Construction of EBV infected epidermal cell and B cell model

Abstract

The invention provides an EBV susceptible 293T cell capable of simultaneously expressing an epidermal cell receptor EphA2 and a cleavage replication key protein RTA, and an EBV susceptible BJAB cell capable of simultaneously expressing a B cell receptor CD21 and a cleavage replication key protein ZTA, so that the infectivity of the cells on EBV is remarkably improved. The EBV infection titer of the cell line disclosed by the invention is more than three times that of normal control under the same condition. The EBV susceptible cells are of great significance to research of EBV infection mechanisms, screening of antiviral drugs and research and development of vaccines.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering, and particularly relates to the construction of EBV-infected epidermal cell and B cell models. Background Art

[0002] Epstein-Barr virus (EBV) is a human herpesvirus that is widely transmitted in the human population, with a global infection rate exceeding 90%. EBV infection is closely associated with a variety of serious human diseases, including infectious mononucleosis, nasopharyngeal carcinoma, gastric cancer, Burkitt lymphoma, and other types of lymphoproliferative disorders.

[0003] During primary infection, EBV primarily infects epidermal cells for lytic replication, then infects B cells and establishes a latent infection there, causing the infected person to carry the virus for life. However, EBV research and antiviral drug development face a major challenge: EBV has difficulty efficiently infecting conventional laboratory cell lines. This limitation has severely hindered in-depth research on its infection mechanisms, high-throughput screening of effective antiviral drugs, and vaccine evaluation.

[0004] Currently, Raji cells are the most commonly used B cell infection model for analyzing EBV neutralizing antibodies in laboratories. However, because these cells naturally carry EBV, exogenous viral infection can interfere with endogenous viral products, affecting the accuracy of experimental results. Furthermore, infection efficiency is low. Furthermore, there is a lack of epidermal cell and B cell models that efficiently infect EBV, possibly due to the specific characteristics of the receptor and EBV replication.

[0005] Therefore, in order to overcome the research bottleneck related to EBV infection, there is an urgent need to provide cells sensitive to EBV infection to facilitate the screening of effective antiviral drugs and the evaluation of vaccine effects. Summary of the Invention

[0006] The present invention provides an EBV-sensitive epidermal-like cell line 293T that simultaneously overexpresses the receptor EphA2 for EBV-infected epidermal cells and the switch protein RTA for viral gene lysis, replication, and transcriptional activation, as well as an EBV-sensitive B cell line BJAB that simultaneously overexpresses the B cell receptor CD21 and the switch protein ZTA for viral gene lysis, replication, and transcriptional activation, and provides uses of the epidermal-like cell line and the B cell line.

[0007] In a first aspect of the present invention, an EBV-susceptible cell line is provided, wherein the cell line overexpresses an EBV receptor and a transcription switch protein.

[0008] In another preferred embodiment, the cell line comprises: an epidermal-like cell line and / or a B cell line.

[0009] In another preferred embodiment, the EBV receptor comprises: CD21 receptor, EphA2 receptor, or a combination thereof.

[0010] In another preferred embodiment, the transcription switch protein is a viral gene lytic replication transcription activator.

[0011] In another preferred embodiment, the transcription switch protein comprises: RTA encoded by the BRLF1 gene, ZTA encoded by the BZLF1 gene, or a combination thereof.

[0012] In another preferred embodiment, the cell line is an epidermal-like cell line, the EBV receptor is adrenergic receptor A2, and the transcription switch protein is replication transcription activator RTA.

[0013] In another preferred embodiment, the epidermal-like cell line is a 293T cell line.

[0014] In another preferred embodiment, the cell line is a B cell line, the EBV receptor is a CD21 receptor, and the transcription switch protein is a replication transcription activator ZTA.

[0015] In another preferred embodiment, the B cell line is BJAB cells.

[0016] In another preferred embodiment, the EBV infection titer Y1 of the cell line is significantly higher than the EBV infection titer Y0 of the normal control.

[0017] In another preferred embodiment, the normal control refers to a wild-type cell line that does not overexpress EBV receptors and does not overexpress transcription switch proteins under the same culture conditions.

[0018] In another preferred embodiment, the ratio of the EBV infection titer Y1 of the cell line to the EBV infection titer Y0 of the normal control is Y1 / Y0≥3, preferably ≥5, and most preferably ≥8.

[0019] In another preferred embodiment, the EBV infection rate X1 of the cell line is significantly higher than the EBV infection rate X0 of the normal control.

[0020] In another preferred embodiment, the ratio of the EBV infection rate X1 of the cell line to the EBV infection rate X0 of the normal control is X1 / X0≥2, preferably ≥3.

