculture water. Store at room temperature for no more than 7 days (the reagents used for preparation are all analytical reagents, all purchased from McLean, and the conductivity of pure water should be less than or equal to 10 us / cm). When used, measure 400 mL of the 10 × E3 aquaculture water prepared in the previous step into a suitable container, add 3.6 L of pure water, and stir evenly.

[0031] In the following examples, the bacterial solution, the drugs used in the positive group, and the drugs used to establish the model were all diluted to the corresponding concentrations with E3 culture water.

[0032] Example 1: Acquisition of Lactobacillus plantarum MB02

[0033] Lactobacillus plantarum MB02 strain was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province, using the following method:

[0034] Use a 50mL sterile centrifuge tube to collect fresh feces, transport it to the laboratory through the cold chain, and after surface disinfection, transfer the sample to a biosafety cabinet. According to the mass of the feces, add an appropriate amount of sterile water to fully dissolve it (add 800-1000uL sterile water for every 100mg), take an appropriate amount of sample and spread it on the MRS culture plate, and culture it at 37°C in an anaerobic workstation. After 48h, pick a single colony and inoculate it into a new MRS culture plate. Culture it in an anaerobic workstation for 24 hours, and refer to the Bergey Manual of Bacterial Identification (8th Edition) and the Manual of Classification and Identification of Fungi to observe the growth status of the colony. The strain isolated after purification was named MB02. The growth status of this strain is that the colony is round, with a smooth surface, neat edges, and milky white opaque.

[0035] The isolated MB02 strain was expanded and cultured, and molecular identification of the MB02 strain was performed using 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGACTT). 16S sequencing was performed by Jinweizhi Biotechnology Co., Ltd., and the obtained 16S rDNA sequence (SEQ ID No: 1) was compared with the NCBI Genome database by BLAST. The results showed that the MB02 strain had a homology of >99% with the known 16S rDNA sequence of Lactobacillus plantarum, and a phylogenetic tree was constructed with homologous strains for evolutionary analysis ( Figure 1 ), confirming that the MB02 strain is a different strain of Lactobacillus plantarum of the same species.

[0036] Finally, the MB02 strain was deposited, and the deposit information is as follows: deposit time: September 29, 2024; name of the depository: China Center for Type Culture Collection (CCTCC); deposit number: CCTCC NO: M 20242116; depository address: Wuhan University, Wuhan, China; classification name: Lactiplantibacillus plantarum.

[0037] Lactiplantibacillusplantarum MB0216S rDNA sequence (1446bp, SEQ ID No: 1):

[0038]

[0039] Example 2: Study on the probiotic function of Lactobacillus plantarum MB02

[0040] Skin dehydration causes wrinkling, and changes in osmotic pressure are the primary cause of water deficiency. Dehydration can lead to skin roughness, loss of elasticity, and other problems. Zebrafish epidermis has a certain osmotic pressure tolerance range, exceeding which leads to dehydration. Therefore, a hypertonic sodium chloride solution can be used to establish a zebrafish dehydration model and evaluate the moisturizing efficacy of test substances.

[0041] 1. Test materials

[0042] 1.1 Test system

[0043] The zebrafish used in this test were AB strain zebrafish purchased from Nanjing Yishulihua Biotechnology Co., Ltd.

[0044] 1.2 Test product information

[0045] There was a total of 1 test sample in this test, and the detailed information is shown in Table 1.

[0046] Table 1 Test sample information

[0047]

[0048] 2. Experimental methods

[0049] (1) Randomly select 2dpf wild-type AB zebrafish and place them in a 6-well cell culture plate; the experiment was set up as normal group, model group, 10 4 CFU / mL, 10 5 CFU / mL and 10 6 CFU / mL Lactobacillus plantarum MB02 group; 10 fish in each group.

[0050] (2) Model construction and intervention: E3 culture water was added to the normal group, sodium chloride solution (0.85% mass fraction) was added to the model group, and bacterial solution containing sodium chloride at the corresponding concentration was added to the Lactobacillus plantarum MB02 group, and the cells were incubated for 24 h.

[0051] (3) Tail area: After the intervention, the zebrafish were placed under a microscope for observation and photography, and the tail area was analyzed using ImageJ software.

[0052] (4) qPCR detection: After the intervention, the zebrafish were collected into a centrifuge tube and ground, RNA was extracted, and reverse transcribed into cDNA for qPCR detection. The gene primer sequences are shown in Table 2:

[0053] Table 2 Gene sequence primers

[0054]

[0055] (5) Detection of hyaluronic acid and equol content: After the intervention, the zebrafish were collected into a centrifuge tube and added with PBS for homogenization. After homogenization, the supernatant was collected by centrifugation to detect the protein concentration (BCA protein quantitative detection kit, product number CMPB02M, Kamo Biotechnology (Guangzhou) Co., Ltd.) and equol (fish equol ELISA detection kit, product number ZK-F8319, Shenzhen Zike Biotechnology Co., Ltd.), and hyaluronic acid (hyaluronic acid ELISA kit, product number ZK-F9858, Shenzhen Zike Biotechnology Co., Ltd.) content.

