Application of receptor-like kinase MdRLK2 in apple comprehensive resistance breeding

By overexpressing the receptor-like kinase MdRLK2 gene in apple plants, the drug resistance problem of chemical prevention and control of apple fungal diseases is solved, and apples are enhanced efficient resistance to fungal diseases is achieved, and apples are promoted molecular breeding and disease prevention and control are promoted.

CN120555484AActive Publication Date: 2025-08-29CHINA AGRI UNIV

Patent Information

Application Number
CN202510613966.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2025-08-29
Estimated Expiration
2045-05-13

AI Technical Summary

Technical Problem

In the prior art, chemical control of apple fungal diseases has drug resistance problems, and is safe and harmful to the environment and fruits, and lacks effective molecular disease-resistant gene resources.

Method used

By overexpressing the receptor-like kinase MdRLK2 gene in apple plants, it was introduced into apple leaves or branches by Agrobacterium mediation to enhance apple resistance to fungal diseases.

Benefits of technology

Significantly improve apples' resistance to fungal diseases, reduce the use of chemical pesticides, and promote molecular breeding and disease prevention and control of apples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120555484A_ABST
    Figure CN120555484A_ABST
Patent Text Reader

Abstract

The invention relates to application of receptor-like kinase MdRLK2 in comprehensive resistance breeding of apples. After the receptor-like kinase MdRLK2 is instantaneously overexpressed in the apple tissue culture seedling Gal-3 and the apple Gala branch, it is found that the improvement of the expression quantity of the receptor-like kinase MdRLK2 effectively enhances the capability of resisting alternaria leaf spot, anthrax leaf blight, brown spot, rot disease and ring spot of apples; therefore, a molecular means for improving the comprehensive disease resistance of the apples is developed by overexpressing the apple receptor-like kinase MdRLK2, and meanwhile, a theoretical basis is provided for molecular breeding of the apples.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular disease resistance, in particular to the application of apple receptor kinase MdRLK2 in apple comprehensive resistance breeding. Background Art

[0002] Apple fungal diseases cause significant economic losses to the apple industry annually. Early leaf drop is the most significant fungal disease affecting apples. These diseases, including Alternaria alternata sp. mali, Diplocarpon coronariae, and Colletotrichum fructicola, infect apple leaves, causing them to drop early in their growth cycle, significantly impacting apple yield. In addition to these leaf diseases, two other branch diseases, ring rot (Botryosphaeria dothidea) and rot (Valsa mali), are also extremely serious. Currently, the primary method for controlling apple fungal diseases is chemical control. This reliance on chemical pesticides has certain drawbacks, including the potential for pathogenic bacteria to develop resistance to pesticides over a long period of time, negatively impacting the environment and the safety of the fruit. Furthermore, chemical residues can also affect human health. Therefore, screening and identifying proteins in apple plants that play a key role in fungal disease resistance is crucial for breeding disease-resistant apple varieties. Summary of the Invention

[0003] In view of the defects in the prior art, the purpose of the present invention is to provide a receptor-like kinase MdRLK2 that is beneficial to the molecular basis and gene reserve of comprehensive resistance breeding of apple.

[0004] In order to achieve the above purpose, the technical solution adopted by the present invention is:

[0005] A use of a receptor-like kinase gene MdRLK2 in resisting fungal infections, characterized in that the use improves the anti-fungal infection performance of apples by overexpressing the receptor-like kinase MdRLK2 in apple plants;

[0006] The nucleotide sequence of the receptor-like kinase gene MdRLK2 is shown in SEQ ID NO.1.

[0007] The fungal infections include leaf spot disease, brown spot disease, anthracnose leaf blight disease, ring rot disease, rot disease and the like.

[0008] The primers for detecting the expression of the receptor-like kinase gene MdRLK2 are characterized in that the sequences of the primers are shown in SEQ ID NO.2-3.

[0009] A method for enhancing the resistance of apple plants to fungal diseases using the MdRLK2 gene, characterized in that:

[0010] The method introduces the apple receptor kinase gene MdRLK2 into apple leaves or branches through Agrobacterium-mediated method, so that the gene is overexpressed in apples; the overexpression of the MdRLK2 gene can significantly improve the resistance of apples to fungal pathogens.

