Engineered Escherichia coli and application thereof in production of stropharia rugoso-annulata

Abstract

The invention relates to a technology for de novo synthesis of stropharia rugoso-annulata from escherichia coli, and belongs to the technical field of microbial engineering. The invention provides an escherichia coli engineering bacterium. The escherichia coli engineering bacterium is obtained by transferring plasmids pHZR01, pHZR02, pHZR03 and pHZR04 into escherichia coli BL21, the route of the invention is a biosynthetic pathway that enterobacter BL21 (DE3) is taken as a chassis cell, Psilocybin is heterologously reconstructed, tryptophan decarboxylase (BaTDC), P450 monooxygenase (PsiH), phosphokinase (PsiK) and methyltransferase (PsiM) from Psilocybin are overexpressed, and a P450 electron transport chain is optimized by expressing reductive protein (CPR), NAD + kinase (NADK) and cytochrome b5 (CYB5), so that the P450 electron transport chain is optimized, and the Psilocybin can be used for preparing a recombinant vector. Then, a tryptophan catabolism gene (tnaA) and a tryptophan negative feedback inhibition gene (trpR) are knocked out to optimize the escherichia coli tryptophan synthesis route, efficient de novo synthesis of the nummulina velutipes in escherichia coli is achieved, and the shake flask fermentation yield is 79.85 + / -3.15 mg / L.

Description

Technical Field

[0001] The present invention relates to the field of microbial engineering technology, and in particular to a recombinant Escherichia coli for producing psilocybin, a construction method thereof, and an application thereof. Technical Background

[0002] Depression is a common mental illness caused by multiple biological, psychological, social and lifestyle factors. Its main manifestations include fatigue, memory loss, decreased mobility, pessimism, depression, sleep disorders, etc. [1] Currently, common antidepressant medications have a slow onset of action and a long treatment cycle. Once discontinued, side effects such as insomnia, headaches, nausea, and irritability may occur. [2] Currently, only a small number of patients with depression experience complete relief from medication. Most discontinue medication due to adverse reactions, resulting in suboptimal results. Therefore, the development of new antidepressants is urgent. Shortening the treatment cycle, prolonging the duration of drug efficacy, ensuring drug safety, minimizing drug dependence, and reducing toxic side effects are key issues in the development of new antidepressants.

[0003] Psilocybin is a natural product derived from tryptamine in the fruiting bodies of the large fungus Psilocybe (the so-called "magic mushroom"). Psilocybin is a relatively stable, water-soluble substance that is first converted into a biologically active derivative, psilocin, by alkaline phosphatase, nonspecific esterase, or the acidic conditions of the stomach. Psilocybin then crosses the blood-brain barrier and interacts with serotonin receptors to exert its psychotropic or therapeutic effects. [3] Studies have shown that psilocybin can exert rapid, powerful and long-lasting anxiolytic and antidepressant effects in the treatment of depression. [4,5] , low lethal toxicity [6] , patients tolerated it well [7] , low drug dependence, no long-term functional impairment and other side effects [8] With its low addictiveness and low toxic side effects, psilocybin is expected to become a new generation of long-acting antidepressant drugs.

[0004] There are two main methods for synthesizing Psilocybin: chemical synthesis and biosynthesis. As early as 1958, Hofmann et al. [9] Designed the initial chemical synthesis route for psilocybin, and then Kargbo

[10] et al. optimized this synthetic route: 4-acetoxyindole reacted with oxalyl chloride, dimethylamine, and lithium aluminum hydride in sequence to generate psilocin, and the intermediate psilocin was directly phosphorylated with phosphorus oxychloride to obtain the final product psilocybin. According to HPLC analysis, the purity of psilocybin can reach 99.7% and the yield is 31%, which can be used to prepare drugs that comply with the Good Manufacturing Practice (cGMP) for pharmaceutical production to meet clinical requirements. However, this method of chemically synthesizing psilocybin has expensive raw materials, low yields, and the risk of environmental pollution. The biosynthetic pathway of psilocybin was analyzed by Fricke et al. in 2017.

[11] They sequenced the genomes of Psilocybe cubensis and Psilocybe cyanescens, expressing genes in the psilocybin biosynthesis gene cluster. In vitro enzymatic experiments confirmed the biosynthesis pathway of psilocybin. Figure 1 ): L-tryptophan (L-Tryptopha) or 4-hydroxytryptophan (4-hydroxytryptophan) is decarboxylated by PsiD (fungal L-tryptophan decarboxylase) to form tryptamine (Tryptamine); Tryptamine is oxidized at the 4-position of the indole ring by PsiH (tryptamine P450 monooxygenase) to form a hydroxyl group to produce 4-hydroxytryptamine (4-hydroxytryptamine); PsiK (phosphokinase) can catalyze the further phosphorylation of the 4-position hydroxyl group of 4-hydroxytryptamine or Psilocin to produce a demethylated psilocybin analogue (Norbaeocystin); Norbaeocystin catalyzes the transfer of two N-methyl groups by PsiM (methyltransferase) to form the final product psilocybin. The analysis of the biosynthetic pathway has laid the foundation for the heterologous expression of psilocybin in a variety of microbial chassis cells. In 2018, Hoefgen et al.

[12] By utilizing the "stop-continue" mechanism of picornaviruses, a vector system containing a 2A self-cleaving peptide was designed to promote the successful co-translational cleavage of each protein produced by polycistronic transcripts. This relieved the restriction of a highly regulated single monocistronic transcript for heterologous expression of multi-gene biosynthetic pathways in eukaryotic hosts, and successfully heterologously expressed the entire biosynthetic gene cluster in Aspergillus nidulans, synthesizing psilocybin with a yield of up to 110 mg / L. In 2019, Adams et al.

