Molecular marker for identifying five chimonanthus plants and application thereof

Abstract

The invention discloses molecular markers for identifying five chimonanthus plants and application of the molecular markers in the technical field of molecular identification of plant species, specific molecular markers (cox2i691 and nad4i1399) are developed on the basis of variable regions between chimonanthus praecox and chimonanthus nitens mitochondrial genomes, and the five chimonanthus species are effectively distinguished. The components comprise chimonanthus praecox, chimonanthus nitens, chimonanthus salicifolius, Zhejiang chimonanthus praecox and chimonanthus nitens. According to the method, the chimonanthus species can be conveniently and accurately identified, important information is provided for chimonanthus evolutionary analysis and biochemical character formation mechanism analysis in the future, and chimonanthus species classification, mitochondrial genome evolutionary research and chimonanthus species derived product discrimination are also facilitated.

Description

Technical Field

[0001] The present invention relates to the technical field of plant species molecular identification, and in particular to molecular markers for identifying five species of Chimonanthus plants and applications thereof. Background Art

[0002] The Calycanthaceae family belongs to the magnolia family and, along with six other families, to the Cinnamales order. This family includes the genera Calycanthus, Chimonanthus, and Idiospermum. The genus Chimonanthus contains six endemic species: Chimonanthus nitens, Chimonanthus praecox, Chimonanthus salicifolius, Chimonanthus campanulatus, Chimonanthus grammatus, and Chimonanthus zhejiangensis.

[0003] Chimonanthus chinensis, an evergreen shrub, is prized for its ornamental value and use in traditional Chinese medicine. Its young leaves are used to make a traditional tea called "gold" or "fragrant wind," and in traditional Chinese medicine, its leaves are granulated to relieve symptoms such as influenza, heatstroke, chronic bronchitis, and chest tightness. However, the lack of available omics data for Chimonanthus chinensis, including the genome, mitochondrial genome, and transcriptome, has limited research on cultivar improvement and the mechanisms of shape formation.

[0004] In addition to wintersweet, other plants in the genus Wintersweet, especially Wintersweet of Mount Tai, Wintersweet of Willowleaf, Wintersweet of Zhejiang, and Wintersweet of Tuotou, are easily confused due to their similar morphology and unclear taxonomic characteristics. Therefore, how to effectively identify these Wintersweet plants is a problem to be solved in this field. Summary of the Invention

[0005] The purpose of the present invention is to provide molecular markers for identifying five species of Chimonanthus and their applications, which solve the current technical problems that the morphological similarities and taxonomic characteristics of Chimonanthus plants are not obvious, they are easily confused, and there is a lack of effective identification methods.

[0006] The present invention achieves the above-mentioned purpose through the following technical solutions: As a first aspect of the present invention, molecular markers for identifying five species of Chimonanthus genus are provided, wherein the five species of Chimonanthus genus are Chimonanthus zhejiangensis, Chimonanthus willowii, Chimonanthus shanxiensis, Chimonanthus chinensis and Chimonanthus tuotuoensis. The molecular markers are cox2i691 and nad4i1399; The nucleotide sequences of cox2i691 of Chimonanthus chinensis, cox2i691 of Chimonanthus willowii, cox2i691 of Chimonanthus zhejiangensis, cox2i691 of Chimonanthus tutuo and cox2i691 of Chimonanthus shanxiensis are shown as SEQ ID NOs. 5-9, respectively; The nucleotide sequences of Chimonanthus nad4i1399 of Chimonanthus chinensis, Chimonanthus willowii, Chimonanthus zhejiangensis, Chimonanthus tuotuoensis and Chimonanthus montana are shown in SEQ ID NOs. 10-14, respectively.

[0007] As a second aspect of the present invention, a primer pair for amplifying the molecular markers for identifying the five species of Chimonanthus genus as described above is also provided. The primer pair for amplifying the molecular marker cox2i691 is: The upstream primer cox2i691-F is shown in SEQ ID NO. 1: TAGTGGACGTTATTTCTGCTG; The downstream primer cox2i691-R is shown in SEQ ID NO. 2: CATAGGTGAAATCCAATCCC; The primer pair used to amplify the molecular marker nad4i1399 is: The upstream primer nad4i1399-F is shown in SEQ ID NO. 3: CCACGCACCCTGGAAACA; The downstream primer nad4i1399-R is shown in SEQ ID NO. 4: TGTGCGTGCGTGAGTTGG.