[0011] The method comprises the following steps:

[0012] Step 1: insert the receptor-like kinase gene MdRLK2 into the two restriction sites of BamHI and NcoI on the pFGC5941 vector, and transform it into Escherichia coli DH5α to obtain an MdRLK2 overexpression gene vector;

[0013] Step 2, extracting the plasmid from the overexpression MdRLK2 gene vector obtained in step 1;

[0014] Step 3: The plasmid obtained in step 2 is transferred into Agrobacterium to prepare a transgenic Agrobacterium bacterial solution;

[0015] Step 4: Transfer the transgenic Agrobacterium solution obtained in step 3 into apple leaves and branches.

[0016] The fungal infections include leaf spot disease, brown spot disease, anthracnose leaf blight disease, ring rot disease, rot disease and the like.

[0017] The specific operation process of the above method is as follows:

[0018] S1: Total RNA of infected apples was extracted by CTAB method;

[0019] S2: reverse transcribe the total RNA extracted in S1 into cDNA;

[0020] S3: using the reverse transcription template obtained in S2 and RT-PCR primers to clone the gene of claim 1;

[0021] S4: Insert the gene obtained in S3 into the BamHI and NcoI restriction sites of the pFGC5941 vector and transform it into Escherichia coli DH5α;

[0022] S5: Extract the plasmid of the overexpression target gene vector constructed in S4;

[0023] S6: The plasmid extracted in S5 was transformed into Agrobacterium, spread on solid YEP medium supplemented with antibiotics, and incubated inverted at 28°C for 24-48 hours; the antibiotics included 50 mg / L Kana and 20 mg / L Rif;

[0024] S7: Pick a single spot of Agrobacterium cultured in S6, add 2 ml of YEP liquid medium containing 50 mg / L Kana and 20 mg / L Rif, and culture overnight at 28°C and 180 rpm;

[0025] S8: Take 80 μL of the Agrobacterium cultured in S7 and add 4 mL of YEP liquid medium containing 50 mg / L Kana, 20 mg / L Rif, and 10 μM acetosyringone. Incubate at 28°C and 180 rpm for 12-16 h.

[0026] S9: Centrifuge the Agrobacterium culture obtained in S8 at 10,000 rpm for 1 minute at room temperature, and remove the culture medium; vortex and resuspend the culture in 1-2 ml of suspension solution; add 10 μL of the resuspended culture to 990 μL of suspension solution to obtain a bacterial suspension, measure the OD600 using a spectrophotometer, adjust the bacterial suspension to OD600 = 1.0, and let it stand at room temperature for 2-5 hours; the suspension contains 10 mM MES-KOH adjusted to pH 5.2, 10 mM MgCl2, and 100 μM acetosyringone;

[0027] S10: Before use, vortex or pipette the bacterial solution obtained in S9 to suspend the bacteria. Then, use a 1 mL syringe without a needle to draw up the bacterial solution, avoiding the leaf veins. Use the 1 mL syringe needle to make small holes in the apple leaves, and inject the bacterial solution into the leaves, injecting 1-2 holes per leaf.

[0028] S11: Before use, vortex or pipette the bacterial suspension obtained in S9 to suspend the bacteria, mix them in a 1:1 ratio, and transfer the bacterial suspension into the branches by vacuum.

[0029] S12: Observe leaves and branches 4 days after Agrobacterium injection.

[0030] Application of the MdRLK2 gene in preparing transgenic apple plants with resistance to fungal diseases.

[0031] The application of the receptor-like kinase MdRLK2 in apple comprehensive resistance breeding has the following beneficial effects:

[0032] By transiently overexpressing the receptor-like kinase MdRLK2 in apple tissue culture seedlings 'Gala-3' and 'Gala' apple branches using the pFGC5941 vector, it was found that overexpression of the receptor-like kinase MdRLK2 can enhance the disease resistance of apple, which is beneficial for the prevention and control of different apple diseases and molecular breeding of apple. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The present invention has the following accompanying drawings:

[0034] Figure 1This figure shows the results of an experiment to enhance the disease resistance of the susceptible variety 'Gala-3' to apple leaf spot disease, apple brown spot disease, and apple anthracnose leaf blight disease by overexpressing the receptor-like kinase MdRLK2.

[0035] Figure 2 This figure shows the experimental results of overexpressing the receptor-like kinase MdRLK2 to enhance the disease resistance of the susceptible apple variety 'Gala' to ring rot and apple rot. DETAILED DESCRIPTION

[0036] The present invention will be further described in detail below with reference to the accompanying drawings.

