Pancreatic cancer treatment target aiming at ECHS1 K115 site and application

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a pancreatic cancer treatment target aiming at an ECHS1 K115 site and application. Experiments show that the level of 115-site lysine succinylation modification (ECHS1 K115su) of ECHS1 protein is remarkably reduced in pancreatic cancer tumors, and existence of the modification is confirmed through a specific succinylation modified antibody for the first time. It is further found that K115 succinylation modification can mediate the conversion efficiency of ECHS1 protein to a substrate of the K115 succinylation modification so as to inhibit oxidative metabolism of pancreatic cancer cell fatty acid beta, and in-vivo and in-vitro functional experiments prove that ECHS1 K115 succinylation modification inhibits proliferation of pancreatic cancer tumor cells and tumor volume increase.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a pancreatic cancer therapeutic target targeting the ECHS1 K115 site and its application. Background Art

[0002] Pancreatic cancer is one of the most common and aggressive malignancies, with an extremely low five-year survival rate, far lower than other common digestive system cancers such as gastric cancer and colorectal cancer. Due to nonspecific early symptoms and ineffective screening tools, most patients are diagnosed at an advanced stage. Pancreatic cancer is divided into two types: pancreatic ductal adenocarcinoma (PDAC), which accounts for over 90% of cases, and rare endocrine tumors that arise from pancreatic islet cells. Major risk factors include smoking, chronic pancreatitis, diabetes, and a family history of pancreatic cancer, while genetic predisposition, such as BRCA1 / 2 and PALB2 mutations, further increases susceptibility. Pancreatic cancer progression involves diverse genetic alterations, including activating mutations in oncogenes such as rat sarcoma viral oncogene homolog (KRAS), and inactivation of tumor suppressor genes such as tumor protein p53 (TP53) and cyclin-dependent kinase inhibitor 2A (CDKN2A). Despite advances in surgical intervention, chemotherapy, and targeted therapies, the prognosis remains grim due to the late diagnosis and high metastatic rate of pancreatic cancer. Therefore, by conducting in-depth research on the molecular mechanisms of pancreatic cancer occurrence and development and finding potential diagnostic and therapeutic targets, more targeted drugs can be developed to improve treatment outcomes.

[0003] Post-translational modifications (PTMs) include glycosylation, ubiquitination, succinylation, acetylation, phosphorylation, palmitoylation, lactylation, and other protein modifications. PTMs occur at various amino acid side chains or peptide bonds and are typically mediated by proteases. Over 200 enzymes associated with PTMs are found in 5% of the proteome. These enzymes, including kinases, phosphatases, transferases, proteases, and ligases, add or remove functional groups, proteins, lipids, or sugars from amino acid side chains. Many proteins can also self-modify using autocatalytic domains, such as autokinases and autoproteolytic domains. Protein modifications influence nearly every aspect of cell biology and pathology. PTMs play important roles in cellular metabolism, signal transduction, protein degradation, DNA replication regulation, stress responses, and are associated with drug resistance. Succinylation occurs by transferring the succinyl group (-CO-CH2-CH2-CO2H) from succinyl-CoA to a lysine residue. Protein succinylation can change the charge state of unmodified lysine residues from positive (+1) to negative (-1) at physiological pH (7.4), thereby having a greater impact on protein structure and function. It is worth noting that compared to lysine acetylation, succinylation transfers a relatively large mass (100 kDa) to the protein residue. Therefore, the change in charge and mass caused by succinylation may have a more significant impact on protein function.

[0004] Short-chain enoyl-CoA hydratase 1 (ECHS1, located on human chromosome 10q26.2-q26.3 and comprising eight exons), is primarily located in mitochondria, catalyzing mitochondrial fatty acid oxidation. It is composed of 299 amino acids. Mutations in this gene are known to cause mitochondrial diseases, leading to abnormal ATP synthesis and insufficient energy sources, thus impairing the normal function of multiple systems. Studying the biological role of ECHS1 succinylation in cancer and its related mechanisms is expected to provide new targets for the diagnosis and treatment of pancreatic cancer. Summary of the Invention

[0005] This study, using an integrated succinylomic analysis of pancreatic cancer tumors, revealed that succinylation at lysine 115 of short-chain enoyl-CoA hydratase 1 (ECHS1) is significantly decreased in pancreatic cancer tissue. ECHS1 is a key mitochondrial enzyme involved in the fatty acid β-oxidation pathway and is crucial for fatty acid metabolism and energy production in cells. Studying the biological role of ECHS1 succinylation in cancer and its associated mechanisms is expected to provide new targets for the diagnosis and treatment of pancreatic cancer.

[0006] In order to make up for the deficiencies of the prior art, the present invention provides a target for pancreatic cancer tumor treatment and its application.