[0021] In a second aspect of the present invention, there is provided a use of the cell line according to the first aspect of the present invention for one or more of the following uses:

[0022] (Z1) used to study the mechanism of EBV infection of host cells;

[0023] (Z2) for screening EBV neutralizing antibodies;

[0024] (Z3) for screening anti-EBV drugs;

[0025] (Z4) for screening EBV vaccines;

[0026] (Z5) is used to prepare a live cell preparation, which is used to detect EBV neutralizing antibodies in a sample.

[0027] In another preferred embodiment, the use is for non-diagnostic and non-therapeutic purposes.

[0028] In a third aspect of the present invention, a living cell preparation is provided, wherein the living cell preparation comprises the cell line according to the first aspect of the present invention.

[0029] In another preferred embodiment, the living cell preparation is further provided with an instruction manual, wherein the instruction manual is used to guide the use of the living cell preparation for detecting EBV neutralizing antibodies in a sample.

[0030] In a fourth aspect of the present invention, a method for preparing the cell line according to the first aspect of the present invention is provided, comprising the following steps:

[0031] (A1) providing pLVX-puro-RTA plasmid and pLVX-hygro-EphA2 plasmid;

[0032] (A2) Transfecting the pLVX-puro-RTA plasmid and the pLVX-hygro-EphA2 plasmid into the epidermal-like cell line, thereby obtaining the cell line according to the first aspect of the present invention.

[0033] In another preferred embodiment, in step (A2), the pLVX-puro-RTA plasmid is first transfected into the epidermal-like cell line, and then the pLVX-hygro-EphA2 plasmid is transfected into the epidermal-like cell line, thereby obtaining the cell line described in the first aspect of the present invention.

[0034] In another preferred embodiment, in step (A2), the pLVX-hygro-EphA2 plasmid is first transfected into the epidermal-like cell line, and then the pLVX-puro-RTA plasmid is transfected into the epidermal-like cell line, thereby obtaining the cell line described in the first aspect of the present invention.

[0035] In a fifth aspect of the present invention, a method for preparing the cell line according to the first aspect of the present invention is provided, comprising the following steps:

[0036] (B1) providing pLVX-hygro-CD21 plasmid and pLVX-puro-ZTA plasmid;

[0037] (B2) electroporating the pLVX-hygro-CD21 plasmid into a B cell line to obtain BJAB-CD21 cells;

[0038] (B3) packaging the pLVX-puro-ZTA into a lentivirus and introducing it into the BJAB-CD21 cells, thereby obtaining the cell line described in the first aspect of the present invention.

[0039] In another preferred embodiment, the method comprises the following steps:

[0040] (B1′) provides pLVX-hygro-CD21 plasmid and pLVX-puro-ZTA plasmid;

[0041] (B2') packaging the pLVX-puro-ZTA plasmid into lentivirus and introducing it into the B cell line;

[0042] (B3') electroporating the pLVX-hygro-CD21 plasmid into the B cell line obtained in step (C2), thereby obtaining the cell line according to the first aspect of the present invention.

[0043] In a sixth aspect of the present invention, a method for evaluating the EBV neutralizing activity of a sample is provided, comprising the following steps:

[0044] (S1) providing the cell line according to the first aspect of the present invention;

[0045] (S2) incubating the sample with the cell line described in step (S1) to provide the EBV neutralizing activity of the sample.

[0046] In another preferred embodiment, the neutralization activity includes: EBV neutralization titer and / or neutralization percentage.

[0047] In another preferred embodiment, the co-incubation refers to incubation at 37°C.

[0048] In another preferred embodiment, the incubation time is 1-3 hours, preferably 2 hours.

[0049] In another preferred embodiment, the sample is a serum sample from a mammal.

[0050] In another preferred embodiment, the mammal is a mammal vaccinated with an EBV vaccine.

[0051] In another preferred embodiment, the mammal is a non-human mammal or a human.

[0052] In a seventh aspect of the present invention, a platform for screening anti-EBV drugs and / or developing EBV vaccines is provided, wherein the platform comprises an EBV-susceptible cell line, wherein the EBV-susceptible cell line comprises:

[0053] (i) an epidermal-like cell line in which adrenergic receptor A2 and replication transcription activator RTA are overexpressed; and / or

[0054] (ii) B cell lines in which the CD21 receptor and the replication transcription activator ZTA are overexpressed.

[0055] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 Schematic diagrams of EphA2 and CD21 expression plasmids pLVX-hygro-EphA2 and pLVX-hygro-CD21 are shown.

[0057] Figure 2 Schematic diagram of EphA2 and CD21 expression plasmids pLVX-puro-RTA-Flag and pLVX-puro-ZTA-flag are shown.