[0008] As a third aspect of the present invention, there is also provided the use of the molecular markers or primer pairs described above in identifying Chimonanthus zekyenensis, Chimonanthus willowii, Chimonanthus mountainus, Chimonanthus chinensis and Chimonanthus tuotuo.

[0009] As a fourth aspect of the present invention, a kit for identifying Chimonanthus zekyenensis, Chimonanthus willowii, Chimonanthus mountainus, Chimonanthus chinensis and Chimonanthus tutuo is also provided, comprising the primer pair described above.

[0010] As a fifth aspect of the present invention, a method for identifying Chimonanthus zekyenensis, Chimonanthus willowii, Chimonanthus montana, Chimonanthus chinensis and Chimonanthus tutuo is also provided, comprising the steps of: (1) Take the plant sample to be tested and extract total DNA; (2) using the total DNA extracted in step (1) as a template, amplifying using the primer pair described above to obtain an amplified product; (3) Sequencing the amplified products obtained in step (2) and identifying Chimonanthus zekyenensis, Chimonanthus willowii, Chimonanthus mountainus, Chimonanthus truncatus, and Chimonanthus tutuo according to the sequencing results.

[0011] As a further optimized solution of the present invention, the PCR amplification reaction system is as follows: the total reaction volume is 20.0 μL, including 2.0 μL template DNA, 0.5 μL each of forward primer and reverse primer, 10.0 μL 2× Taq PCR Master Mix and 7.0 μL ddH2O.

[0012] As a further optimization scheme of the present invention, the PCR amplification reaction conditions are as follows: denaturation at 94°C for 5 min, followed by 35 cycles, each cycle including 94°C for 30 seconds, 58°C for 30 seconds and 72°C for 60 seconds, and finally extension at 72°C for 5 minutes.

[0013] The beneficial effects of the present invention are: First, the present invention uses Oxford Nanopore and Illumina sequencing technologies to complete the assembly of a high-quality mitochondrial genome of Chimonanthus chinensis. Through comparative analysis with the mitochondrial genome of Chimonanthus chinensis, the present invention comprehensively characterizes the structural characteristics and sequence variations of the mitochondrial genome of Chimonanthus chinensis. Secondly, the present invention developed specific molecular markers (cox2i691 and nad4i1399) based on the variable regions between the mitochondrial genomes of Chimonanthus chinensis and Chimonanthus montana, effectively distinguishing five species of Chimonanthus genus, namely, Chimonanthus chinensis, Chimonanthus montana, Chimonanthus willowleaf, Chimonanthus zhejiangensis and Chimonanthus tuotuoensis. Finally, the invention is conducive to the convenient and accurate identification of Chimonanthus species, providing crucial information for future evolutionary analysis of Chimonanthus and analysis of the mechanism of biochemical trait formation, and is also conducive to the classification of Chimonanthus species, mitochondrial genome evolution research, and the identification of products derived from Chimonanthus species. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The assembly results of the Chimonanthus mitochondrial genome provided in Example 2 of the present invention are shown in the Unitig diagram depicting chr1 (A) and chr2 (B) of the Chimonanthus mitochondrial genome. C1 to C13 represent Contig 1 to Contig 13. Sequences are displayed as colored bars, with numbers reflecting their length and relative sequencing depth, and black lines indicating connections between sequences. Figure 2 This is a diagram of the mitochondrial genome structure and gene distribution of Chimonanthus chinensis provided in Example 2 of the present invention. In the diagram, genes in the outer circle (chr1) and the lower linear region (chr2) are transcribed counterclockwise, while genes in the inner circle and the upper linear region are transcribed clockwise. Genes with different functions are distinguished by different colors. Figure 3 、 Figure 4 All are comparative analyses of the cis-splicing introns shared in the mitochondrial genomes of Chimonanthus chinensis and Chimonanthus chinensis provided in Example 3 of the present invention; Figure 5 This is an electrophoresis diagram of the mitochondrial genome marker PCR product provided in Example 3 of the present invention. In the figure, A shows the cox2i691 marker; B shows the nad4i1399F marker. PCR amplification covers 3-4 individuals from different provenances of each species. DNA marker: DL2000. Figure 6 This is the Sanger sequencing alignment result of the PCR amplification product provided in Example 4 of the present invention. In the figure, A shows the cox2i691 polymorphic site; B shows the nad4i1399 polymorphic site; the identical nucleotides in all sequences are shown in black, while the conserved nucleotides in ≥60% of the sequences are shown in gray, and insertions and deletions are marked with short lines. DETAILED DESCRIPTION