[13] For the first time, psilocybin was produced in a prokaryotic host. The researchers constructed a modular biosynthetic production platform for Escherichia coli, used multiple genetic optimization technologies in parallel (promoter library screening, enzyme copy number screening, etc.) to identify genetically advantageous mutants and optimize fermentation conditions. They used PsiD, PsiK, PsiM and natural Escherichia coli tryptophan synthase (TrpAB) to ferment 4-hydroxyindole as a precursor substrate to produce psilocybin, and its yield was increased to 1.16 g / L. Although Escherichia coli can naturally produce serine and indole, it lacks the ability to express P450 monooxygenase. In 2020, Milne et al.

[14] By expressing a cytochrome P450 reductase (CPR) from Psilocybe cubana, we successfully achieved the de novo synthesis of psilocybin from glucose in Saccharomyces cerevisiae, and produced 627±140 mg / L of psilocybin and 580±276 mg / L of its dephosphorylated degradation product, psilocin, in a three-stage fed-batch fermentation system.

[15] Two psilocybin-producing strains, Saccharomyces cerevisiae and Acremonium chrysogenum, were constructed. CRISPR-Cas9 multi-site gene editing technology was used to construct recombinant strains, integrating multiple psilocybin synthesis enzyme modules, Tdc, PsiK, PsiH, and PsiM, into the genome. The psilocybin production was effectively increased to 114 mg / L by screening and optimizing the enzyme gene copy number. A monocistronic multi-gene expression vector was constructed, inserting 2A peptide sequences and TEV protease recognition sites between the psilocybin biosynthesis enzyme genes, Tdc, PsiH, PsiK, and PsiM, and successfully achieving psilocin biosynthesis using serine and methionine as precursors.

[16] et al. developed an Escherichia coli co-culture system for de novo psilocybin synthesis. The JF06 strain expressed the substrate-universal tryptophan synthase TrpB, a P450 monooxygenase, and the P450 reductase CPR, while the pSilo16 strain expressed TrpB, PsiD, PsiK, and PsiM. After optimizing the genetic pathway, psilocybin production reached 28.5 ± 0.3 mg / L. They also achieved biosynthesis of psilocybin and 13 non-natural derivatives using this bacterial platform.

[0005] The above research demonstrates that industrial production of psilocybin through microbial fermentation is an effective strategy, offering lower production costs, less environmental pollution, and sustainable development compared to traditional chemical synthesis methods. While E. coli exhibits significant advantages in heterologous psilocybin synthesis, this relies on the addition of precursors and bypasses the P450 enzyme, preventing de novo synthesis and increasing production costs. Therefore, achieving de novo synthesis of psilocybin in E. coli to increase yield and reduce costs is an inevitable trend. Summary of the Invention

[0006] The purpose of the present invention is to provide a plasmid-free high-tryptophan-producing strain obtained through metabolic modification, and based on this, recombinant exogenous genes to obtain a genetically engineered bacterium capable of producing psilocybin. The genetically engineered bacterium does not rely on the addition of exogenous substrates and can produce psilocybin from scratch.

[0007] The purpose of the present invention is to provide a recombinant Escherichia coli for producing psilocybin. The recombinant Escherichia coli uses Escherichia coli BL21 (DE3) as the base bacteria and is metabolically modified to obtain the Escherichia coli Strain02 strain with high tryptophan production.

[0008] Using Escherichia coli Strain02 as the host bacteria, strain 13 was obtained by overexpressing the genes of decarboxylase (BaTDC), modified P450 monooxygenase (trPsiH), phosphokinase (PsiK), and methyltransferase (PsiM) from Psilocybe cubensis, as well as genes expressing reducing protein (CPR), NAD+ kinase (NadK), and cytochrome b5 (CYB5), thereby achieving efficient de novo synthesis of psilocybin in Escherichia coli.

[0009] To achieve this object, the present invention provides an engineered Escherichia coli bacterium, obtained by transforming plasmids pHZR01, pHZR02, pHZR03, and pHZR04 into Escherichia coli BL21 (DE3); the plasmid pHZR01 is obtained by Gibson assembly of a pHZR11 linearized vector and a psiK gene fragment; the pHZR11 linearized vector is obtained by PCR amplifying the pHZR11 plasmid using RSF-2-F and RSF-2-R; the pHZR11 plasmid is obtained by Gibson assembly of a pRSFDuet-GmR linearized vector and psiM and BaTDC gene fragments; the psiK gene sequence is shown in SEQ ID NO.4 of the sequence listing; the pRSFDuet-GmR plasmid gene sequence is shown in SEQ ID NO.1 of the sequence listing; and the psiM gene sequence is shown in SEQ ID NO.2 of the sequence listing. The BaTDC gene sequence is shown in SEQ ID NO.3 of the sequence listing; the pHZR02 plasmid is obtained by Gibson assembly of a pET28a-KanR linearized vector and a trpsiH gene fragment; the sequence of the trpsiH gene fragment is shown in SEQ ID NO.12 of the sequence listing; the gene sequence of the pET28a-KanR plasmid is shown in SEQ ID NO.14 of the sequence listing; the plasmid pHZR03 is obtained by Gibson assembly of a pGro7 linearized vector and gene fragments of CPR and CYB5; the gene sequence of the pGro7 linearized vector is shown in SEQ ID NO.5 of the sequence listing; the CPR gene sequence is shown in SEQ ID NO.6 of the sequence listing; the gene sequence of the CYB5 gene is shown in SEQ ID NO.7 of the sequence listing; the plasmid pHZR04 is obtained by Gibson assembly of a pCDFDuet-Amp linearized vector and a nadK gene fragment; the gene sequence of the pCDFDuet-Amp linearized vector is shown in SEQ ID NO.8; the nadK gene sequence is shown in the sequence listing SEQ ID NO.9.

[0010] Furthermore, the transformed strain after knocking out the tnaA gene and trpR gene of Escherichia coli BL21 replaced Escherichia coli BL21; the gene sequence of the tryptophan decomposition gene tnaA is shown in the sequence listing SEQ ID NO.10; the gene sequence of the tryptophan negative feedback inhibition gene trpR is shown in the sequence listing SEQ ID NO.11.