[0058] Figure 3 The results showed that the 293T-RTA-EphA2 monoclonal cell line and the BJAB-ZTA-CD21 monoclonal cell line were successfully constructed.

[0059] in, Figure 3 A shows the results of Western Blot detection of RTA and EphA2 after pLVX-puro-RTA and pLVX-hygro-EphA2 plasmids were transformed into epidermal-like 293T cells and stable monoclonal cell lines were screened; Figure 3 B shows the expression of ZTA and CD21 in the monoclonal BJAB-ZTA-CD21 cells screened by Western Blot assay.

[0060] Figure 4 It was shown that the cell line 293T-RTA-EphA2 is susceptible to EBV.

[0061] in, Figure 4 A shows the fluorescence imaging results after 293T-RTA-EphA2 cell line and wild-type 293T-WT cell line were co-incubated with EBV-GFP. Figure 4 B shows the corresponding fluorescence quantification results.

[0062] Figure 5 The cell line BJAB-ZTA-CD21 is shown to be susceptible to EBV.

[0063] in, Figure 5 A shows the fluorescence imaging results of BJAB-ZTA-CD21 cell line and wild-type BJAB-WT cell line after co-incubation with EBV-GFP; Figure 5 B shows the FACS analysis results 72 h after infection; Figure 5 C shows the results of repeated experiments on the BJAB-ZTA-CD21 cell line and the wild-type BJAB-WT cell line infected with low doses of EBV-GFP; Figure 5 D shows Figure 5 Quantitative results of C; Figure 5 E shows the results of FACS analysis of the BJAB-ZTA-CD21 cell line and the Raji cell line commonly used in EBV neutralization experiments.

[0064] Figure 6 It was shown that 293T-RTA-EphA2 cells and BJAB-ZTA-CD21 cells exhibited clear neutralization curves in the EBV neutralization assay, which can be used to evaluate the neutralizing potency of antibodies or sera.

[0065] in, Figure 6 A and Figure 6 B shows the neutralization curves of cell lines BJAB-ZTA-CD21 and epithelial cells 293T-RTA-EphA2, respectively. DETAILED DESCRIPTION

[0066] After extensive and in-depth research, the inventors unexpectedly discovered for the first time that by genetically modifying the cell surface to overexpress specific EBV receptors and simultaneously overexpressing specific transcriptional switch proteins that can promote EBV replication (for example, overexpressing the cell receptor EphA2 and the key protein for lytic replication RTA in epidermal cells, and for another example, overexpressing the B cell receptor CD21 and the key protein for lytic replication ZTA in B cells), the EBV infection rate can be increased by more than two times, thereby improving viral replication, thereby obtaining cells that are more susceptible to and easily detectable by EBV. The EBV-susceptible cells are of great significance for studying the mechanism of EBV infection, antiviral drug screening, and vaccine development. The present invention was completed on this basis.

[0067] Specifically, the construction of 293T cells that simultaneously express the epidermal cell receptor EphA2 and the key protein for lytic replication, RTA, and BJAB cells that dually express the B cell receptor CD21 and the key protein for lytic replication, significantly improved the infectivity of these cells to EBV. These modified cell models not only contribute to a deeper understanding of the mechanism of EBV infection but also provide an efficient platform for antiviral drug screening and vaccine development, thereby significantly improving the efficiency and success rate of development.

[0068] the term

[0069] In order to more easily understand the present disclosure, some terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms should have the meaning given below. Other definitions are set forth throughout the application.

[0070] As used herein, the term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items.

[0071] As used herein, the terms "comprises," "includes," and "comprising" are used interchangeably to encompass not only closed definitions but also semi-closed and open definitions. In other words, the terms encompass "consisting of," "consisting essentially of."

[0072] Where a numerical range is provided, it is understood that every intervening integer of that value, every tenth of each intervening integer of that value, between the upper and lower limits of that range, and any other intervening values ​​in the stated range are encompassed within the invention, unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any expressly excluded limits in the stated range. For example, "1 to 50" includes "2 to 25," "5 to 20," "25 to 50," "1 to 10," and the like.

[0073] As used herein, the term "vaccine" includes prophylactic vaccines and therapeutic vaccines.

[0074] As used herein, the term "overexpression" refers to a significant increase in expression level. For example, overexpression of an EBV receptor in a cell line means that the ratio of the EBV receptor level N1 in the cell line to the EBV receptor level N0 in a wild-type cell line is N1 / N0 ≥ 1.1, preferably ≥ 1.3, more preferably ≥ 1.5, and most preferably ≥ 2.0. In specific embodiments, the EBV receptor level includes protein level and / or nucleic acid level.