[0007] The present invention is achieved through the following technical solutions: In a first aspect, the present invention provides a target for pancreatic cancer tumor treatment, wherein the target is succinylated modification of lysine 115 of ECHS1, ECHS1 K115su.

[0008] In a second aspect, the present invention provides the use of ECHS1 K115su, a succinylated modification of lysine at position 115 of ECHS1, as a target in the preparation of a drug for treating pancreatic cancer.

[0009] In a third aspect, the present invention provides the use of a reagent for detecting the expression level of ECHS1 K115su, a succinylated modification of lysine 115 of ECHS1, in the preparation of a pancreatic cancer tumor diagnostic product.

[0010] Succinylation modification of lysine 115 of ECHS1 can mediate the conversion efficiency of ECHS1 protein to its substrate, thereby inhibiting the fatty acid β-oxidation metabolism of pancreatic cancer cells, thereby inhibiting the proliferation of pancreatic cancer cells and the growth of tumor volume.

[0011] In a fourth aspect, the present invention provides an antigenic peptide of the pancreatic cancer tumor treatment target ECHS1 K115su, wherein the antigenic peptide sequence of the target ECHS1 K115su is: Su-2:CYSS-(Su)K-FLKHWDHL.

[0012] In a fifth aspect, the present invention provides use of an antigenic peptide targeting ECHS1 K115su in the preparation of a drug for preventing or treating tumors.

[0013] Compared with existing technologies, the present invention is beneficial in that it experimentally discovered that the level of succinylation modification of lysine 115 of the ECHS1 protein (ECHS1 K115su) is significantly reduced in pancreatic cancer tumors, and for the first time confirmed the presence of this modification using a specific succinylation antibody. It was further discovered that K115 succinylation can mediate the conversion efficiency of ECHS1 protein to its substrates, thereby inhibiting fatty acid β-oxidation metabolism in pancreatic cancer cells. In vitro and in vivo functional experiments confirmed that ECHS1 K115 succinylation modification inhibits pancreatic cancer cell proliferation and tumor volume growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The present invention will be further described below with reference to the accompanying drawings.