[0011] Furthermore, plasmid pHZR12 replaced plasmid pHZR02; the plasmid pHZR12 was obtained by PCR amplifying the pHZR02 plasmid using 28a-trpsiH-F and 28a-trpsiH-R to obtain a pET28a-trpsiH linearized vector; the pET28a-trpsiH linearized vector and the T7-psiM gene fragment were mixed at the same time, and the pHZR12 plasmid was obtained by Gibson assembly; the gene sequence of the T7-psiM gene fragment is shown in SEQ ID NO.13 in the sequence listing.

[0012] The present invention also provides the use of engineered Escherichia coli in the fermentation production of psilocybin.

[0013] Furthermore, the fermentation medium is TB medium; the TB medium includes: 12g / L tryptone, 24g / L yeast extract, 4mL / L glycerol, 2.31g / L KH2PO4, and 12.54g / L K2HPO4.

[0014] Furthermore, the fermentation culture time is 42 hours.

[0015] Furthermore, the psilocybin production was 79.85±3.15 mg / L.

[0016] The present invention obtained a recombinant genetically engineered Escherichia coli strain, achieved the de novo synthesis of psilocybin, and successfully increased the psilocybin production to 79.85±3.15 mg / L by solving the problem of low expression and weak activity of eukaryotic P450 monooxygenase in prokaryotic cells, optimizing the P450 electron transport chain, and resolving the problems of insufficient tryptophan supply and excessive accumulation of unmethylated precursors. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0018] Figure 1 Figure 2 shows the protein expression of PsiH in the transformed strain.

[0019] Figure 2 The diagram shows the HPLC detection of products in the fermentation broth.

[0020] Figure 3 LC-MS product diagram is shown.

[0021] Figure 4 LC-MS product diagram is shown.

[0022] Figure 5 LC-MS product diagram is shown. DETAILED DESCRIPTION

[0023] All gene expression in the present invention is carried out on plasmid vectors. The proteins involved in the present invention are listed in Table 1. The plasmids constructed in the present invention are listed in Table 2. The strains constructed in the present invention are listed in Table 3. All primer sequences in the present invention are listed in Table 4.

[0024] Table 1 Proteins involved in this protocol

[0025] Table 1 The proteins used in this study

[0026]

[0027] Table 2 The plamids used in this study

[0028]

[0029]

[0030] Table 3 Strains used in this study

[0031] Table 3 The strains used in this study

[0032]

[0033]

[0034] Table 4 Primers involved in this study

[0035] Table 4 The genes used in this study

[0036]

[0037]

[0038]

[0039]

[0040]

[0041] Example 1:

[0042] Expression and activity detection of PsiH and chimeric proteins in Escherichia coli

[0043] 1. Acquisition of target fragments

[0044] (1) PCR amplification

[0045] 100 μL PCR amplification system: 1 μL template DNA, 4 μL 10 pM primers up-tnaA-F and up-tnaA-R, 50 μL 2× phanta buffer, 2 μL dNTP (2 mM), 2 μL DNA polymerase and 37 μL ddH2O.

[0046] The amplification system was subjected to 30 cycles of pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 sec, annealing at 55-72°C for 15 sec, extension at 72°C at 2 kb / min, and post-extension at 72°C for 5 min.

[0047] The PCR product was purified using the Kangwei Century Gel Extraction Kit to obtain the target fragment.

[0048] Gene fragments of psiH, SUMO-psiH, trpsiH, SUMO-trpsiH, 5144-trpsiH, SUMO-5144-trpsiH, and CPR, as well as the pGro7 linearized vector, were obtained by PCR amplification.

[0049] (2) Restriction enzyme digestion:

[0050] 50 μL enzyme digestion system: 20 μL plasmid DNA (5 μg), 5.0 μL restriction endonuclease 1, 5.0 μL restriction endonuclease 2, 10 μL 10* buffer, 60 μL ddH2O.

[0051] Select the appropriate enzyme digestion temperature according to the restriction endonuclease, and the digestion time is about 4 hours.

[0052] The fragments after enzyme digestion were purified using Kangwei Century Gel Extraction Kit to obtain the target fragment.

[0053] The pET28a plasmid was double-digested with NdeI and XhoI (Takara) in a 10×H buffer.

[0054] 2. Gibson assembly plasmid construction

[0055] (1) The connection system is as follows (refer to SE Seamleess Cloning and assembly kit)

[0056]

[0057]

[0058] (2) After the system is mixed, place it in a 37°C water bath or PCR instrument for 5-30 minutes, then transfer it to ice or store it at -20°C.

[0059] (3) Add the assembled system to 100 μL of DH5α competent medium, incubate on ice for 30 min, heat shock at 42°C for 90 sec, recover for 45 min, spread on a solid LB plate containing resistance, and culture at 37°C overnight.

[0060] (4) The pET28a vector after enzyme digestion was mixed with psiH, SUMO-psiH, trpsiH, SUMO-trpsiH, 5144-trpsiH and SUMO-5144-trpsiH gene fragments, and pHZR02, pHZR06, pHZR07, pHZR08, pHZR09 and pHZR10 plasmids were obtained by Gibson assembly.

[0061] The plasmid pHZR02 is obtained by Gibson assembly of the psiH gene fragment and the pET28a vector after enzyme digestion. The sequence of the psiH gene fragment is shown in SEQ ID NO.12 in the sequence listing.

[0062] The linearized pGro7 vector and the CPR gene fragment were mixed and assembled by Gibson to obtain the pHZR05 plasmid.

[0063] 3. Identification of Transformants

[0064] The UTAQ amplification system (10 μL) consisted of 1 μL bacterial culture as template, 0.5 μL each of 10 pM primers 1 and 2, 5 μL of 2*Utaq MIX buffer, and 3 μL of ddH2O. The system underwent 30 cycles of pre-denaturation at 94°C for 3 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C at 2 kb / min, and post-extension at 72°C for 5 minutes. PCR products were verified by 1% agarose gel electrophoresis.