[0015] The present application is described in further detail below in conjunction with the accompanying drawings. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0016] Example 1 Leaf tissue sampling, DNA extraction and sequencing 1. Leaf tissue sampling Fresh leaves of Chimonanthus praecox, Chimonanthus montana, Chimonanthus willowii, and Chimonanthus chekiangensis were collected from the Forestry Research Institute of Shangrao City, Jiangxi Academy of Forestry, and Jiangxi Agricultural University, China. Wild Chimonanthus tutuo leaf samples were collected from natural populations in Anyuan County and Huichang County, Jiangxi Province. The sample collection information is shown in Table 1.

[0017] After collection, the samples were immediately stored in liquid nitrogen. The Chimonanthus chinensis samples from Wuyuan County were sent to Nanjing Jisi Huiyuan Biotechnology Co., Ltd. for mitochondrial genome sequencing, and the remaining samples were stored in a -80°C refrigerator for later use.

[0018] Table 1 Sample collection information Sample No. type Collection location Seed source 1 Zhejiang Wintersweet Jiangxi Agricultural University, Nanchang Economic Development Zone Longquan County 2 Zhejiang Wintersweet Jiangxi Agricultural University, Nanchang Economic Development Zone Kecheng District 3 Zhejiang Wintersweet Jiangxi Agricultural University, Nanchang Economic Development Zone Changshan County 4 Willow-leaf sweet Guangxin District, Shangrao City Longquan County 5 Willow-leaf sweet Guangxin District, Shangrao City Yushan County 6 Willow-leaf sweet Guangxin District, Shangrao City Guangfeng District 7 Mountain Wintersweet Guangxin District, Shangrao City Wuyuan County 8 Mountain Wintersweet Guangxin District, Shangrao City Yushan County 9 Mountain Wintersweet Guangxin District, Shangrao City Jixi County 10 Wintersweet Jiangxi Academy of Forestry Sciences, Nanchang Economic Development Zone unknown 11 Wintersweet Jiangxi Academy of Forestry Sciences, Nanchang Economic Development Zone unknown 12 Wintersweet Jiangxi Academy of Forestry Sciences, Nanchang Economic Development Zone unknown 13 Wintersweet Jiangxi Academy of Forestry Sciences, Nanchang Economic Development Zone unknown 14 Tutolamei Anyuan County Ge'ao Forest Farm Anyuan County 15 Tutolamei Anyuan County Ge'ao Forest Farm Anyuan County 16 Tutolamei Qingxi Township, Huichang County Huichang County 2. DNA extraction and sequencing (1) DNA extraction Genomic DNA was extracted from fresh leaves of Chimonanthus praecox, Chimonanthus chinensis, Chimonanthus willowii, Chimonanthus chekiangensis, and Chimonanthus tutuo using the Tiangen Biochemical Plant Genomic DNA Kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). Quality and concentration were assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) and 1.0% agarose gel electrophoresis. Note that DNA was extracted separately from different individuals of the same species listed in Table 1 and used as templates for PCR amplification experiments. This was designed as biological replicates for different individuals of the same species.

[0019] (2) Sequencing For short-read sequencing, high-quality genomic DNA was fragmented to approximately 350 bp using a Covaris S2 / E210 sonicator (Covaris Inc., Woburn, MA, USA), and Illumina libraries were constructed according to standard Illumina methods (Illumina, Inc., San Diego, CA, USA) and sequenced on the NovaSeq 6000 platform.