[0015] Figure 1 The succinylation modification genomics analysis of pancreatic cancer revealed that the abundance of ECHS1 lysine 115 succinylation (ECHS1K115su) was significantly reduced in pancreatic cancer cells; Figure 1Middle A is a graph showing the analysis of succinylation modification levels of ECHS1 K115 in pancreatic cancer succinylomics data; Figure 1 Middle B is a representative MS / MS image of succinylation modification of ECHS1 K115; Figure 2 The mass spectra of ECHS1 K115 succinylated modified peptide and non-modified peptide; Figure 2 A in the middle is the mass spectrum of Su-1 antigen polypeptide, Figure 2 B in the middle is the mass spectrum of Su-2 antigen polypeptide. Figure 2 Middle C is the mass spectrum of the control peptide Su-3, Figure 2 D in the middle is the mass spectrum of the unmodified control peptide Su-4; Figure 3 For the analysis of succinylated modified antibodies and ECHS1 protein; Figure 3 Figure A in the middle is the specificity validation analysis of the ECHS1 K115 succinylated modified antibody. Figure 3 Middle B is the position analysis of K115 site in the predicted small molecule binding pocket of ECHS1 protein; Figure 3 Middle C is the position analysis of K115 site in the ECHS1 protein domain; Figure 4 To verify the succinylation modification of ECHS1 K115 in pancreatic cancer cell lines; Figure 4 Figure A shows the presence of succinylation modification at the ECHS1 K115 site by detecting IgG and HA in Hs766T (Hs766T is a human pancreatic cancer cell line). Figure 4 Figure B shows the presence of succinylation modification at ECHS1K115 site by detecting IgG and HA in PANC-1 (PANC-1 is a human pancreatic cancer cell line). Figure 4 Middle C is the verification of succinylation modification at ECHS1 K115 site by detecting HA in Hs766T. Figure 4 Middle D is the verification of succinylation modification at ECHS1 K115 site by detecting HA in PANC-1; Figure 5 To confirm that K115 site is the key site analysis for succinylation modification of ECHS1 protein; Figure 5 A in the middle is that the K115 site is confirmed by Hs766T to be the key site for succinylation modification of ECHS1 protein. Figure 5 Middle B is the confirmation by PANC-1 that K115 site is the key site for succinylation modification of ECHS1 protein; Figure 6 This is a map of the construction and analysis of ECHS1 knockout and K115 succinylation modification deletion cell lines; Figure 6Middle A is Western blot verification of ECHS1 knockout efficiency in pancreatic cancer cell lines; Figure 6 Middle B is the ECHS1 expression level analysis graph detected by Western blot experiment in ECHS1 knockout cell lines after wild-type ECHS1 or its mutant K115R was complemented respectively; Figure 7 This is an analysis of the effect of ECHS1 K115 succinylation deletion on pancreatic cancer tumor development; Figure 7 A and B in the middle are the effects of ECHS1 K115 succinylation deletion on the proliferation ability of pancreatic cancer cells detected by CCK8 assay. Figure 7 Middle C and D are clone formation experiments to detect the effect of ECHS1 K115 succinylation modification on cell proliferation; Figure 8 To detect the effect of ECHS1 K115su deletion on the migration ability of pancreatic cancer cells by Transwell assay; Figure 8 A and B in the middle are the effects of ECHS1 K115su deletion on the migration ability of pancreatic cancer cells detected by Hs766T. Figure 8 C and D show the effect of ECHS1 K115su deletion on the migration ability of pancreatic cancer cells detected by PANC-1; Figure 9 Nude mice were subcutaneously injected with ECHS1 K115 succinylation-deficient and corresponding control cell lines. The tumor volume was measured during the growth process. About one month later, the tumors were removed, photographed, and the tumor weight and volume were measured for analysis. Figure 9 A in the middle is a photo of the tumor. Figure 9 B in the middle is tumor volume analysis, Figure 9 Middle C is tumor weight analysis; Figure 10 To conduct targeted metabolomics analysis to detect the effect of ECHS1 K115 succinylation on intracellular metabolites; Figure 10 A in the figure is a scatter plot of principal component analysis (PCA). Figure 10 Middle B is the heat map of differential expression analysis of ECHS1 protein wild type (WT) and K115R mutant (K115R) samples. Figure 10 Middle C is the result diagram of ECHS1 metabolic pathway enrichment analysis (Pathwayanalysis), Figure 10 Middle D is the heat map of differential expression of metabolites between wild-type (WT) and ECHS1 K115R mutant samples; Figure 11 This is a metabolic flux analysis of the effect of ECHS1 K115 succinylation modification on fatty acid and tricarboxylic acid cycle metabolism; Figure 11A in the middle is a metabolic flow chart related to fatty acid oxidation (FAO) and tricarboxylic acid cycle (TCA cycle). Figure 11 B in the figure shows the relative abundance of ¹³C-labeled acetyl-CoA in different samples. Figure 11 C in the middle is the relative abundance of ¹³C-labeled citric acid in different samples. Figure 11 D in the middle is the relative abundance of ¹³C-labeled isocitrate in different samples. Figure 11 Figure E shows the relative abundance of ¹³C-labeled fumarate in different samples; Figure 12 To analyze the effect of succinylation modification at the K115 site on the binding of ECHS1 protein to its substrate and the release of the product; Figure 12 A in the middle is a schematic diagram of the ECHS1 structure whose binding substrate is trans-Δ2-enoyl-CoA. Figure 12 Figure B is a schematic diagram of the ECHS1 K115su structure with trans-Δ2-enoyl-CoA as its binding substrate. Figure 12 Figure C is a schematic diagram of the ECHS1 structure whose binding substrate is 3-hydroxyacyl-CoA. Figure 12 D in the figure is a schematic diagram of the structure of ECHS1K115su whose binding substrate is 3-hydroxyacyl-CoA. Figure 12 E in the middle is the PMF energy diagram of the dissociation process of the substrate from the unmodified ECHS1 protein and the ECHS1 protein with succinylation at K115 site. Figure 12 Figure F is the PMF energy diagram of the product dissociation process from the binding pocket of the unmodified ECHS1 protein and the ECHS1 protein modified by succinylation at the K115 site. DETAILED DESCRIPTION

[0016] The present invention will be further described below with reference to the accompanying drawings.

[0017] Example 1 Analysis of ECHS1 succinylation modification using the pancreatic cancer succinylation database (the pancreatic cancer succinylation modification database was commissioned by Hangzhou Jingjie Biotechnology Co., Ltd.) Protein Extraction: Fifteen pairs of pancreatic cancer tissues and their corresponding adjacent adjacent tissues were removed from a -80°C freezer. Appropriate amounts of sample were weighed into a liquid nitrogen-cooled mortar and pestle and thoroughly ground into a powder. Four volumes of lysis buffer (1% sodium dodecyl sulfate (SDS), 1% protease inhibitors, 3 μM Trichostatin A (TSA), 50 mM nicotinamide (NAM)) were added to each sample and sonicated. The samples were centrifuged at 12,000 g for 10 min at 4°C. The supernatant was transferred to a fresh tube and protein concentration was determined using a Bicinchoninic Acid Assay (BCA) kit.