[0065] 4. Expression of PsiH and chimeric proteins

[0066] (1) Plasmids pHZR02, pHZR06, pHZR07, pHZR08, pHZR09, and pHZR10 were added to 100 μL of BL21 competent cells, respectively. The cells were placed in an ice bath for 30 min, heat-shocked at 42°C for 90 sec, and recovered for 45 min. The cells were then spread on solid LB plates containing Kana and Chl resistances and cultured at 37°C overnight.

[0067] (2) The transformed E. coli strain was streaked on an LB solid plate for strain activation. A single colony was picked and cultured overnight in 3 mL of liquid LB medium containing Kana and Chl at 37°C and 220 rpm to obtain a seed solution. 1% of the bacterial solution was inoculated into 3 mL of LB and cultured at 37°C and 220 rpm until the OD 600 =0.4-0.6. Then, 0.1 mM IPTG and 500 μg / mL L-ara were added and cultured at 20°C and 220 rpm for 12 h.

[0068] (3) Centrifuge the bacterial suspension and remove the supernatant to collect the cells. Add 1 mL of PBS buffer (pH = 7.4) and mix thoroughly by pipetting. Ultrasonicate the suspension in an ice bath for 5 seconds, 8 seconds at a time, for a total of 20 cycles until the suspension becomes clear.

[0069] (4) Take 50 μL of whole cell solution and add 12 μL of 5*Loading Buffer, mix well by pipetting, boil for 10 min, centrifuge for 5 min, and take 20 μL for SDS-PAGE detection.

[0070] (5) The solution used for 12% SDS-polyacrylamide gel is as follows

[0071]

[0072] (6) Protein expression Figure 1 As shown in the figure, compared with the wild-type PsiH, the expression levels of PsiH proteins with a Sumo tag added to the N-terminus and replaced with the 5144C1NTD domain at the N-terminus were significantly improved; the Sumo tag was further added to 5144C1NTD-PsiH to further increase the expression level of PsiH; the expression level of truncated PsiH (trPsiH) was further improved; on the basis of truncated PsiH, the further addition of the Sumo tag can further increase the expression level of PsiH.

[0073] 5. PsiH and chimeric protein activity detection

[0074] (1) Plasmids pHZR02, pHZR06, pHZR07, pHZR08, pHZR09, pHZR10 and pHZR05 were added to 100 μL BL21 competent cells, incubated on ice for 30 min, heat-shocked at 42°C for 90 sec, and recovered for 45 min. After that, the cells were spread on solid LB plates containing Kana and Chl resistance and cultured at 37°C overnight.

[0075] (2) The transformed E. coli strain was streaked on an LB solid plate for strain activation. A single colony was picked and cultured overnight in 3 mL of liquid LB medium containing Kana and Chl at 37°C and 220 rpm to obtain a seed solution. 1% of the bacterial solution was inoculated into 100 mL of LB and cultured at 37°C and 220 rpm until the OD 600 =0.4-0.6. Then, 0.1 mM IPTG and 500 μg / mL L-ara were added and cultured at 20°C and 220 rpm for 15 h.

[0076] (3) The fermentation broth was concentrated to 1:50 (v / v), 500 μg / mL of the substrate tryptamine was added, and the culture was carried out at 20°C and 220 rpm for 24 h.

[0077] (4) Take 500 μL of the fermentation broth obtained in step (3), add 500 μL of methanol, mix well, and centrifuge to obtain the supernatant.

[0078] (5) Detect the product catalyzed by PsiH by HPLC.

[0079] HPLC was performed on a Waters 2695 system (USA) equipped with a C18 analytical column (Gemini 250×4.6 mm, particle size 5 μm; Phenomenex). The mobile phase flow rate was 1 mL / min, and the injection volume was 20 μL. The mobile phases A and B used for elution were acetonitrile supplemented with 0.1% (v / v) formic acid and water, respectively. The elution program was: 5% acetonitrile (0-1 min); 5-95% acetonitrile (1-12 min); 100% acetonitrile (12-15.5 min); and 5% acetonitrile (15.5-22 min).

[0080] (6) PsiH activity assay results: After expressing CPR, PsiH activity was achieved in E. coli. The activities of different PsiH chimeric proteins were positively correlated with their protein expression levels. Among them, the truncated PsiH (trPsiH) catalyzed the production of 4-hydroxytryptamine from tryptamine at a yield of 87.24 mg / mL, which was approximately 9.6 times higher than that of wild-type PsiH (PcPsiH) (p < 0.01).

[0081] Example 2:

[0082] De novo synthesis of psilocybin in Escherichia coli

[0083] 1. Construction of recombinant plasmid pHZR01

[0084] The pRSFDuet-GmR plasmid was amplified by PCR using RSF-1-F and RSF-1-R to obtain the pRSFDuet-GmR linearized vector. The pRSFDuet-GmR linearized vector was mixed with the psiM and BaTDC gene fragments at the same time, and the pHZR11 plasmid was obtained by Gibson assembly.

[0085] The gene sequence of the pRSFDuet-GmR plasmid is shown in the sequence table SEQ ID NO.1.

[0086] The psiM gene sequence is shown in the sequence listing SEQ ID NO.2.

[0087] The BaTDC gene sequence is shown in SEQ ID NO.3 in the sequence listing.

[0088] The pHZR11 plasmid was amplified by PCR using RSF-2-F and RSF-2-R to obtain the pHZR11 linearized vector. The pHZR11 linearized vector was mixed with the psiK gene fragment at the same time and the pHZR01 plasmid was obtained by Gibson assembly.

[0089] The psiK gene sequence is shown in the sequence listing SEQ ID NO.4.