[0075] EBV infection

[0076] EBV can establish primary infection in B cells and epithelial cells.

[0077] The key mechanism for EBV to enter B cells is the binding of viral glycoprotein gp350 to complement receptor 2 (CR2, CD21) on the surface of B cells. Subsequently, gp42 binds to the cell receptor HLA2 to form a gH / gL / gp42-HLA2 complex, triggering conformational changes in the gB protein, thereby promoting the fusion of the viral envelope and the cytoplasmic membrane.

[0078] In contrast, EBV infects epithelial cells via a different mechanism, primarily through the binding of BMRF2 to integrins, followed by gH / gL binding to adrenergic receptor A2 (EphA2), activating gB protein and thus initiating membrane fusion.

[0079] Because EBV infects B cells and epithelial cells differently, vaccines or neutralizing antibodies may exhibit different inhibitory effects on different cell types. Therefore, using these two cell types separately in neutralization experiments can not only comprehensively evaluate the neutralizing ability of candidate vaccines, but also clarify their inhibitory effects on different infection pathways, thereby optimizing vaccine design and evaluating their breadth of protection.

[0080] Once infected, EBV establishes two modes of infection: lytic and latent. The virus maintains a lifelong latent infection state in the human body, with only occasional reactivation and lytic replication. Under specific conditions, EBV can reactivate and enter the lytic replication cycle, during which most viral genes are expressed, the virus is able to replicate its genome, and produce infectious progeny viruses.

[0081] Transcriptional switch proteins

[0082] EBV can promote viral replication and viral gene expression through the regulation of key transcriptional switch proteins such as RTA (encoded by the BRLF1 gene) and ZTA (encoded by the BZLF1 gene).

[0083] BZLF1 (ZTA / ZEBRA) is a key regulator in the viral transition from latent infection to lytic replication. As an immediate early gene product, BZLF1 recognizes the ZRE sequence in the viral genome through its bZIP domain, activating its own promoter to form a positive feedback loop and driving the transcription of downstream early genes (such as DNA polymerase BALF5) and late genes (such as capsid protein VP1 and envelope protein gp350). Simultaneously, it reshapes the cellular metabolic environment by regulating host signaling pathways such as NF-κB and MAPK, promoting viral genome replication and progeny particle assembly. BRLF1 (RTA) binds to the RRE through its zinc finger domain, synergizing with BZLF1 to enhance target gene transcription efficiency and activate the host MAPK pathway to provide raw materials for viral replication.

[0084] Studies have also shown that RTA is the primary EBV lytic transcriptional activator in epithelial cells. When expressed alone, RTA effectively induces transcription of most EBV early genes, while ZTA only activates BHLF1 and LF3 transcripts, which are involved in lytic initiation. Furthermore, while the expression of late genes requires the synergistic action of both RTA and ZTA, RTA remains the dominant factor. ZTA primarily acts as a cofactor for DNA replication and, together with RTA, enhances the transcription of some early genes.

[0085] The main advantages of the present invention include:

[0086] (a) The present invention overexpresses EBV receptors and transcriptional switch proteins on the cell surface through genetic modification, thereby providing epithelial cells and B cells with high EBV invasion efficiency, increased viral replication, and enhanced EBV infection ability.

[0087] (b) The present invention provides 293T cells that simultaneously overexpress the epidermal cell receptor EphA2 and the key protein for lytic replication RTA, and BJAB cells that simultaneously overexpress the B cell receptor CD21 and the key protein for lytic replication ZTA, which significantly improve the infectivity of the cells to EBV.

[0088] (c) The cell line of the present invention not only helps to deepen our understanding of the EBV infection mechanism, but also provides an efficient platform for antiviral drug screening and vaccine development, thereby significantly improving the efficiency and success rate of development.

[0089] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally based on conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0090] Example 1: Construction and expression identification of 293T-RTA-EphA2 and BJAB-ZTA-CD21 cell lines.

[0091] To construct epithelial and B cell lines more susceptible to EBV, four plasmids (pLVX-puro-RTA, pLVX-hygro-EphA2, pLVX-puro-ZTA, and pLVX-hygro-CD21) were first constructed. Each plasmid contained a FLAG tag at its C-terminus for easy detection. The pLVX-puro-RTA and pLVX-hygro-EphA2 plasmids were transformed into epidermal-like 293T cells, and monoclonal cell lines expressing the gene stably were selected. The pLVX-puro-ZTA and pLVX-hygro-CD21 plasmids were then transformed into BJAB cells, and monoclonal cell lines expressing the gene stably were selected.