[0018] Trypsin digestion: Equal amounts of each protein sample (15 pairs of protein samples extracted from pancreatic cancer tissue) were digested with lysis buffer. The volume was adjusted to the same value. One volume of pre-chilled acetone was added, vortexed, and then four volumes of pre-chilled acetone were added. The mixture was precipitated at -20°C for 2 h. Centrifuged at 4500 g for 5 min, the supernatant discarded, and the pellet washed twice with pre-chilled acetone. After air drying, tetraethylammonium bromide (TEAB) was added to a final concentration of 200 mM. The pellet was sonicated and disrupted. Trypsin was then added at a ratio of 1:50 (protease:protein, m / m) and digested overnight. Dithiothreitol (DTT) was added to a final concentration of 5 mM, and the mixture was reduced at 56°C for 30 min. Iodoacetamide (IAA) was then added to a final concentration of 11 mM. The mixture was incubated at room temperature in the dark for 15 min.

[0019] Modification enrichment: IP peptides were dissolved in immunoprecipitation buffer (100 mM NaCl, 1 mM EDTA, 50 mM Tris-HCl, 0.5% NP-40, pH 8.0). The supernatant was transferred to pre-washed succinylated resin (Antibody Resin Product No. (PTM-402), from Hangzhou Jingjie Biotechnology Co., Ltd., PTM Bio). The resin was incubated overnight at 4°C on a rotary shaker with gentle agitation. After incubation, the resin was washed four times with IP buffer and twice with deionized water. Finally, the resin-bound peptides were eluted three times with 0.1% trifluoroacetic acid. The eluate was collected and freeze-dried under vacuum. After drying, the resin was desalted according to the C18 ZipTips instructions and freeze-dried under vacuum for LC-MS / MS analysis.

[0020] Liquid chromatography-mass spectrometry analysis: Peptides were dissolved in liquid chromatography mobile phase A and separated using a NanoElute ultra-high performance liquid chromatography system. Mobile phase A consisted of 0.1% formic acid and 2% acetonitrile in water; mobile phase B consisted of 0.1% formic acid and 100% acetonitrile. The gradient was set as follows: 7% to 24% B (0-42 min); 24% to 32% B (42-54 min); 32% to 80% B (54-57 min); and 80% B (57-60 min). The flow rate was maintained at 450 nL / min. After separation by the ultra-high performance liquid chromatography system, the peptides were injected into the Capillary ion source for ionization and analyzed by the timsTOF Pro mass spectrometer. The ion source voltage was set to 1.6 kV. The peptide precursor ions and their secondary fragments were detected and analyzed using a high-resolution time-of-flight (TOF) system. The secondary mass spectrometer scan range was set to 100–1700. Data acquisition was performed in parallel accumulation serial fragmentation (PASEF) mode. Following a primary mass spectrum, 10 secondary spectra were acquired in PASEF mode for precursor ion charge ranges of 0–5. The dynamic exclusion time for the tandem mass spectrometry scan was set to 30 s to avoid repeated scanning of precursor ions.

[0021] Mass Spectrometry Data Search: The acquired MS and MS / MS data were searched against the human SwissProt database (20,422 entries) using the MaxQuant search engine (version 1.6.15.0). Search parameters included the proteolytic enzyme trypsin and allowed for up to two missed cleavage sites. The precursor ion tolerance was set to 20 ppm, the main search peptide tolerance to 5 ppm, and the mass tolerance for fragment ions to 0.02 Da. Carbamidomethylation on Cys was designated as a fixed modification, while acetylation at the protein N-terminus and oxidation on Met were designated as variable modifications. For analysis of lysine succinylation (Ksu) peptide enrichment data, lysine succinylation was included as a variable modification. False discovery rates (FDRs) for peptide-spectrum matching, site identification, and protein identification were set to <1%.

[0022] Succinylation-modification omics analysis: Ksu peptide levels were calculated based on raw spectral intensities. A database containing all succinylated peptides was constructed and normalized according to their protein abundance to exclude changes in Ksu peptide levels caused by protein level dynamics. Differences between pancreatic cancer and adjacent paracancerous tissues were compared.

[0023] Development of a specific antibody targeting the succinylated modification of ECHS1 K115 (commissioned to Hangzhou Jingjie Biotechnology Co., Ltd.) 1. Immunogen design: Based on the protein sequence and succinylation modification, two succinylated modified antigen peptides were designed and synthesized (ECHS1 K115 succinylated modified peptide and non-modified peptide mass spectra are shown in Figure 2). Figure 2 As shown in the figure, the antibody was used for animal immunization, purification and detection. At the same time, a succinylated modified control peptide and a non-modified control peptide were designed and synthesized for purification and detection. At the same time, the four synthesized immunogenic peptides were detected by mass spectrometry. After multiple immunizations, a small amount of serum was taken from 6 SPF experimental grade New Zealand white rabbits for ELISA detection to preliminarily evaluate the titer and specificity of the antiserum. 2. Antibody quality control: A sufficient amount of rabbit serum was taken for affinity purification of Protein A and immunogenic peptide columns. The purified antibodies were first tested by ELISA, DotBlot and Western blot. (1) Antibody ELISA detection: In a 96-well enzyme-labeled plate coated with antigen-modified peptides and control peptides, antibodies were added and incubated at different dilution ratios. Then, enzyme-labeled secondary antibody and TMB substrate were applied to detect the binding of peptide and antibody; (2) Antibody Dot blot detection: different doses of modified peptide and non-modified peptide were fixed on the solid phase membrane, incubated with antibody, and then enzyme-labeled secondary antibody and chemiluminescent substrate were added to detect the binding of peptide and antibody. The results are as follows Figure 1 As shown in the figure, it can be seen that: this example found that ECHS1 K115 position has succinylation modification, and its abundance is significantly reduced in pancreatic cancer.