[0090] 2. Transform the recombinant plasmid into E. coli BL21

[0091] Plasmids pHZR01, pHZR02, and pHZR05 were added to 100 μL of competent E. coli BL21, incubated on ice for 30 minutes, heat-shocked at 42°C for 90 seconds, and allowed to recover for 45 minutes. The plasmids were then plated on solid LB plates containing Kana, Chl, and GmR resistance proteins and cultured overnight at 37°C. This resulted in the construction of strain Strain03.

[0092] 3. Shake flask fermentation to produce psilocybin

[0093] (1) Streak the E. coli strain Strain03 on an LB solid plate for strain activation.

[0094] A single colony of Strain03 was picked and cultured in 3 mL of antibiotic-free liquid culture medium at 37°C and 220 rpm overnight to obtain seed solution.

[0095] Take 1% of the bacterial solution and inoculate it into 100 mL of LB, and culture it at 37°C and 220 rpm until the OD 600 =0.4-0.6.

[0096] Then, 0.1 mM IPTG and 500 μg / mL L-ara were added and cultured at 20° C. and 220 rpm for 24 h.

[0097] (2) Take 500 μL of the fermentation broth obtained in step 1, add 500 μL of methanol, mix well, and centrifuge to obtain the supernatant.

[0098] (3) Detection of psilocybin production by HPLC.

[0099] Analyze the sample using a Waters 2695 system (USA) equipped with a C18 analytical column (Gemini 250×4.6 mm, particle size 5 μm; Phenomenex). The mobile phase flow rate was 1 mL / min, and the injection volume was 20 μL. The mobile phases A and B used for elution were acetonitrile supplemented with 0.1% (v / v) formic acid and water, respectively.

[0100] The elution program was: 0-1 min 5% acetonitrile; 1-12 min 5-95% acetonitrile; 12-15.5 min 100% acetonitrile; 15.5-22 min 5% acetonitrile.

[0101] (4) LC-MS detection conditions: A C18 analytical column (Gemini 250×4.6 mm, particle size 5 μm; Phenomenex) was used, the mobile phase flow rate was 1 mL / min, and the injection volume was 20 μL.

[0102] The mobile phases A and B used for elution were acetonitrile and water with 0.1% (V / V) formic acid added, respectively.

[0103] The elution program was: 0-1 min 5% acetonitrile; 1-12 min 5-95% acetonitrile; 12-15.5 min 100% acetonitrile; 15.5-22 min 5% acetonitrile.

[0104] (5) HPLC test results are as follows Figure 2 As shown, the LC-MS detection results are as follows Figure 3 —5: When the precursor tryptophan was added, the production of psilocybin and the intermediates baeocystin and norbaeocystin was detected; however, when the precursor tryptophan was not added, the production of psilocybin and the intermediates was extremely low.

[0105] The results indicate that de novo synthesis of psilocybin was successfully achieved in Escherichia coli, and lay the foundation for pathway optimization and yield improvement.

[0106] Example 3:

[0107] Optimizing the P450 electron transport chain

[0108] 1. Construction of recombinant plasmids pHZR03 and pHZR04

[0109] The linearized pGro7 vector and the CPR (P450 reductase) and CYB5 (cytochrome B5) gene fragments were mixed simultaneously and assembled by Gibson to obtain the pHZR03 plasmid;

[0110] The gene sequence of the pGro7 linearized vector is shown in the sequence listing as SEQ ID NO.5.

[0111] The CPR gene sequence is shown in the sequence listing as SEQ ID NO.6.

[0112] The CYB5 gene sequence is shown in the sequence listing as SEQ ID NO.7.

[0113] Double enzyme digestion with BamHI and NotI was performed to obtain the linearized pCDFDuet-Amp vector. The linearized pCDFDuet-Amp vector and the nadK gene fragment were mixed at the same time and assembled by Gibson to obtain the pHZR04 plasmid.

[0114] The gene sequence of the pCDFDuet-Amp linearized vector is shown in the sequence table as SEQ ID NO.8.

[0115] The nadK gene sequence is shown in the sequence listing as SEQ ID NO.9.

[0116] 2. Transform the recombinant plasmid into E. coli BL21

[0117] Plasmids pHZR01, pHZR02, pHZR03, and pHZR04 were added to 100 μL of competent E. coli BL21 cells, incubated on ice for 30 minutes, heat-shocked at 42°C for 90 seconds, and allowed to recover for 45 minutes. The cells were then plated onto solid LB plates containing Kana, Chl, GmR, and Amp resistances and cultured overnight at 37°C. This resulted in the construction of strain Strain05.

[0118] 3. Test the optimization effect through fermentation and HPLC detection.

[0119] The results showed that overexpression of NAD+ kinase and cytochrome b5 could optimize the P450 electron transport chain and increase PsiH activity. The production of psilocybin in Strain 05 was 9.49 mg / L, a significant increase of 11.36 times.

[0120] Embodiment 4:

[0121] Optimizing the tryptophan biosynthesis pathway in Escherichia coli

[0122] 1. Construction of high-tryptophan-producing Escherichia coli strain Strain02

[0123] The Escherichia coli BL21 was gene-edited using CRISPR / Cas9 technology, and the tryptophan decomposition gene tnaA was knocked out to obtain the Escherichia coli Strain01 strain, and then the tryptophan negative feedback inhibition gene trpR was knocked out to obtain the Escherichia coli strain Strain02.

[0124] The gene sequence of the tryptophan decomposition gene tnaA is shown in the sequence table as SEQ ID NO.10.

[0125] The gene sequence of the tryptophan negative feedback inhibitory gene trpR is shown in the sequence table as SEQ ID NO.11.