[0020] For long-read sequencing, high-quality genomic DNA was first randomly fragmented, enriched, and purified using the Short Read Eliminator XS kit (Circulomics, Inc., Baltimore, MD, USA). Large DNA fragments were then recovered by gel excision, end-repaired, and end-terminated with adenine A. Ligation reactions were then performed using the SQK-LSK109 ligation kit (Oxford Nanopore Technologies, Cambridge, UK). Finally, the constructed DNA library was quantitatively analyzed. After library construction, the DNA library was added to a flow cell at a specific concentration and volume, and the flow cell was transferred to the Oxford Nanopore PromethION sequencer for real-time single-molecule sequencing.

[0021] Raw Illumina sequencing reads were filtered using fastp software (version 0.20.0, https: / / github.com / OpenGene / fastp) to obtain high-quality reads and remove adapters and low-quality or ambiguous sequences. Raw Nanopore sequencing reads were refined using filtlong software (version 0.2.1, https: / / github.com / rrwick / Filtlong), filtering out reads shorter than 1000 bases and with an average quality score below 7.

[0022] Example 2 Mitochondrial genome assembly Given the high conservation of PCGs and ribosomal RNA sequences in plant mitochondrial genomes, we first aligned the Nanopore PromethION sequencing reads of Chimonanthus serrata with the plant mitochondrial core gene database (https: / / github.com / xul962464 / plant_mt_ref_gene) using Minimap2 software (version 2.1) to initiate the assembly work.

[0023] Reads with alignment lengths exceeding 50 bp were selected as potential candidate sequences, and seed sequences were determined based on the number and quality of aligned genes to ensure comprehensive coverage of core genes. Subsequently, Nanopore PromethION raw reads were realigned to these seed sequences using Minimap2. Reads with overlaps greater than 1 kb and similarities greater than 70% were selected and added to the seed sequences. All three generations of sequencing reads for the mitochondrial genome were obtained through iterative extension.

[0024] Next, the obtained Nanopore PromethION sequencing reads were corrected using the third-generation assembly software Canu, and the Illumina sequencing reads were aligned to the corrected Nanopore PromethION sequencing reads using Bowtie2 (v2.3.5.1). Subsequently, the aligned Illumina reads and Nanopore PromethION reads were spliced ​​using Unicycler (v0.4.8) with default parameters to obtain contigs.

[0025] Finally, the corrected Nanopore PromethION sequencing reads were realigned to the contigs using Minimap2, and branch orientations were manually resolved to complete the assembly. This rigorous approach ensured the accuracy and completeness of the mitochondrial genome assembly.

[0026] The results are as follows Figure 1 As shown, 37,641,521 clean reads with a total length of 11.29 Gb were obtained by Illumina sequencing. 10.36 Gb of clean reads were obtained from the Nanopore platform with an N50 value of 26,161 bp. 13 contigs were assembled using Unicycler software. Except for contig 4, the other 12 contigs formed a complex circular structure with a total length of 916,004 bp and were named chromosome 1 ( Figure 1A). Contig 4, 74,775 bp in length, formed a separate circular chromosome and was designated as chromosome 2 ( Figure 1 B).

[0027] The mitochondrial genome of Chimonanthus serrata contains 40 PCGs, 19 tRNA genes and 3 rRNA genes, e.g. Figure 2 The total length of these PCGs sequences is 42,429 bp, accounting for 4.28% of the mitochondrial genome.

[0028] Example 3 Molecular marker gel electrophoresis results The intron sequences of all PCGs in the currently available mitochondrial genomes of Chimonanthus chinensis (Genbank accession number OR811177.1) and Chimonanthus chinensis were extracted and sequence alignment analysis was performed using BLAST software (version 2.10.1). Seven insertions and deletions (indels) were found in the introns of four PCGs: nad2 (1), nad4 (3), nad7 (1), and cox2 (2). The alignment analysis results are shown in Figure 2. Figure 3 、 Figure 4 The highly variable region sequences in the cox2 and nad4 introns were designated cox2i691 and nad4i1399, respectively.

[0029] Primer 5.0 software was used to design primers targeting the cox2i691 and nad4i1399 variant regions. The primer information is as follows: The primers for molecular marker cox2i691 are: Upstream primer cox2i691-F: TAGTGGACGTTATTTCTGCTG (SEQ ID NO. 1); Downstream primer cox2i691-R: CATAGGTGAAATCCAATCCC (SEQ ID NO. 2).