[0024] In this embodiment, Figure 3 In Figure A, the prepared ECHS1 K115su antibody was specifically detected. HeLa and MCF-7 cells were treated with drugs suramin (40 μM, 7 h) + SBA (5 mM, 7 h) + succinic acid (30 μM, 16 h) (the drug can induce increased succinylation modification), and the above-prepared antibodies were used to detect the succinylation modification levels of ECHS1K115 in the above cells.

[0025] Example 2 Validation of ECHS1 lysine 115 succinylation modification (ECHS1 K115su) in pancreatic cancer cells I. Construction of lentiviral overexpression plasmids expressing wild-type ECHS1 and its K115 mutation fused to an HA tag: Forward and reverse primers were designed based on the CDS sequence (forward primer: ATGGCCGCCCTGCGTGTCCTG; reverse primer: CTGGTCTTTGAAGTTGGCCTTTCTC). The ECHS1 expression sequence was amplified by PCR and ligated into the pcDNA6B-HA vector to generate the pcDNA6B-HA-ECHS1 plasmid expressing ECHS1. Separately, point mutation primers were designed (forward primer: GACTGTTACTCCAGCCGGTTCTTGAAGC and reverse primer: CCGGCTGGAGTAACAGTCCTGGAAACTC) to mutate lysine 115 of ECHS1 to arginine, constructing the ECHS1 K115 mutation plasmid pcDNA6B-HA-ECHS1-K115R.

[0026] Verification of succinylation of lysine 115 of ECHS1 in pancreatic cancer cells: Pancreatic cancer cells were transfected with the ECHS1-expressing plasmid pcDNA6B-HA-ECHS1 or a control empty vector plasmid. The cells were treated with 5 mM succinate for 24 hours. ECHS1 protein was enriched by co-immunoprecipitation. The cells were lysed with RIPA buffer (Beyotime, P0013D), and total protein was extracted. Sepharose beads conjugated with HA antibody (Sigma-Aldrich, A2095) were added to the beads and incubated overnight at 4°C. The beads were gently washed with PBS (pH 7.4), and the proteins were separated by SDS-PAGE (polyacrylamide gel electrophoresis). The level of ECHS1 succinylation in these cells was detected using a pan-succinylation antibody.

[0027] 3. Confirmation that K115 is the key site for succinylation modification of ECHS1: ECHS1K115 succinylation modification-deficient and control cells were treated with 5 mM succinic acid for 24 hours, and the above cell lines were lysed using RIPA strong lysis buffer, and total protein was extracted. The cells were incubated overnight with HA antibody-coupled agarose beads (Sigma-Aldrich, A2095), gently washed with PBS buffer, and changes in the level of ECHS1 succinylation modification were detected by Western blot experiments.

[0028] The results are as follows Figure 4-5 As shown in the figure, it can be seen that ECHS1 is succinylated in pancreatic cancer cell lines, and K115 is the key site for succinylation of ECHS1.

[0029] Figure 4Figure A shows pancreatic cancer cells exogenously transfected with ECHS1. The cell lines were treated with 5 mM succinate for 24 hours, and exogenous ECHS1 was enriched by immunoprecipitation. Its succinylation modification was then verified using a pan-succinylation antibody. Figure 4 Middle B shows exogenously transferred ECHS1 into pancreatic cancer cells, and exogenous ECHS1 was enriched by immunoprecipitation. The effect of succinate treatment on the succinylation level of ECHS1 was detected using a pan-succinylation antibody. Figure 5 Figures A and B show pancreatic cancer cells exogenously transfected with ECHS1 or its mutant K115R. The cell lines were treated with 5 mM succinate for 24 hours, and exogenous ECHS1 and its mutant K115R were enriched by immunoprecipitation. The succinylation modification levels of exogenous ECHS1 in the cell lines were detected using a pan-succinylation modification antibody.