[0126] 2. CRISPR / Cas9 gene knockout operation, taking the tnaA gene as an example

[0127] (1) Preparation of E. coli BL21 / pCas competent cells

[0128] Add the pCas plasmid to the BL21 competent cell, ice bath for 30 minutes, heat shock at 42°C for 90 seconds, and after recovery for 45 minutes, spread it on a solid LB plate containing 50μg / mL kanamycin (kana) and culture it at 30°C overnight. Pick a single colony of E. coli BL21 / pCas on the solid plate, culture it in 3mL of liquid culture medium containing 50μg / mL kana at 30°C and 220rpm overnight to obtain a seed solution. Take 1% of the bacterial solution and inoculate it into 100mL LB, add the inducer L-arabinose (L-ara) to a final concentration of 10mM, and culture it at 30°C and 220rpm until the OD 600 =0.6-0.9, wash the cells with 10% glycerol 4-5 times, remove the supernatant by centrifugation, add 1 mL of ice-cold 10% glycerol to resuspend the cells, and dispense 100 μL into each tube to obtain E. coli BL21 / pCas electroporation competent cells.

[0129] (2) Preparation of sgRNA

[0130] Potential off-target cleavage sites were designed and evaluated using the website http: / / crispor.tefor.net / crispor.py. Cleavage sites with high scores at different locations were selected. In the given sequence, TAAAGTCGCCGGTATCCGTG CGG was selected for sgRNA-1 targeting the tnaA gene, with CGG as the PAM site; ATCACCAGTAACTCTGCAGG TGG was selected for sgRNA-2 targeting the tnaA gene, with TGG as the PAM site. The target fragment containing N20 was amplified using primers sgRNA1-tnaA-F and sgRNA1-tnaA-R. The pTarget linearized vector fragment was amplified using primers pTarget1-tnaA-F and pTarget-R. The PCR product was purified using a Corning Gel Extraction Kit. The purified target fragment and vector fragment were assembled using the SE Seamleess Cloning and Assembly Kit to construct the plasmid pTarget-tnaA-1, which was derived from correct transformants.

[0131] The construction method of pTarget-tnaA-2 is the same as that of pTarget-tnaA-1.

[0132] (3) Preparation of Donor DNA

[0133] Using 1 μL of E. coli BL21 genomic DNA (10 μg / μL) as a template, 4 μL each of 10 pM primers up-tnaA-F and up-tnaA-R, 50 μL of 2× phanta buffer, 2 μL of 2 mM dNTPs, 2 μL of DNA polymerase, and 37 μL of ddH2O were added to create a 100 μL PCR amplification system. The amplification system underwent 30 cycles of pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 15 seconds, annealing at 57°C for 15 seconds, extension at 72°C for 15 seconds, and post-extension at 72°C for 5 minutes. The PCR product was purified using a Kangwei Century Gel Extraction Kit to obtain the upstream homology arm fragment.

[0134] The downstream homology arm amplification method is the same as the upstream homology arm amplification method.

[0135] Using 1 μL of each large upstream and downstream homology arms (10 μg / μL) as template, 4 μL of 10 pM primers (up-tnaA-F and down-tnaA-R), 50 μL of 2× phanta buffer, 2 μL of 2 mM dNTPs, 2 μL of DNA polymerase, and 36 μL of ddH2O were added to create a 100 μL PCR amplification system. The amplification system underwent 30 cycles of pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 15 seconds, annealing at 57°C for 15 seconds, extension at 72°C for 15 seconds, and post-extension at 72°C for 5 minutes. Overlap PCR amplification yielded donor DNA. The PCR product was purified using the Kangwei Century Gel Extraction Kit to obtain donor DNA.

[0136] (4) Gene knockout

[0137] Add 100 ng of pTarget plasmid and 400 ng of donor DNA to 100 μL of BL21 / pCas electroporation competent medium and electroporate at 2500 V, 25 μF, 200 Ω, 2 mm. Immediately after electroporation, add 1 mL of ice-cold LB and resuspend at 30°C, 220 rpm for 1 hour. Then, spread on LB plates containing 50 μg / mL kana and 50 μg / mL spec.

[0138] (5) Plasmid elimination

[0139] Colonies containing pCas and pTarget were inoculated onto a plate containing 50 μg / mL Kana and 0.5 mM rhamnose (L-rhamnose monohydrate). Incubated at 30°C, 220 rpm for 8 to 16 hours, diluted, and plated onto LB plates containing 50 μg / mL Kana. Colony cure was confirmed by measuring colony sensitivity to Spec. pTarget and pCas were eliminated by non-selectively growing colonies at 37°C overnight. Plasmid elimination was confirmed by colony replica plating.

[0140] (6) For subsequent gene knockout, refer to the tnaA gene knockout operation process.

[0141] 9. Construction of recombinant Escherichia coli Strain07

[0142] (1) Preparation of Escherichia coli Strain02 electroporation competent cells

[0143] Pick a single colony of E. coli Strain02 from a solid plate without antibiotics and culture it in 3 mL of liquid medium without antibiotics at 37°C and 220 rpm overnight to obtain seed solution. Take 1% of the bacterial solution and inoculate it in 100 mL of LB and culture it at 37°C and 220 rpm until the OD 600=0.4-0.6, wash the cells with 10% glycerol 4-5 times, remove the supernatant by centrifugation, add 1 mL of ice-cold 10% glycerol to resuspend the cells, and dispense 100 μL into each tube to obtain electroporation competent E. coli Strain02.

[0144] (2) Electroporation of the recombinant plasmid into the Strain07 strain

[0145] The constructed plasmids pHZR01, pHZR02, pHZR03, and pHZR04 were mixed into a 10 μL system and added to 100 μL of Strain02 electroporation competent medium. Electroporation was performed at 2500 V, 25 μF, 200 Ω, and 2 mm. Immediately after electroporation, 1 mL of ice-cold LB was added and the cells were reconstituted at 37°C, 220 rpm, and then plated onto LB plates containing 50 μg / mL Kana, 50 μg / mL Chl, 40 μg / mL Gm, and 100 μg / mL Amp. The cells were cultured overnight at 37°C. Single colonies were picked from the plates to obtain the recombinant E. coli Strain07.

[0146] (3) Test the optimization effect through fermentation and HPLC detection.