[0037] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the reagents and materials mentioned in the present invention were all in accordance with the conditions recommended by the manufacturer's instructions.

[0038] 1. Plant total RNA extraction:

[0039] (1) All tissue samples of apple 'Gala-3' were quickly ground in liquid nitrogen;

[0040] (2) Add 990 μL of preheated CTAB solution and 10 μL of β-mercaptoethanol to the plant tissue, vortex for 30 seconds, and then place in a 65°C water bath for 10 minutes;

[0041] (3) Add 1000 μL of CI (chloroform / isoamyl alcohol volume ratio = 24:1) and mix by inverting;

[0042] (4) 4°C, 12,000 rpm, 10 min;

[0043] (5) Pipette 800 μL of supernatant, add an equal volume of CI, and mix by inverting;

[0044] (6) 4°C, 12,000 rpm, 10 min;

[0045] (7) Aspirate about 650 μL of supernatant and add 1000 μL of isopropanol;

[0046] (8) Precipitation at -20°C for 30 min;

[0047] (9) 4°C 12000 rpm 10 min;

[0048] (10) Pour off the supernatant and add 1 ml of 75% ethanol to wash the precipitate;

[0049] (11) 4°C, 12000 rpm, 10 min;

[0050] (12) Pour off the supernatant and incubate at 4°C, 12,000 rpm, for 2 min.

[0051] (13) Aspirate the supernatant and add 40 μL RNase-free H2O to dissolve the precipitate;

[0052] (14) The integrity was checked by 1% agarose gel electrophoresis, and the RNA concentration was calculated by measuring the absorbance at 260 nm using a UV spectrophotometer.

[0053] 2. Cloning of MdRLK2:

[0054] (1) CTAB extraction of Gala-3 total RNA;

[0055] (2) Reverse transcription into cDNA;

[0056] (3) Design of RT-PCR primers: F: AGCATCAAAGTTTAGAGGCATTGTT; R: TTCTTTTCTCTATGCACGTTTAACG.

[0057] (4) After PCR, the fragments were detected by 1% agarose gel electrophoresis using 0.1% TAE electrophoresis buffer at 70-110V for about 15 minutes, stained with ethidium bromide, and the size of the PCR product fragments was detected under ultraviolet light.

[0058] 3. Construction of MdRLK2 overexpression vector

[0059] MdRLK2 was inserted into the two restriction sites of BamHI and NcoI on the pFGC5941 vector, transformed into Escherichia coli DH5α, and plaque-picked sequencing was performed. After the sequencing sequence was correct, the plasmid was extracted and transiently expressed.

[0060] The specific operations are as follows:

[0061] Enzyme digestion reaction system:

[0062]

[0063] The reaction system was placed in a 37°C water bath for 24 hours, and then the recovered products were detected by agarose gel electrophoresis. Fragments of the correct size were selected and recovered using a recovery kit from Novezan.

[0064] T4 ligase ligation system:

[0065]

[0066] The above reaction system was placed in a 16°C metal bath. After 24 hours, 20 μL of the above ligation system was transferred into Escherichia coli DH5α.

[0067] 4. Recovery of target fragments from agarose gel

[0068] Use a recovery kit and refer to the kit instructions for the method.

[0069] (1) Cut the agarose gel containing the target sequence fragment, remove as much excess gel as possible, add 3 gel volumes of Buffer B2, and mix intermittently until the gel block is completely melted.

[0070] (2) Add 200 μL of isopropanol and mix well.

[0071] (3) Transfer the mixture to a column separation and purification column, centrifuge at 12,000 × g for 60 s, and discard the waste liquid in the collection tube.

[0072] (4) Add 300 μl of Buffer B2 to the purification column, centrifuge at 12,000 × g for 30 s, and discard the waste liquid in the collection tube.

[0073] (5) Add 500 μl Wash Buffer to the purification column, centrifuge at 12,000 × g for 30 seconds, and discard the waste liquid in the collection tube.

[0074] (6) Repeat once.

[0075] (7) After leaving the container empty for 2 minutes, place it in a fume hood and blow for 5 minutes.

[0076] (8) Take a new 1.5 ml centrifuge tube, place the purification column in the new 1.5 ml centrifuge tube, add 30 μL of TEBuffer preheated at 55°C, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 × g for 60 seconds.

[0077] (9) Discard the adsorption column and store the recovered product in a -20°C refrigerator.