[0030] Example 3 Construction of ECHS1 knockout and K115 succinylation-deficient cell lines 1. Construction of ECHS1 knockout plasmid based on CRISPR-Cas9 technology: According to the analysis of the conserved structural functional domains of ECHS1 protein, the following three sgRNA sequences were designed: 5'-CACCGCCCTCAATGCACTTTGCGA-3', 5'-CACCGGAGGCCTTATCCCCGCCGGTG-3', 5'-CACCGATCCAACTGAACCGCCCCA-3'. The above sequences were annealed and ligated into the PX330 vector to construct pX330-U6-gRNA-Cas9 knockout plasmids.

[0031] Second, the ECHS1 knockout plasmid constructed above was co-transfected into pancreatic cancer cells. After 48 hours, G418 (Beyotime, ST081) was added to select the cells. GFP-positive cells were further sorted by flow cytometry and seeded into 96-well plates at a density of one cell per well. After colonies grew, the cells were harvested and lysed, and the ECHS1 knockout efficiency was detected by Western blot.

[0032] Third, construct lentiviral overexpression plasmids expressing wild-type ECHS1 and its K115 mutation fused to a GFP tag: Forward and reverse primers were designed based on the CDS sequence (forward primer: ATGGCCGCCCTGCGTGTCCTG; reverse primer: CTGGTCTTTGAAGTTGGCCTTTCTC). The ECHS1 expression sequence was amplified by PCR and ligated into the pLVX-GFP vector to generate the ECHS1-expressing lentiviral plasmid pLVX-GFP-ECHS1. Separately, point mutation primers were designed (forward primer: GACTGTTACTCCAGCCGGTTCTTGAAGC and reverse primer: CCGGCTGGAGTAACAGTCCTGGAAACTC) to mutate lysine 115 of ECHS1 to arginine, constructing the plasmid pLVX-GFP-ECHS1K115R, which lacks the succinylation modification at K115 of ECHS1.

[0033] IV. Construction of an ECHS1 K115 succinylation-deficient cell line: HEK293T cells were plated in a 10 cm dish and allowed to reach 70-80% confluency. The target plasmids (pLVX-GFP-ECHS1 and pLVX-GFP-ECHS1K115R) were dissolved in 1.5 ml of Opti-MEM medium at a ratio of 12 μg: 9 μg: 3 μg of PSPAX2:PMD2G. Separately, 72 μl of PEI reagent was dissolved in 1.5 ml of Opti-MEM medium. After incubation for 5 minutes, the two solutions were mixed, incubated for 15 minutes, and then added to the HEK293T cells. After 48 hours, the viral supernatant was collected and filtered through a 0.22 μm filter. The viral solution was added to the ECHS1 knockout pancreatic cancer cells constructed above. Fresh culture medium was replaced after 12-16 hours. After 48 hours of culture, puromycin (Solebol, P8230) was added to select stable expression cell lines, and the ECHS1 expression level was detected by Western blot.

[0034] The results are as follows Figure 6 As shown in the figure, it can be seen that the present invention successfully constructed a pancreatic cancer cell line with ECHS1 knockout and K115 site mutation.

[0035] Example 4 Effects of ECHS1 K115 succinyl modification on the development and progression of pancreatic cancer 1. CCK8 and clone formation assay to detect the effect of ECHS1 K115 succinylation deletion on pancreatic cancer cell proliferation: ECHS1K115 succinylation deletion and control cells were treated with 5 mM succinate for 24 hours, digested and passaged in the logarithmic growth phase, counted, added to 96-well plates, and cultured normally in a 37°C incubator. The following experimental operations were performed at 0 hours, 24 hours, 48 ​​hours, and 96 hours: the culture medium was aspirated, the cells were washed three times with PBS, and the culture medium containing 10% CCK8 was added. The cells were cultured in the incubator for 4 hours, and the OD450 value was measured using a microplate reader and statistically analyzed. At the same time, the above-mentioned succinate-treated cell lines were counted and inoculated into 6-well plates, and the 6-well plates were placed in a 37°C incubator and cultured normally for 1-2 weeks. When the clones grew to an appropriate size, the culture medium was aspirated, the cells were washed three times with PBS, fixed at room temperature for 30 minutes, stained with diluted crystal violet solution for 30 minutes, rinsed with double-distilled water, and allowed to dry naturally. The number of clones was statistically analyzed.

[0036] 2. The results are as follows Figure 7 As shown in the figure, it can be seen that ECHS1 K115 succinylation modification inhibits the proliferation of pancreatic cancer cells.

[0037] 3. Transwell experiment to detect the effect of ECHS1 K115 succinylation deletion on pancreatic cancer cell migration: ECHS1K115 succinylation deletion and control cells were treated with 5 mM succinic acid for 24 hours, digested and passaged cells in the logarithmic growth phase, counted cells, resuspended in serum-free medium and added to the upper chamber of transwell, and complete medium was added to the lower chamber. The cells were placed in a 37°C incubator and cultured normally for 20-24 hours. After the cells passed through the transwell holes and stretched out, the medium was discarded, the cells were washed three times with PBS, fixed at room temperature for 30 minutes, stained with diluted crystal violet solution for 30 minutes, rinsed with double-distilled water, and allowed to dry naturally. The number of cells passing through the aperture was photographed and counted for statistical analysis.