[0147] The results showed that by knocking out the key tryptophan synthesis gene tnaA and the negative feedback inhibition gene trpR, the synthesis pathway of the psilocybin precursor tryptophan can be optimized, and the ability of Escherichia coli to synthesize tryptophan itself can be improved. The production of psilocybin was 13.98 mg / L, an increase of 47.31%.

[0148] Example 5:

[0149] Optimizing the methylation step in the psilocybin synthesis pathway

[0150] 1. Construction of recombinant plasmid pHZR12

[0151] The pHZR02 plasmid was amplified using primers 28a-trpsiH-F and 28a-trpsiH-R to generate the pET28a-trpsiH linearized vector. The pET28a-psiM plasmid was amplified using primers T7-psiM-F and T7-psiM-R to generate the T7-psiM gene fragment. The pET28a-trpsiH linearized vector and the T7-psiM gene fragment were mixed and assembled by Gibson assembly to generate the pHZR12 plasmid.

[0152] The gene sequence of the T7-psiM gene fragment is shown in SEQ ID NO.13 in the sequence listing.

[0153] 2. Construction of recombinant Escherichia coli Strain 13

[0154] The constructed plasmids pHZR01, pHZR03, pHZR04, and pHZR12 were mixed into a 10 μL system and added to 100 μL of E. coli strain Strain02 for electroporation. Electroporation was performed at 2500 V, 25 μF, 200 Ω, and 2 mm. Immediately after electroporation, 1 mL of ice-cold LB was added and the cells were reconstituted at 37°C, 220 rpm, and then plated onto LB plates containing 50 μg / mL Kana, 50 μg / mL Chl, 40 μg / mL Gm, and 100 μg / mL Amp. The cells were cultured overnight at 37°C. A single colony was picked from the plate to identify the recombinant E. coli strain Strain13.

[0155] The optimization effect was tested through fermentation and HPLC detection.

[0156] The results showed that by increasing the copy number of the methyltransferase gene psiM, the accumulation of unmethylated precursors could be reduced, and the psilocybin production was 33.77 mg / L, an increase of 1.42 times.

[0157] Example 6:

[0158] Optimize culture conditions

[0159] 1. Culture medium optimization

[0160] Escherichia coli strain Strain13 was streaked on LB solid plates for strain activation.

[0161] A single colony of strain Strain 13 was picked and cultured overnight in 3 mL of liquid culture medium containing 50 μg / mL Kana, 50 μg / mL Chl, 40 μg / mL Gm, and 100 μg / mL Amp at 37°C and 220 rpm to obtain a seed solution.

[0162] 1% of the bacterial suspension was inoculated into 100 mL LB (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl) in a 250 mL conical flask, 100 mL LB (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl) in a 500 mL baffled shake flask, 100 mL LBG (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 20 g / L glucose) in a 500 mL baffled shake flask, and 100 mL TB medium (12 g / L tryptone, 24 g / L yeast extract, 4 mL / L glycerol, 2.31 g / L KH2PO4, 12.54 g / L K2HPO4) in a 500 mL baffled shake flask. The cells were cultured at 37 ° C and 220 rpm for 12 h until the OD reached 0.600 =0.4-0.6. Then, 0.1 mM IPTG and 500 μg / mL L-ara were added and cultured at 20°C and 220 rpm.

[0163] The production of psilocybin in the fermentation broth was measured every 6 h.

[0164] The yield of psilocybin in TB was the highest (79.40 mg / mL), which was 92.65% higher than that in LB medium.

[0165] 2. Optimization of culture time

[0166] E. coli strain Strain13 was inoculated into 3 mL of liquid culture medium and cultured overnight at 37°C and 220 rpm to obtain seed solution. 1% of the bacterial solution was inoculated into 100 mL of TB in a 500 mL baffled shake flask and cultured at 37°C and 220 rpm for 3 h until the OD 600 =0.4-0.6. 0.1 mM IPTG and 500 μg / mL L-ara were then added and cultured at 20°C and 220 rpm. The various products in the fermentation broth were measured every 6 h.

[0167] The production of psilocybin reached its highest level at 42 h, with a maximum of 79.85±3.15 mg / L.

[0168] References

[0169] [1]FERREIRA NR, VITORINO C, FORTUNA A. From antioxidant toneuromodulator: The role of ascorbate in the management of major depressiondisorder[J]. Biochem Pharmacol, 2022, 206: 115300.

[0170] [2]PEREZ-CABALLERO L,TORRES-SANCHEZ S,ROMERO-LOPEZ-

[0171] ALBERCA C,et al.Monoaminergic system and depression[J].Cell TissueRes,

[0172] 2019,377(1):107-13.

[0173] [3]TYLS F,PALENICEK T,HORACEK J.Psilocybin--summary of knowledge andnew perspectives[J].Eur Neuropsychopharmacol,2014,24(3):342-56.

[0174] [4]ROSS S,BOSSIS A,GUSS J,et al.Rapid and sustained symptom reductionfollowing psilocybin treatment for anxiety and depression in patients withlife-

[0175] threatening cancer:a randomized controlled trial[J].JPsychopharmacol,2016,

[0176] 30(12):1165-80.

[0177] [5]GRIFFITHS R R,JOHNSON M W,CARDUCCI M A,et al.Psilocybin producessubstantial and sustained decreases in depression and anxiety in patientswith life-threatening cancer:A randomized double-blind trial[J].JPsychopharmacol,2016,30(12):1181-97.

[0178] [6]GARTZ J.BIOTRANSFORMATION OF TRYPTAMINE DERIVATIVES IN MYCELIALCULTURES OF PSILOCYBE[J].JOURNAL OF BASIC MICROBIOLOGY,1989,29(6):347-52.

[0179] [7]CARHART-HARRIS R L,BOLSTRIDGE M,RUCKER J,et al.Psilocybin withpsychological support for treatment-resistant depression:an open-labelfeasibility study[J].Lancet Psychiatry,2016,3(7):619-27.