[0030] The primers for molecular marker nad4i1399 are: Upstream primer nad4i1399-F: CCACGCACCCTGGAAACA (SEQ ID NO. 3); Downstream primer nad4i1399-R: TGTGCGTGCGTGAGTTGG (SEQ ID NO. 4).

[0031] Total DNA from Chimonanthus praecox, Chimonanthus chinensis, Chimonanthus willowii, Chimonanthus chekiangensis, and Chimonanthus tutuo was extracted and quantified using the Tiangen Biochemical Plant Genomic DNA Kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). PCR amplification was performed using the extracted total DNA from each of the five Chimonanthus species as templates using the primer pairs designed above. The nucleotide sequences of cox2i691 and nad4i1399 for each of the five Chimonanthus species were obtained. The PCR amplification reaction system was as follows: The total reaction volume was 20.0 µL, containing 2.0 µL template DNA (50 ng), 0.5 µL each of forward and reverse primers, 10.0 µL 2× Taq PCR Master Mix, and 7.0 µL ddH2O.

[0032] PCR amplification reaction conditions are as follows: Denaturation was performed at 94 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 60 s, and a final extension at 72 °C for 5 min.

[0033] PCR amplification products were detected by 5% agarose gel electrophoresis. PCR amplification covered 3-4 individuals from different sources for each species. Figure 5 As shown, Figure 5 Figure A shows the cox2i691 marker, and Figure B shows the nad4i1399 marker; based on the DNA amplification band patterns and subsequent sequencing results ( Figure 6 ) Five species of the genus Chimonanthus can be distinguished, namely, Chimonanthus zhejiangensis, Chimonanthus willowii, Chimonanthus mountainus, Chimonanthus chinensis and Chimonanthus tuotuo.

[0034] The nucleotide sequence of Chimonanthus praecox cox2i691 is as follows: TAGTGGACGTTATTTCTGCTGAAAAACTACGTCATCGCGCCCTAGCGCGCCTTCCTTAATACTGCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCGCCTACACTTTAGGGTCTAGTAACTTGCCGGGTCGCCTACACTTTAGGGTCGCCTACACTTGCCGGGTCGCCTACACTTTAGGGTCGCCTACACTTGCTGGGGCTTTGAAGCTTTGACTCAGCCCGACGTGCTTGCTGCTTGCTTTCTCGCTTCCGAGAGGCGAAGGGAGCCTGACTTACGGCTTCCAAGCCTGGCGCGAAGCGAAGGGATTGGATTTCACCTATG (SEQ ID NO.5).

[0035] The nucleotide sequence of Chimonanthus nitens Oliv. cox2i691 is shown below: TAGTGGACGTTATTTCTGCTGAAAAACTACGTCATCGCGCCCTAGCGCGCCTTCCTTAATACTGCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCGCCTACACTTGCCGGGTCGCCGTAACTTTAGGGTCGCCGTAACTTTAGGGTCGCCGTAACTTTAGGGTCGCCGTAACTTGCCGGGTCGCCTACACTTGCTGGGGCTTTGAAGCTTTGATTCAGCCCGACGTGCTTGCTGCTTGCTTTCTCGCTTCCGAGAGGCGAAGGGAGCCTGACTTACGGCTTCCAAGCCTGGCGCGAAGCGAAGGGATTGGATTTCACCTATG (SEQ IDNO.6).

[0036] The nucleotide sequence of Chimonanthus praecox (L.) Link cox2i691 is shown below: TAGTGGACGTTATTTCTGCTGAAAAACTACGTCATCGCGCCCTAGCGCGCCTTCCTTAATACTGCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCGCCGTAACTTTAGGGTCGCCGTAACTTGCTGGGGCTTTGAAGCTTTGACTCAGCCCGACGTGCTTGCTGCTTGCTTTCTCGCTTCCGAGAGGCGAAGGGAGCCTGACTTACGGCTTCCAAGCCTGGCGCGAAGCGAAGGGATTGGATTTCACCTATG (SEQ ID NO.7).