[0038] The results are as follows Figure 8 As shown in the figure, it can be seen that ECHS1 K115 succinylation modification inhibits pancreatic cancer cell migration.

[0039] 3. Nude mouse tumorigenesis assay to detect the effect of ECHS1 K115 succinylation deletion on pancreatic cancer cell growth: ECHS1 K115 succinylation deletion and control cells were treated with 5 mM succinate for 24 h. Cells in the logarithmic growth phase were digested and passaged. The cells were counted and resuspended in PBS buffer. The cell density was adjusted to 5 × 10 70.1 mL of cell suspension was then injected subcutaneously into the axilla of nude mice. The tumor volume was measured every 4 days after tumor growth. After about one month, the tumor was removed and its weight and volume were measured. 4. The results are as follows Figure 9 As shown in the figure, it can be seen that ECHS1 K115 succinylation modification inhibits pancreatic cancer tumor growth in vivo.

[0040] As can be seen from the above examples, the present invention provides an application of ECHS1 modified by desuccinylation at lysine 115 as a target for pancreatic cancer development. Desuccinylation modification of ECHS1 at position 115 promotes the growth and metastasis of pancreatic cancer cells, and the level of succinylation modification of ECHS1 at position 115 is significantly reduced in pancreatic cancer. A decrease in the level of succinylation modification of ECHS1 at position 115 can predict the risk of pancreatic cancer development and progression, and at the same time provides a new diagnostic method for clinical diagnosis of pancreatic cancer at the molecular level, and provides a new drug target for the treatment of pancreatic cancer.

[0041] Example 5 ECHS1 K115 succinyl modification inhibits fatty acid β-oxidation in pancreatic cancer I. Targeted metabolomics experiments examined the effects of ECHS1 K115 succinylation loss on metabolites in pancreatic cancer cells: ECHS1 K115 succinylation-deficient and control cells were treated with 5 mM succinate for 24 hours. Cells in the logarithmic growth phase were digested and passaged, and the cells were counted. Then, 150 μL of ice-cold 80% methanol solution (containing an internal standard) was added. The cells were sonicated three times for 3 seconds at an appropriate power level and centrifuged at 18,000 g for 20 minutes at 4°C. 30 μL of the supernatant was transferred to a 96-well plate. Subsequent steps were performed on an Eppendorf epMotion workstation (Eppendorf Inc., Humburg, Germany). 20 μL of freshly prepared derivatization reagent was added to each well, the plate was sealed, and derivatization was incubated at 30°C for 60 minutes. The sample was then diluted by adding 330 μL of ice-cold 50% methanol solution and centrifuged at 4°C (4000 g, 30 min). 135 μL of the supernatant was aspirated and transferred to a new 96-well plate, and 10 μL of internal standard was added to each well. Serial dilutions of the derivatized standard stock solution were added to the left wells, and the plate was sealed for LC-MS analysis.

[0042] The results are as follows Figure 10 As shown in the figure, it can be seen that ECHS1 K115 succinylation modification affects fatty acid-related metabolites and carnitine levels in pancreatic cancer cells.

[0043] This embodiment Figure 10In this study, ECHS1 K115su-deficient and control cells were treated with 5 mM succinate for 24 hours. Cells in the logarithmic growth phase were digested and passaged, and metabolites were extracted for targeted metabolomics analysis. A PCA plot showed differences between ECHS1 K115su-deficient and control cells based on metabolite analysis. A heat map was then used to display the differential metabolites in these cell lines. KEGG pathway enrichment analysis was performed on these differential metabolites. A heat map was also used to display the differential carnitine metabolites identified in these cell lines.

[0044] 2. Metabolic flux experiments examined the effect of ECHS1 K115 succinylation deletion on fatty acid β-oxidation metabolism in pancreatic cancer: 13 C 16 ECHS1 K115 succinylation-deficient and control cells were cultured in palmitic acid-containing medium for 24 hours. Cells in the logarithmic growth phase were digested and passaged. Cell counts were performed, and 400 μL of 80% methanol was added to each tube of cell sample. Cells were disrupted by sonication (JY92-IIN, NingBoScientz Biotechnology Co., Ltd.). The supernatant was concentrated by centrifugation at 18,000 g for 15 minutes at 4°C (Microfuge 20R, Beckman Coulter, Inc., Indianapolis, IN, USA). The supernatant was collected and concentrated by centrifugation (Labconco, Kansas City, MO, USA), reconstituted with 100 μL of 80% methanol, and then injected for analysis. Metabolic flux analysis was performed using a Waters ACQUITY-I UPLC / Xevo TQS ultrahigh-pressure liquid chromatography coupled to a triple quadrupole mass spectrometer.