[0180] [8]STUDERUS E,KOMETER M,HASLER F,et al.Acute,subacute and long-

[0181] term subjective effects of psilocybin in healthy humans:a pooledanalysis of experimental studies[J].J Psychopharmacol,2011,25(11):1434-52.

[0182] [9]HOFMANN A,FREY A,OTT H,et al.KONSTITUTIONSAUFKLARUNG UND SYNTHESEVON PSILOCYBIN[J].EXPERIENTIA,1958,14(11):397-9.

[0183]

[10] KARGBO R B,SHERWOOD A,WALKER A,et al.Direct Phosphorylation ofPsilocin Enables Optimized cGMP Kilogram-Scale Manufacture of Psilocybin[J].ACS Omega,2020,5(27):16959-66.

[0184]

[11] FRICKE J,BLEI F,HOFFMEISTER D.Enzymatic Synthesis of Psilocybin[J].

[0185] Angew Chem Int Ed Engl,2017,56(40):12352-5.

[0186]

[12] HOEFGEN S,LIN J,FRICKE J,et al.Facile assembly and fluorescence-based screening method for heterologous expression of biosynthetic pathwaysin fungi

[0187] [J].Metab Eng,2018,48:44-51.

[0188] In vivo production of psilocybinin E.coli[J].Metab Eng,2019,56:111-9

[0189]

[14] MILNE N,THOMSEN P,MOLGAARD ​​KNUDSEN N,et al.Metabolic engineeringof Saccharomyces cerevisiae for the de novo production of psilocybin andrelated tryptamine derivatives[J].Metab Eng,2020,60:25-36.

[15] Introduction to the Proceedings of the Proceedings of the Developing Processing of Chemical Engineering [D] and the National Chemical Society, 2022.

[16] FLOWER JE,GIBBONS WJ,JR.,ADAMS AM,et al."Biosynthesis of psilocybin and its nonnatural derivatives by promiscuous psilocybin synthesis pathway in Escherichia coli"[J].BiotechnolBioeng,2023,120(8):2214-29.

[17] JIANG Y,CHEN B,DUAN C,et al.Multigene Editing of the Escherichia coli Genome Via the CRISPR-Cas9 System[J].Applied andEnvironmental Microbiology,2015,81(7):2506-14.

Claims

1. An engineered Escherichia coli, characterized in that: Plasmids pHZR01, pHZR02, pHZR03, and pHZR04 were transformed into Escherichia coli BL21; The plasmid pHZR01 is obtained by Gibson assembly of the pHZR11 linearized vector and the psiK gene fragment; the pHZR11 linearized vector is obtained by PCR amplification of the pHZR11 plasmid using RSF-2-F and RSF-2-R; the pHZR11 plasmid is obtained by Gibson assembly of the pRSFDuet-GmR linearized vector and the psiM and BaTDC gene fragments; the psiK gene sequence is shown in the sequence listing SEQ ID NO.4; the pRSFDuet-GmR plasmid gene sequence is shown in the sequence listing SEQ ID NO.

1. The psiM gene sequence is shown in the sequence listing SEQ ID NO.

2. The BaTDC gene sequence is shown in the sequence listing SEQ ID NO.3; The pHZR02 plasmid is obtained by Gibson assembly of the pET28a-KanR linearized vector and the trpsiH gene fragment; the sequence of the trpsiH gene fragment is shown in the sequence listing as SEQ ID NO.12; the gene sequence of the pET28a-KanR plasmid is shown in the sequence listing as SEQ ID NO.14; The plasmid pHZR03 is obtained by Gibson assembly of the pGro7 linearized vector and the CPR and CYB5 gene fragments; the gene sequence of the pGro7 linearized vector is shown in SEQ ID NO.5 of the sequence listing; the CPR gene sequence is shown in SEQ ID NO.6 of the sequence listing; and the CYB5 gene sequence is shown in SEQ ID NO.7 of the sequence listing; The plasmid pHZR04 is obtained by Gibson assembly of the pCDFDuet-Amp linearized vector and the nadK gene fragment; the gene sequence of the pCDFDuet-Amp linearized vector is shown in the sequence list SEQ ID NO.8; the nadK gene sequence is shown in the sequence list SEQ ID NO.

9.

2. The engineered Escherichia coli according to claim 1, characterized in that: The transformed strain after knocking out the tnaA gene and trpR gene of Escherichia coli BL21 was used to replace Escherichia coli BL21; The gene sequence of the tryptophan decomposition gene tnaA is shown in the sequence listing SEQ ID NO.10; The gene sequence of the tryptophan negative feedback inhibitory gene trpR is shown in the sequence table as SEQ ID NO.

11.

3. The engineered Escherichia coli according to claim 2, characterized in that Plasmid pHZR12 replaced plasmid pHZR02; The plasmid pHZR12 is prepared by PCR amplifying the pHZR02 plasmid using 28a-trpsiH-F and 28a-trpsiH-R to obtain a pET28a-trpsiH linearized vector; the pET28a-trpsiH linearized vector is mixed with the T7-psiM gene fragment and assembled by Gibson to obtain the pHZR12 plasmid; The gene sequence of the T7-psiM gene fragment is shown in SEQ ID NO.13 in the sequence listing.

4. Use of the engineered Escherichia coli according to any one of claims 1 to 3 in the fermentation production of psilocybin.

5. The use of the engineered Escherichia coli according to claim 4 in the fermentation production of psilocybin, characterized in that: The fermentation medium is TB medium; The TB culture medium includes: 12 g / L tryptone, 24 g / L yeast extract, 4 mL / L glycerol, 2.31 g / L KH2PO4, and 12.54 g / L K2HPO4.

6. The use of the engineered Escherichia coli according to claim 4 in the fermentation production of psilocybin, characterized in that: The fermentation culture time is 42 hours.

7. The use of the engineered Escherichia coli bacteria according to claim 4 in the fermentation production of psilocybin, characterized in that: The psilocybin production was 79.85±3.15 mg / L.

Images