[0092] Construction of 293T-RTA-EphA2 cell line. According to the instructions of the relevant kit, with reference to human EphA2 in NCBI (Gene Bank: NM_004431.5), and using the self-designed primers EphA2-F: gcctcgagatggagctccaggcagcccgcgcctg (SEQ ID NO: 1) and EphA2-R-Flag: cgtctagattacttatcgtcgtcatccttgtaatcgatggggatccccacagtgttcacctggtccttgag (SEQ ID NO: 2), using the plasmid containing EphA2 constructed in other vectors as a template, PCR amplified EphA2 and added a Flag tag to the end of the gene to express it in fusion with the EphA2 gene (EphA2-Flag) for easy detection; after obtaining the EphA2-Flag gene fragment, it was cloned into the pLVX-hygro vector to obtain pLVX-hygro-EphA2, as shown in FIG. Figure 1 As shown, the constructed pLVX-hygro-EphA2 plasmid was double-digested, and the gene fragments after digestion were verified by electrophoresis to be in the expected size. Further DNA sequencing analysis showed that the plasmid construction was correct. The plasmid map of pLVX-puro-RTA is shown in Figure 2 shown.

[0093] Well-growing 293T cells were evenly seeded into 6-well plates and cultured. When the cell density reached approximately 70%-80%, the culture medium was removed and replaced with fresh complete medium. Transfection with the pLVX-hygro-EphA2 and pLVX-puro-RTA plasmids was performed using Tenfect transfection reagent according to the manufacturer's instructions. After 48 hours, the culture medium was replaced with fresh complete medium and hygromycin (400 μg / ml) and puromycin (2 μg / ml) were added for resistance selection. Positive clones were identified and designated 293T-RTA-EphA2.

[0094] Construction of BJAB-ZTA-CD21 cell line. According to the instructions of the relevant kit, with reference to human CD21 (Gene Bank: NM_001006658.3) in NCBI, according to the self-designed primers CD21-F: gcactagtatgggcgccgcgggcctgctcgg (SEQ ID NO: 3), CD21-R-Flag: atagtttagcggccgctcacttatcgtcgtcatccttgtaatcgctggctgggttgtatggatcaacagaatatactt ctcgtgctt (SEQ ID NO: 4), RNA was extracted from human lymphoma cells Raji cells and reversed to cDNA as a template, CD21 was PCR amplified and a Flag tag was added to the end of the gene to be fused with CD21 for detection (CD21-Flag); After obtaining the CD21-Flag gene fragment, it was cloned into the pLVX-hygro vector () to obtain pLVX-hygro-CD21, as shown in FIG. Figure 1 As shown, the constructed pLVX-hygro-CD21 plasmid was double-digested, and the gene fragments after digestion were verified by electrophoresis to be in the expected size. Further DNA sequencing analysis showed that the plasmid construction was correct. The plasmid map of pLVX-puro-ZTA expression is shown in Figure 2 shown.

[0095] BJAB cells with good growth status were centrifuged at 1500 rpm for 5 min to collect the cells, the supernatant was discarded, the cell pellet was resuspended in PBS buffer and counted, and 2×10 6 Centrifuge the cells and remove the supernatant. Place 100 μL of electroporation buffer in a 1.5 mL centrifuge tube, add 4 μg of pLVX-hygro-CD21 plasmid, pipette to mix, use a pipette to aspirate the electroporation buffer to resuspend the cell pellet, and add it to the electroporation cup. Place the electroporation cup in the electroporator, set the corresponding program, start the program, and electroporation is complete when the electroporator displays OK. Resuspend the electroporated cells in complete culture medium preheated to 37°C and add them to the cell culture plate. After culturing the cells for 48 hours, add hygromycin at a final concentration of 200 μg / ml for resistance screening. The resulting positive clone was named BJAB-CD21.

[0096] 293T cells were plated in a 10 cm diameter culture dish for packaging lentivirus, and transfection was performed when the density reached about 80%. Two 1.5 mL centrifuge tubes were divided into tube A and tube B. 500 μl of Opti-MEM medium and 30 μl of PEI were added to tube A and mixed thoroughly; 500 μl of Opti-MEM medium was added to tube B, followed by the addition of pLVX-puro-ZTA plasmid (5 μg), lentiviral packaging auxiliary plasmid psPAX2 (3 μg), and PMD2.G (2 μg), and mixed thoroughly. Then, the transfection reagent mixed in tube A was added to tube B and mixed thoroughly, and incubated at room temperature for 30 minutes. After the incubation, the mixture of tubes A and B was evenly added dropwise to the 293T cells, and gently shaken to mix, and placed in a 37 ° C, 5% CO2 incubator for culture. After 24 hours of culture, sodium butyrate was added to the culture medium to a final concentration of 2.5 μM. Culture was continued for another 48 hours, and the cell culture supernatant was harvested. The viral supernatant was then centrifuged at 4000 rpm at 4°C for 30 minutes to remove cell debris. The supernatant was aliquoted and frozen at -80°C to obtain packaged ZTA-expressing lentivirus.