[0037] The nucleotide sequence of Chimonanthus grammatus cox2i691 is shown below: TAGTGGACGTTATTTCTGCTGAAAAACTACGTCATCGCGCCCTAGCGCGCCTTCCTTAATACTGCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCTAGTAACTTGCCGGGTCGCCGTAACTTGCCGGGTCGCCGTAACTTTAGGGTCTAGTAACTTTAGGGTCTAGTAACTTTAGGGTCGCCTACACTTGCTGGGGCTTTGAAGCTTTGACTCAGCCCGACGTGCTTGCTGCTTGCTTTCTCGCTTCCGAGAGGCGAAGGGAGCCTGACTTACGGCTTCCAAGCCTGGCGCGAAGCGAAGGGATTGGATTTCACCTATG (SEQ ID NO.8).

[0038] The nucleotide sequence of Chimonanthus nitens cox2i691 is shown below; TAGTGGACGTTATTTCTGCTGAAAAACTACGTCATCGCGCCCTAGCGCGCCTTCCTTAATACTGCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCGCCTACACTTGCCGGGTCGCCGTAACTTGCTGGGGCTTTGAAGCTTTGACTCAGCCCGACGTGCTTGCTGCTTGCTTTCTCGCTTCCGAGAGGCGAAGGGAGCCTGACTTACGGCTTCCAAGCCTGGCGCGAAGCGAAGGGATTGGATTTCACCTATG (SEQ ID NO.9).

[0039] The nucleotide sequence of Chimonanthus praecox nad4i1399 is shown below: CCACGCACCCTGGAAACATACTGCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGCCGCCTACACTTGCCGGGTCGCCGTAACTTGCCGGGTCTAGTAACTTGCTGGGGCCGGAAGATCTCAGTTGTCCTGGACTGGACAAGTACGTAGAGATCTTCGTGGGACCGGGGAGGGAGTATCAATCGATCTTTTCTAGGATTCCAACTCACGCACGCACA (SEQ ID NO.10).

[0040] The nucleotide sequence of Chimonanthus salicifolius nad4i​1399 is shown below: CCACGCACCCTGGAAACATACTGCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCTAGTAACTTGCCGGGTCGCCTACACTTGCTGGGGCCGGAAGATCTCAGTTGTCCTGGACTGGACAAGTACGTAGAGATCTTCGTGGGACCGGGGAGGGAGTATCAATCGATCTTTTCTAGGATTCCAACTCACGCACGCACA (SEQ ID NO.11).

[0041] The nucleotide sequence of Chimonanthus nitens nad4i1399 is shown below: CCACGCACCCTGGAAACATACTGCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCGCCGTAACTTGCCGGGTCGCCGTAACTTGCTGGGGCCGGAAGATCTCAGTTGTCCTGGACTGGACAAGTACGTAGAGATCTTCGTGGGACCGGGGAGGGAGTATCAATCGATCTTTTCTAGGATTCCAACTCACGCACGCACA (SEQ ID NO.12).

[0042] The nucleotide sequence of Chimonanthus grammatus nad4i1399 is shown below: CCACGCACCCTGGAAACATACTGCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCTAGTAACTTGCCGGGTCTAGTAACTTTAGGGTCGCCTACACTTGCTGGGGCCGGAAGATCTCAGTTGTCCTGGACTGGACAAGTACGTAGAGATCTTCGTGGGACCGGGGAGGGAGTATCAATCGATCTTTTCTAGGATTCCAACTCACGCACGCACA (SEQ ID NO.13).

[0043] The nucleotide sequence of Chimonanthus nad4i1399 is shown below: CCACGCACCCTGGAAACATACTGCGCGTTGCGGCTCCCTTCCAACACCTGCCGCGTTGCGGCGGACTTCCAACACCTGCCGCGTTGCGGCTCCCTTTGGGTCGCCTACACTTGCCGGGTCTAGTAACTTGCCG GGTCGCCGTAACTTGCTGGGGCCGGAAGATCTCAGTTGTCCTGGACTGGACAAGTACGTAGAGATCTTCGTGGGACCGGGGAGGGAGTATCAATCGATCTTTTCTAGGATTCCAACTCACGCACGCACA (SEQ ID NO.14).

[0044] Example 4 Comparison of molecular marker sequencing results Following the method described in Example 3, PCR was used to amplify the cox2i691 and nad4i1399 nucleotide sequences of five Chimonanthus species. The PCR products were purified and cloned into the pMD18-T vector (Takara), transformed into TOP10 competent Escherichia coli (Shanghai Bioengineering), and positive clones were screened. The target sequences were confirmed by Sanger sequencing, and the alignment results were visualized using Chromas software (version 2.6.6). The results are shown in Figure 2. Figure 5 shown.