[0078] 5. E. coli DH5α transformation process:

[0079] Add 10 μL of the ligated vector to 30 μL of E. coli DH5α. Incubate on ice for 30 minutes, heat shock at 42°C for 30 seconds, and then incubate on ice for 2 minutes. Add 200 μL of liquid LB medium and shake at 200 rpm at 37°C for 40-60 minutes. Centrifuge at 10,000 rpm for 1 minute at room temperature. Aspirate 200 μL of the supernatant and use the remaining liquid to resuspend the cells. Spread the suspension onto solid LB+Amp medium and incubate overnight at 37°C in an oven.

[0080] 6. Spot picking:

[0081] A single colony after overnight culture was picked and placed in 200 μL LB+Amp liquid medium, and placed in a shaking incubator at 37°C and 200 rpm for 3 h.

[0082] Bacterial liquid PCR:

[0083]

[0084] The above system was subjected to 35 cycles of 95°C, 3 min; 95°C, 1 min; 60°C, 30 s; 72°C, 30 s; 72°C, 10 min; and 16°C, 1 min.

[0085] Detection was performed by electrophoresis on a 1% agarose gel using 0.1% TAE electrophoresis buffer at 70-110V for approximately 15 minutes. The fragments were stained with ethidium bromide and the size of the PCR products was determined under UV light. Bacterial cultures with the correct band size were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing comparison using DNAMAN.

[0086] 7. Plasmid extraction (Vazyme, FastPure Plasmid Mini Kit, DC201)

[0087] (1) Take 1-5 ml of overnight culture (12-16 hours) and add it to a 2 ml centrifuge tube. Centrifuge at 10,000 rpm for 1 minute. Discard the culture medium and aspirate the remaining liquid.

[0088] (2) Add 250 μl of Buffer P1 (with RNase A added) to the centrifuge tube and vortex to mix.

[0089] (3) Add 250 μl of Buffer P2 to the tube prepared in step 2 and mix gently by inverting 8-10 times.

[0090] (4) Add 350 μl of Buffer P3 to the sample prepared in step 3, gently invert the tube 8-10 times, and centrifuge at 12,000 rpm for 10 min.

[0091] (5) Place the FastPure DNA MiniColumns adsorption column in a 2 ml Collection Tube. Carefully transfer the supernatant from step 4 to the adsorption column using a pipette and centrifuge at 12,000 rpm for 30 seconds. Discard the waste liquid from the collection tube and replace the adsorption column in the collection tube.

[0092] (6) Add 600 μl of Buffer PW2 (diluted with anhydrous ethanol) to the adsorption column. Centrifuge at 12,000 rpm for 30 seconds. Discard the waste liquid and return the adsorption column to the collection tube.

[0093] (7) Repeat step 6;

[0094] (8) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 1 min to dry the adsorption column;

[0095] (9) Place the adsorption column in a new sterilized 1.5 ml centrifuge tube. Add 30-100 μl of Elution Buffer to the center of the column membrane. Let stand at room temperature for 2 minutes, then centrifuge at 12,000 rpm for 1 minute to elute the DNA.

[0096] (10) Discard the adsorption column and store the DNA product at -20°C

[0097] 8. Agrobacterium transformation:

[0098] (1) Take one tube of prepared competent cells, completely dissolve them on ice, and gently suspend the cells.

[0099] (2) Add 5-10 μL of the plasmid of the transgenic fungus overexpressing MdRLK2, mix gently, and place on ice for 30 minutes.

[0100] (3) Cold shock in liquid nitrogen for 1 min.

[0101] (4) Heat shock at 37°C for 5 min and place on ice for 2 min.

[0102] (5) Add 500 μL YEP liquid culture medium and culture at 28°C, 140 rpm, and shake for 4-6 h.

[0103] (6) Centrifuge at 4000 rpm for 3 min at room temperature, remove approximately 400 μL of supernatant, and suspend the cells with the remaining culture medium.

[0104] (7) The bacteria were spread on solid YEP medium supplemented with antibiotics (50 mg / L Kana, 20 mg / L Rif).

[0105] (8) Incubate the plate upside down at 28°C for 24-48 hours.