[0097] BJAB-CD21 cells in good growth condition were cultured at 4×10 5 cells / ml were inoculated into 6-well plates and transduced with the packaged pLVX-puro-ZTA recombinant lentivirus. After incubation for 2 hours, complete medium was added and cultured for a further 48 hours. Then 1 μg / ml of puromycin was added for resistance screening. The positive clone obtained was named BJAB-ZTA-CD21.

[0098] The pLVX-puro-RTA and pLVX-hygro-EphA2 plasmids were transfected into epidermal-like 293T cells to obtain stably expressing monoclonal cell lines, which were then detected by Western Blot. Figure 3 As shown in A; pLVX-puro-ZTA transfection and pLVX-hygro-CD21 lentiviral transduction were used to obtain a stable monoclonal cell line expressing BJAB cells, and its expression was verified by Western Blot detection. The results are shown in Figure 3 As shown in Figure B, the successful construction of the 293T-RTA-EphA2 cell line and the BJAB-ZTA-CD21 cell line was confirmed. The construction of the 293T-RTA-EphA2 cell line and the BJAB-ZTA-CD21 cell line was highly reproducible.

[0099] In addition, this example also attempts to introduce the ZTA gene into epithelial cells and RTA into BJAB cells. However, after applying the screening pressure, significant cell death was observed, which indicates that the 293T-ZTA-EphA2 and BJAB-RTA-CD21 cell lines were not successfully constructed. This may be because the key role of ZTA in EBV DNA replication may cause DNA replication stress in epithelial cells, thereby inducing cell cycle arrest or apoptosis, making it difficult for stable transfected cells to survive. This conclusion confirms that the construction of the EBV-susceptible 293T cells that simultaneously express the epidermal cell receptor EphA2 and the key protein for lytic replication RTA, and the EBV-susceptible BJAB cells that simultaneously express the B cell receptor CD21 and the key protein for lytic replication ZTA of the present invention are both non-obvious.

[0100] Example 2: EBV infection experiment of cell line 293T-RTA-EphA2 and cell line BJAB-ZTA-CD21.

[0101] To test whether the constructed cell lines were more susceptible to EBV, the same amount of EBV-GFP was used to infect the constructed 293T-RTA-EphA2 cell line and the wild-type 293T-WT cell line in six-well plates.

[0102] 293T and 293T-RTA-EphA2 cells were seeded into cell culture plates one day in advance. For viral infection, the culture supernatant was aspirated and the cells were covered with EBV-GFP diluted in DMEM. The cells were then incubated at 37°C, 5% CO2 for 1 hour, with the plates shaken every 15 minutes to ensure uniform coverage of the viral suspension. After infection, the inoculum was aspirated and replaced with complete culture medium for continued culture. Green fluorescence in the cell wells was observed and recorded at 24, 48, and 72 hours post-infection.

[0103] Observation by fluorescence microscopy revealed Figure 4 A shows the corresponding quantitative results. Figure 4 As shown in B.

[0104] The results showed that the GFP fluorescence representing EBV infection in the 293T-RTA-EphA2 cell line was significantly more and stronger than that in the 293T-WT cell line.

[0105] In order to more accurately determine the efficiency of EBV infection in the constructed cell lines, the same experiment was performed in 96-well plates, with three replicates for each sample. The plate was scanned by S6 Universal M2 Analyzer and the number of EBV-infected cells expressing GFP was counted and analyzed. Figure 4 B and Table 1.

[0106] Table 1 EBV infection rate of epithelial cell lines

[0107]

[0108] The results showed that the number of EBV-infected cells in 293T-RTA-EphA2 cell line was significantly higher than that in 293T-WT cell line.

[0109] The above results indicate that the susceptibility of the 293T-RTA-EphA2 cell line to EBV is significantly higher than that of the corresponding wild-type 293T cell line.

[0110] Healthy BJAB and BJAB-ZTA-CD21 cells were centrifuged at 1500 rpm for 5 minutes to collect the cells. The supernatant was discarded, and the cell pellet was resuspended in PBS buffer and counted. The desired number of cells was centrifuged and the supernatant removed. The cells were resuspended in RPMI 1640 medium diluted with EBV-GFP and added to a cell culture plate and incubated at 37°C, 5% CO2 for 2 hours. After infection, the supernatant was removed by centrifugation, and the cells were resuspended in complete RPMI 1640 medium and added to a cell culture plate and incubated at 37°C, 5% CO2. After 72 hours of culture, the cells were collected by centrifugation, fixed with 4% PFA, and analyzed by flow cytometry for EBV-GFP-positive cells.