[0045] The results are as follows Figure 11 As shown in the figure, it can be seen that ECHS1 K115 succinylation modification inhibits fatty acid β-oxidation metabolism in pancreatic cancer cells. Figure 11 It contains 13 C 16 ECHS1 K115 succinylation-deficient and control cells were cultured in palmitic acid-containing medium for 24 hours. Cells in the logarithmic growth phase were digested and passaged, and the cells were collected for metabolic flux analysis.

[0046] 3. Molecular dynamics simulation analysis of the effect of K115 succinylation modification on the catalytic activity of ECHS1 (this part of the structural analysis was commissioned to Shanghai Taoshu Biotechnology Co., Ltd.): This part uses stretching molecular dynamics simulation to study the simulation trajectories of substrates and products in the binding pockets of succinylated ECHS1 and unmodified ECHS1. Taking the last frame conformation of the conventional molecular dynamics simulation as the initial conformation, a stretching dynamics simulation was performed on the products bound to succinylated ECHS1 and unmodified ECHS1. The position of product molecule dissociation was set as the center point of the CB of the residues K282 and K353 atoms, and the stretching direction was defined as the vector formed by the center of mass of the product molecule and the center. This dissociation direction was selected for umbrella sampling and potential energy surface analysis, and the limiting force constant was 1.5 kcal mol−1 Å−2. From Figure 12 Zhong E and Figure 12 The PMF energy diagram in Figure F shows that the initial energy barriers for substrate dissociation from the binding pocket of unmodified and succinylated ECSH1 proteins are similar. Within the 1-3 Å range from the initial position, the barrier for substrate dissociation from the unmodified protein is slightly higher. During this period, the purine group of the substrate maintains hydrogen bonds with residues A359 and I361. After 2.5 Å, these hydrogen bonds are broken, leading to rapid dissociation. In the succinylated ECHS1 protein, the purine group breaks hydrogen bonds with residues A359 and I361 earlier, while maintaining a hydrogen bond with K282. The product dissociates from the binding pocket of the unmodified ECHS1 protein at a significantly lower energy barrier than the succinylated ECHS1 protein. The purine group of the product maintains hydrogen bonds with residues A359 and I361, but these hydrogen bonds are broken after 3.1 Å and 2.5 Å, respectively, leading to dissociation.

[0047] 4. The results are as follows Figure 12 As shown in the figure, the purine group of the substrate is more easily released from the succinylated ECSH1 binding pocket, while the product is relatively more stable in the succinylated ECSH1 binding pocket. Based on this result, it is speculated that succinylation of K115 will reduce the conversion efficiency of ECSH1 to the substrate.

[0048] also, Figure 12As shown in the PMF energy diagram, the initial energy barriers for substrate dissociation from the binding pocket of unmodified and succinylated ECSH1 proteins are similar. Within the 1-3 Å range from the initial position, the barrier for substrate dissociation from the unmodified protein is slightly higher. During this period, the purine group of the substrate maintains hydrogen bonds with residues A359 and I361. After 2.5 Å, these hydrogen bonds are broken, leading to rapid dissociation. In the succinylated ECHS1 protein, the purine group breaks hydrogen bonds with residues A359 and I361 earlier, while maintaining a hydrogen bond with K282. The product dissociates from the binding pocket of the unmodified ECHS1 protein at a significantly lower energy barrier than the succinylated ECHS1 protein. The purine group of the product maintains hydrogen bonds with residues A359 and I361, but these hydrogen bonds are broken after 3.1 Å and 2.5 Å, respectively, leading to dissociation.

Claims

1. A pancreatic cancer therapeutic target targeting the ECHS1 K115 site, characterized in that: The target is the succinylation modification of lysine 115 of ECHS1 ECHS1 K115su.

2. Use of the ECHS1 K115su according to claim 1 as a target in the preparation of a drug for treating pancreatic cancer.

3. Use of the reagent for detecting the expression level of ECHS1 K115su according to claim 1 in the preparation of a pancreatic cancer tumor diagnostic product.

4. The use according to claim 2, characterized in that Succinylation modification of lysine 115 of ECHS1 can mediate the conversion efficiency of ECHS1 protein to its substrate, thereby inhibiting the fatty acid β-oxidation metabolism of pancreatic cancer cells, thereby inhibiting the proliferation of pancreatic cancer cells and the growth of tumor volume.

5. The ECHS1 K115su antigen peptide according to claim 1, characterized in that: The antigenic peptide sequence of the target ECHS1 K115su is Su-2:CYSS-(Su)K-FLKHWDHL.

6. Use of the ECHS1 K115su antigen peptide according to claim 5 in the preparation of a drug for preventing or treating tumors.

Images