[0056] (6) Data statistics: The experimental data were expressed as mean ± SEM and analyzed by t-test. Compared with the normal group: # P<0.05, ## P<0.01, ### P<0.001; using one-way ANOVA, compared with the model group: * P<0.05, ** P<0.01, *** P<0.001.

[0057] 3. Experimental results

[0058] 3.1 Effects of Lactobacillus plantarum MB02 on zebrafish tail area

[0059] Based on the above test method, the effect of Lactobacillus plantarum MB02 on the tail area of ​​zebrafish is as follows Figure 2 As shown in Table 3:

[0060] like Figure 2 As shown in Table 3, compared with the normal group, the relative surface area of ​​the zebrafish tail in the model group was significantly reduced (P<0.001), indicating that the dehydration model was successfully established. 4 CFU / mL, 10 5 CFU / mL and 10 6 The relative area of ​​the zebrafish tail in the CFU / mL Lactobacillus plantarum MB02 group increased significantly (P<0.001).

[0061] Table 3 Statistical table of the effect of Lactobacillus plantarum MB02 on the tail area of ​​zebrafish (n=6)

[0062]

[0063] 3.2 Effects of Lactobacillus plantarum MB02 on the expression of zebrafish collagen genes col1a1a and col1a1b

[0064] Based on the above test method, the effect of Lactobacillus plantarum MB02 on the expression of zebrafish collagen genes col1a1a and col1a1b is as follows Figure 3 As shown in Table 4:

[0065] like Figure 3 As shown in Table 4, compared with the normal group, the relative expression levels of zebrafish collagen genes col1a1a and col1a1b in the model group were significantly decreased (P<0.001). 4 CFU / mL, 10 5 CFU / mL and 10 6 The relative expression levels of zebrafish collagen genes col1a1a and col1a1b in the CFU / mL Lactobacillus plantarum MB02 group were extremely significantly increased (P<0.001).

[0066] Table 4 Statistical table of the effects of Lactobacillus plantarum MB02 on the expression of zebrafish collagen genes col1a1a and col1a1b (n=3)

[0067]

[0068]

[0069] 3.3 Effect of Lactobacillus plantarum MB02 on the expression of the zebrafish elastin gene eln1

[0070] Based on the above test method, the effect of Lactobacillus plantarum MB02 on the expression of zebrafish elastin gene eln1 is as follows Figure 4 As shown in Table 5:

[0071] like Figure 4 As shown in Table 5, compared with the normal group, the relative expression of zebrafish elastin gene eln1 in the model group was decreased and there was a statistical difference (P<0.05). 4 The relative expression level of zebrafish elastin gene eln1 in the CFU / mL Lactobacillus plantarum MB02 group was significantly increased (P<0.01). 5 CFU / mL and 10 6 The relative expression level of zebrafish elastin gene eln1 in the CFU / mL Lactobacillus plantarum MB02 group was extremely significantly increased (P<0.001).

[0072] Table 5 Statistical table of the effect of Lactobacillus plantarum MB02 on the expression of zebrafish elastin gene eln1 (n=3)

[0073]

[0074] 3.4 Effect of Lactobacillus plantarum MB02 on the expression of the zebrafish aquaporin gene aqp3

[0075] Based on the above test method, the effect of Lactobacillus plantarum MB02 on the expression of zebrafish water channel protein gene aqp3 is as follows Figure 5 And as shown in Table 6:

[0076] like Figure 5 As shown in Table 6, compared with the normal group, the relative expression level of zebrafish water channel protein gene aqp3 in the model group was significantly decreased (P<0.001). 4 The relative expression level of zebrafish water channel protein gene aqp3 increased in the Lactobacillus plantarum MB02 group, but there was no statistical difference (P>0.05). 5 The relative expression level of zebrafish water channel protein gene aqp3 in the Lactobacillus plantarum MB02 group was significantly increased (P<0.01). 6 The relative expression level of zebrafish water channel protein gene aqp3 in the CFU / mL Lactobacillus plantarum MB02 group was extremely significantly increased (P<0.001).

[0077] Table 6 Statistical table of the effect of Lactobacillus plantarum MB02 on the expression of zebrafish water channel protein gene aqp3 (n=3)

[0078]

[0079] 3.5 Effect of Lactobacillus plantarum MB02 on the expression of the hyaluronan synthase gene has3 in zebrafish

[0080] Based on the above test method, the effect of Lactobacillus plantarum MB02 on the expression of zebrafish hyaluronan synthase gene has3 is as follows Figure 6 As shown in Table 7:

[0081] like Figure 6 As shown in Table 7, compared with the normal group, the relative expression level of the zebrafish hyaluronan synthase gene has3 in the model group was significantly decreased (P<0.01). 4 CFU / mL, 10 5 CFU / mL and 10 6 The relative expression level of the zebrafish hyaluronan synthase gene has3 in the CFU / mL Lactobacillus plantarum MB02 group was extremely significantly increased (P<0.001).