[0111] The same titer of EBV-GFP (2000 FFU) was used to infect the BJAB-ZTA-CD21 cell line and the wild-type BJAB-WT cell line.

[0112] Observation by fluorescence microscopy revealed Figure 5 As shown in A.

[0113] The results showed that the GFP fluorescence representing EBV infection in the BJAB-ZTA-CD21 cell line was significantly more and stronger than that in the BJAB-WT cell line.

[0114] FACS analysis was performed 72 hours after infection. Figure 5 As shown in B.

[0115] After the BJAB-ZTA-CD21 cell line was infected with EBV, the number of GFP-positive cells, representing EBV infection, was significantly higher than that of BJAB-WT cells.

[0116] The experiment was repeated with 1000 FFU of EBV-GFP in the BJAB-ZTA-CD21 cell line and the wild-type BJAB-WT cell line, with three replicates for each sample. Figure 5 C and Figure 5 D, where Figure 5The results corresponding to D are shown in Table 2.

[0117] Table 2 EBV infection rate of BJAB cell line

[0118]

[0119] The results further confirmed that the EBV infection efficiency in the BJAB-ZTA-CD21 cell line was significantly higher than that in the BJAB-WT cells, and had good stability and reproducibility.

[0120] In addition, this example compares the BJAB-ZTA-CD21 cell line and the Raji cell line commonly used in EBV neutralization experiments. The FACS analysis results are shown in Figure 2. Figure 5 As shown in E, the results showed that the infection efficiency of EBV in BJAB-ZTA-CD21 cell line was significantly higher than that in Raji cells.

[0121] The results of this example show that the susceptibility of the BJAB-ZTA-CD21 cell line to EBV is significantly higher than that of the corresponding wild-type BJAB cell line and the commonly used Raji cell line.

[0122] Example 3: EBV neutralization assay in cell lines.

[0123] To evaluate the applicability of the B cells and epithelial cells of the present invention in EBV neutralization experiments, positive serum samples from the immune gHgL group and negative control serum samples from the PBS group were used. Figure 6 A and Figure 6 B shows the neutralization curves of cell lines BJAB-ZTA-CD21 and epithelial cells 293T-RTA-EphA2, respectively.

[0124] B cell neutralization experiments were performed in BJAB-ZTA-CD21 cells. 12.5 μL of 5-fold serially diluted serum samples were mixed with 12.5 μL of EBV-GFP virus (diluted to a final infection frequency of 1-5%). After incubation at 37°C for 1 hour, 25 μL of 2x10 4 / well of BJAB-ZTA-CD21 cells and incubated again at 37°C for 2 hours. Subsequently, the cells were centrifuged, the supernatant discarded, and resuspended in 10% FBS1% PS1640. After incubation at 37°C for 3 days, the cells were fixed with 2% paraformaldehyde. The percentage of GFP-positive (GFP+) BJAB-ZTA-CD21 cells was determined using a BD LSRII flow cytometer. The neutralization percentage was calculated according to the following formula: 100×(average percentage of GFP cells in a given sample - average percentage of GFP cells in simple cell control samples) / (average percentage of GFP cells in simple virus control samples - average percentage of GFP cells in simple cell control samples).

[0125] Regarding B cell neutralization, the neutralizing effect gradually decreased with increasing dilution of gHgL serum, demonstrating a typical dose-dependent pattern. Neutralization was strong at lower dilutions, but at higher dilutions, the neutralizing capacity of the antibody weakened. This suggests that gHgL-positive serum also has strong neutralizing activity in B cells, and the neutralization effect is inversely proportional to the dilution factor. PBS serum maintained a low level at lower dilutions, and the neutralization effect fluctuated slightly but did not decrease significantly with increasing dilution, indicating that PBS serum has no significant neutralizing effect on EBV infection in B cells.

[0126] Neutralization experiments in epithelial cells were performed in 293T-RTA-EphA2 cells. 2 × 10 4 293T-RTA-EphA2 cells were cultured in 96-well tissue culture plates. After 24 hours, 25 μL of 5-fold serially diluted serum samples and 25 μL of EBV-GFP virus (diluted to about 200 FFU / well, FFU-fluorescent focus unit) were incubated at 37°C for 1 hour. The culture medium in the cells was aspirated and replaced with the serum-virus mixture. After incubation at 37°C for 1 hour, an equal amount of 10% FBS1% PSDMEM was added to the cells and incubated at 37°C for 48 hours. After 48 hours, the cell supernatant was discarded and the cells were washed with water. The plates were scanned using an S6 Universal M2 Analyzer, and GFP-expressing cells were counted and analyzed, recorded as FFU. Percent neutralization was calculated using the following formula: 100 × (FFU of a given sample - FFU of a cell-only control sample) / (FFU of a virus-only control sample - FFU of a cell-only control sample). Serum samples were collected from mice immunized with EBV gHgL protein and PBS as a control.