[0106] 9. Overexpression of MdRLK2 in leaves of 'Gala-3' tissue culture seedlings

[0107] The constructed MdRLK2 plasmid was transformed into Agrobacterium for transient expression and cultured for 4 days. The results are shown in Figure 1 Middle A: Agrobacterium-mediated transient expression of the susceptible variety 'Gala-3' tissue culture seedlings for 4 days. The expression level of MdRLK2 was detected by fluorescence quantitative PCR, and it was found that the expression level of MdRLK2 increased significantly. Figure 1 Middle B and Figure 1Figure C shows the phenotype and lesion area of ​​susceptible 'Gala-3' seedlings grown four days after Agrobacterium-mediated transient expression, followed by inoculation 48 hours later. WT represents 'Gala-3' seedlings without transient expression; EV represents 'Gala-3' seedlings transiently expressed with no pFGC5941 vector; and OE-MdRLK2 represents 'Gala-3' seedlings transiently expressed with the pFGC5941 vector overexpressing MdRLK2. As shown in these figures, transient overexpression of the MdRLK2 gene and inoculation with the fungus significantly reduced lesion area on 'Gala' leaves.

[0108] 10. Overexpression of MdRLK2 in 'Gala' shoots

[0109] The constructed MdRLK2 plasmid was transformed into Agrobacterium for transient expression and cultured for 4 days. The results are shown in Figure 2 Middle A: Agrobacterium-mediated transient expression in susceptible cultivar 'Gala' branches. Quantitative fluorescence PCR was used to detect the expression of MdRLK2 4 days later, and it was found that the expression level of MdRLK2 increased significantly. Figure 2 Figures B and C show the phenotype and lesion area of ​​susceptible 'Gala' branches subjected to Agrobacterium-mediated transient expression for 4 days and 48 hours after inoculation. WT represents 'Gala' branches without transient expression; EV represents 'Gala' branches subjected to transient expression with an empty pFGC5941 vector; and OE-MdRLK2 represents 'Gala' branches subjected to transient expression with a pFGC5941 vector overexpressing MdRLK2. The results showed that transient overexpression of MdRLK2 significantly reduced lesion area in 'Gala' branches following fungal inoculation.

[0110] The primers used in the fluorescent quantitative PCR described in items 9 and 10 above are as follows:

[0111] MdRLK2 fluorescence quantitative primers: F: TCCGAGGGCGATCTATTCCT (SEQ ID NO. 2), R: ACAGTTACCACCTGCTCTGC (SEQ ID NO. 3).

[0112] Internal reference U6 fluorescent quantitative primer: F: 5'-TTGGGGACATCCGATAAAATTG-3', R: 5'-AAAAATTTGGACCATTTCTCG-3'.

[0113] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

[0114] The contents not described in detail in this specification belong to the prior art known to those skilled in the art.

Claims

1. A use of a receptor-like kinase gene MdRLK2 in antifungal infection, characterized in that: The application improves the anti-fungal infection performance of apple by overexpressing the receptor-like kinase MdRLK2 in apple plants; The nucleotide sequence of the receptor-like kinase gene MdRLK2 is shown in SEQ ID NO.

1.

2. Primers for detecting the expression of the receptor-like kinase gene MdRLK2, characterized in that: The sequences of the primers are shown in SEQ ID NO. 2-3.

3. A method for enhancing the resistance of apple plants to fungal diseases using the MdRLK2 gene, characterized in that: The method introduces the apple receptor kinase gene MdRLK2 into apple leaves or branches through Agrobacterium-mediated method, so that the gene is overexpressed in apples; the overexpression of the MdRLK2 gene can significantly improve the resistance of apples to fungal pathogens.

4. Application of the MdRLK2 gene in the preparation of transgenic apple plants with resistance to fungal diseases.

Citation Information

Patent Citations

  • Application of receptor-like kinase gene MdMRLK2 in improving water utilization efficiency of plants

    CN113249394A

  • Apple susceptible gene and application thereof in disease resistance regulation

    CN114395565A

  • Apple receptor-like kinase as well as expression gene and application thereof

    CN117230092A

  • Trans-boundary delivery milRNA of apple early-stage defoliation pathogen and prevention and treatment method thereof

    CN117603968A

  • Xinjiang malus sieboldii gene MsWRKY65 and application thereof in apple rot resistance

    CN118308370A

Cited By

  • Application of receptor-like kinase gene MdCIK2 in regulation and control of apple disease resistance

    CN120829923A

  • Application of MdCIK2 gene in regulating disease resistance of apple

    CN120829923B