[0082] Table 7 Statistical table of the effect of Lactobacillus plantarum MB02 on the expression of hyaluronan synthase gene has3 in zebrafish (n=3)

[0083]

[0084] 3.6 Effect of Lactobacillus plantarum MB02 on hyaluronic acid concentration in zebrafish

[0085] Based on the above test method, the effect of Lactobacillus plantarum MB02 on the hyaluronic acid concentration of zebrafish is as follows Figure 7 As shown in Table 8:

[0086] like Figure 7 As shown in Table 8, compared with the normal group, the hyaluronic acid concentration of zebrafish in the model group was significantly reduced (P<0.001). 4 The concentration of hyaluronic acid in zebrafish of the Lactobacillus plantarum MB02 group increased with statistical significance (P<0.05). 5 CFU / mL and 10 6 The hyaluronic acid concentration of zebrafish in the CFU / mL Lactobacillus plantarum MB02 group was extremely significantly increased (P<0.001).

[0087] Table 8 Statistical table of the effect of Lactobacillus plantarum MB02 on the concentration of hyaluronic acid in zebrafish (n=3)

[0088]

[0089] 3.7 Effect of Lactobacillus plantarum MB02 on equol content in zebrafish

[0090] Based on the above test method, the effect of Lactobacillus plantarum MB02 on the equol content in zebrafish is as follows Figure 8 As shown in Table 9:

[0091] like Figure 8 As shown in Table 9, compared with the normal group, the concentration of equol in zebrafish in the model group was significantly reduced (P<0.001). 4 CFU / mL, 10 5 CFU / mL and 10 6 The equol content in zebrafish in the CFU / mL Lactobacillus plantarum MB02 group was extremely significantly increased (P<0.001).

[0092] Table 9 Statistical table of the effect of Lactobacillus plantarum MB02 on the equol content in zebrafish (n=3)

[0093]

[0094] In conclusion, Lactobacillus plantarum MB02 4 CFU / mL, 10 5 CFU / mL and 10 6 CFU / mL concentration can significantly increase the tail area of ​​zebrafish; at 10 4 CFU / mL, 105 CFU / mL and 10 6 CFU / mL concentration can significantly increase the expression of collagen genes col1a1a and col1a1b, elastin gene eln1, and hyaluronic acid synthase gene has3; at 10 4 CFU / mL concentration could not statistically increase the expression of aquaporin gene aqp3. 5 CFU / mL and 10 6 CFU / mL concentration could significantly increase the expression of aquaporin gene aqp3; at 10 4 CFU / mL, 10 5 CFU / mL and 10 6 CFU / mL concentration can significantly increase the levels of hyaluronic acid and equol. These results indicate that Lactobacillus plantarum MB02 has potential moisturizing and firming effects.

[0095] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. It is apparent to those skilled in the art that various changes, modifications, substitutions, and variations of these embodiments may be made without departing from the principles and spirit of the present invention, and the changes still fall within the scope of protection of the present invention.

Claims

1. A Lactobacillus plantarum MB02 strain, characterized in that: The Lactobacillus plantarum MB02 strain was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province, and its preservation number is CCTCC NO: M20242116.

2. A plant lactobacillus (Lactiplantibacillus plantarum) MB02 strain according to claim 1, characterized in that, The 16S rDNA of the Lactobacillus plantarum MB02 strain is shown in SEQ ID No:

1.

3. Use of the plant lactobacillus (Lactiplantibacillus plantarum) MB02 strain according to claim 1 or 2 in preparing skin care products.

4. The use according to claim 3, characterized in that The skin care product is used for moisturizing, anti-wrinkle and skin firming.

5. The use according to claim 3, characterized in that The Lactobacillus plantarum MB02 strain achieves a skin care effect by increasing the expression levels of collagen genes col1a1a and col1a1b, elastin gene eln1, hyaluronic acid synthase gene has3, and aquaporin gene aqp3, as well as increasing the contents of hyaluronic acid and equol.

6. The use according to claim 3, characterized in that The skin care products include lotions, creams, essences, facial masks, toners, and gels.

7. A probiotic agent, characterized in that The bacterial agent uses the Lactobacillus plantarum MB02 strain according to claim 1 or 2 as a main active ingredient.

8. A probiotic agent according to claim 7, characterized in that: In the bacterial agent, the number of MB02 strains is not less than 10 5 CFU / mL.

9. A probiotic agent according to claim 7, characterized in that: The bacterial agent also includes excipients acceptable in the cosmetics field.

Images