[0127] For epithelial cell neutralization, as the dilution ratio of gHgL serum increases, the curve remains at a higher level, indicating that at lower dilution ratios (i.e., when the serum concentration is high), the antibody can effectively neutralize EBV infection in epithelial cells. However, as the dilution ratio continues to increase, the curve drops sharply at high dilution ratios, indicating that the antibody neutralization ability fails at higher dilution ratios. The serum curve in the PBS group has almost no change and remains stable at different dilution ratios, indicating that the antibody or serum has no significant neutralizing effect on EBV in epithelial cells, even at higher concentrations (lower dilution ratios).

[0128] The results of this example show that in epithelial cells and B cells, as the dilution of gHgL serum increases, the neutralization effect gradually weakens, a typical dose-dependent reaction, which indicates that the cells of the present invention can accurately reflect the neutralization effect of antibodies on EBV infection. The performance in epithelial cells and B cells with PBS serum showed almost no obvious neutralization effect, indicating that the modified cells can distinguish between samples with neutralizing activity and control samples without neutralizing activity, showing the reliability of the experiment. Therefore, the epithelial cells and B cells of the present invention showed clear neutralization curves in the EBV neutralization experiment, demonstrating that they are suitable for use in evaluating the neutralization efficacy of antibodies or serum.

[0129] In summary, simultaneous overexpression of the EBV receptor for epidermal infection, EphA2, and the viral gene lytic replication and transcriptional activation switch protein, RTA, in the epidermal-like cell line 293T significantly enhanced EBV infection in 293T cells. Simultaneous overexpression of the B cell receptor, CD21, and the viral gene lytic replication and transcriptional activation switch protein, ZTA, in the BJAB cell line significantly enhanced EBV infection in B cells. These two newly constructed cell lines are ideal cell models for studying EBV infection mechanisms, evaluating EBV vaccines, and screening antiviral drugs.

[0130] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. An EBV-susceptible cell line, characterized in that The cell line overexpresses EBV receptors and transcriptional switch proteins.

2. The cell line according to claim 1, wherein The cell lines include: epidermal-like cell lines and / or B cell lines.

3. The cell line according to claim 1, wherein The cell line is an epidermal-like cell line, the EBV receptor is adrenergic receptor A2, and the transcription switch protein is replication transcription activator RTA.

4. The cell line according to claim 1, wherein The cell line is a B cell line, the EBV receptor is a CD21 receptor, and the transcription switch protein is a replication transcription activator ZTA.

5. The cell line according to claim 1, wherein The EBV infection rate X1 of the cell line is significantly higher than the EBV infection rate X0 of the normal control.

6. The use of the cell line according to claim 1, characterized in that For one or more of the following purposes: (Z1) used to study the mechanism of EBV infection of host cells; (Z2) for screening EBV neutralizing antibodies; (Z3) for screening anti-EBV drugs; (Z4) for screening EBV vaccines; (Z5) is used to prepare a live cell preparation, which is used to detect EBV neutralizing antibodies in a sample.

7. A living cell preparation, characterized in that The living cell preparation comprises the cell line according to claim 1.

8. The method for preparing the cell line according to claim 3, characterized in that: The following steps are involved: (A1) providing pLVX-puro-RTA plasmid and pLVX-hygro-EphA2 plasmid; (A2) Transfecting the pLVX-puro-RTA plasmid and the pLVX-hygro-EphA2 plasmid into the epidermal-like cell line, thereby obtaining the cell line of claim 3.

9. The method for preparing the cell line according to claim 4, characterized in that: The following steps are involved: (B1) providing pLVX-hygro-CD21 plasmid and pLVX-puro-ZTA plasmid; (B2) electroporating the pLVX-hygro-CD21 plasmid into a B cell line to obtain BJAB-CD21 cells; (B3) packaging the pLVX-puro-ZTA into a lentivirus and introducing it into the BJAB-CD21 cells, thereby obtaining the cell line of claim 4.

10. A method for evaluating the EBV neutralization activity of a sample, characterized in that: The following steps are involved: (S1) providing the cell line according to any one of claims 1 to 5; (S2) incubating the sample with the cell line described in step (S1) to provide the EBV neutralizing activity of the sample.

Images