[0045] Sequencing alignment of markers cox2i691 and nad4i1399 revealed abundant sequence polymorphism among species including Chimonanthus zekyenica, Chimonanthus willowii, Chimonanthus shanxiensis, Chimonanthus chinensis, and Chimonanthus tutuo. Of particular note, the cox2i691 marker revealed a 106-bp deletion in Chimonanthus shanxiensis and Chimonanthus zhejiangensis, while the nad4i1399 marker revealed 28-bp and 25-bp insertions in Chimonanthus tutuosis, respectively. These results confirm the high reliability of cox2i691 and nad4i1399 as molecular markers for accurately identifying Chimonanthus species.

[0046] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. Identify molecular markers for five species of Chimonanthus, characterized in that: The five species of Chimonanthus are Chimonanthus zhejiangensis, Chimonanthus willowii, Chimonanthus mountainus, Chimonanthus chinensis and Chimonanthus tuotuo; The molecular markers are cox2i691 and nad4i1399; The nucleotide sequences of cox2i691 of Chimonanthus chinensis, cox2i691 of Chimonanthus willowii, cox2i691 of Chimonanthus zhejiangensis, cox2i691 of Chimonanthus tutuo and cox2i691 of Chimonanthus shanxiensis are shown as SEQ ID NOs. 5-9, respectively; The nucleotide sequences of Chimonanthus nad4i1399 of Chimonanthus chinensis, Chimonanthus willowii, Chimonanthus zhejiangensis, Chimonanthus tuotuoensis and Chimonanthus montana are shown in SEQ ID NOs. 10-14, respectively.

2. A primer pair for amplifying a molecular marker for identifying five species of Chimonanthus plants as claimed in claim 1, characterized in that: The primer pair used to amplify the molecular marker cox2i691 is: The upstream primer cox2i691-F is shown in SEQ ID NO. 1: TAGTGGACGTTATTTCTGCTG; The downstream primer cox2i691-R is shown in SEQ ID NO. 2: CATAGGTGAAATCCAATCCC; The primer pair used to amplify the molecular marker nad4i1399 is: The upstream primer nad4i1399-F is shown in SEQ ID NO. 3: CCACGCACCCTGGAAACA; The downstream primer nad4i1399-R is shown in SEQ ID NO. 4: TGTGCGTGCGTGAGTTGG.

3. The molecular marker as claimed in claim 1 or the primer pair as claimed in claim 2 is used in identifying Chimonanthus zhejiangensis, Chimonanthus willowii, Chimonanthus mountainus, Chimonanthus chinensis and Chimonanthus tutuo.

4. A kit for identifying Chimonanthus zekyenensis, Chimonanthus willowii, Chimonanthus mountainus, Chimonanthus chinensis and Chimonanthus tutuo, characterized in that: Comprising the primer pair as claimed in claim 2.

5. A method for identifying Chimonanthus zekyensis, Chimonanthus willowii, Chimonanthus montana, Chimonanthus chinensis and Chimonanthus tutuo, characterized in that: The steps include: Take the plant samples to be tested and extract total DNA; (2) using the total DNA extracted in step (1) as a template, performing a PCR amplification reaction using the primer pair described in claim 2 to obtain an amplified product; (3) Sequencing the amplified products obtained in step (2) and identifying Chimonanthus zekyenensis, Chimonanthus willowii, Chimonanthus mountainus, Chimonanthus chinensis and Chimonanthus tuotuo according to the sequencing results.

6. The method according to claim 5, characterized in that The PCR amplification reaction system was as follows: the total reaction volume was 20.0 μL, containing 2.0 μL template DNA, 0.5 μL each of forward primer and reverse primer, 10.0 μL 2× Taq PCR Master Mix, and 7.0 μL ddH2O.

7. The method according to claim 5, characterized in that The PCR amplification reaction conditions were as follows: denaturation at 94°C for 5 min, followed by 35 cycles, each cycle consisting of 94°C for 30 s, 58°C for 30 s, and 72°C for 60 s, and finally extension at 72°C for 5 min.

Images