Application of potato miR828 in regulation and control of anthocyanin biosynthesis

Abstract

The invention provides application of potato miR828 in regulation and control of anthocyanin biosynthesis, and relates to the technical field of biology, a nucleotide sequence of a precursor sequence of the potato miR828 is as shown in SEQ ID NO.1, and a mature sequence of the potato miR828 is as shown in SEQ ID NO.2. According to the present invention, the cutting effect of the miR828 on the StMYB3 is proved through the dual luciferase and the in vivo degradation experiment; tobacco transient expression analysis experiments find that miR828 may be a negative regulatory factor for anthocyanin biosynthesis; a dual luciferase experiment shows that after the miR828 is co-injected, the activity of the StDFR promoter is reduced; a luciferase complementation experiment shows that the miR828 inhibits the formation of a compound, and the miR828 has great significance in enriching anthocyanin biosynthesis regulation ideas, crop anthocyanin biosynthesis breeding and subsequent preparation of anthocyanin-containing health-care products.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of potato miR828 in regulating anthocyanin biosynthesis. Background Art

[0002] MicroRNAs (miRNAs) are a class of small, endogenous non-coding RNA molecules found widely in eukaryotes and are important regulators of gene expression in plants. They negatively regulate gene expression at the post-transcriptional level primarily through cleavage of target mRNAs and translational repression. In plants, miRNAs often exert their effects by directly cleaving target genes.

[0003] Once a miRNA binds to its target gene, the AGO protein mediates the specific cleavage of the mRNA phosphodiester bond at positions 10-11 of the miRNA, generating two fragmented mRNA products. Most 3′ and 5′ cleavage products are degraded by exonucleases. The 3′ cleavage product is degraded by exoribonuclease 4 in the cytoplasm; the 5′ cleavage product is first uridylated by nucleoside transferase (HESO 1) and subsequently degraded by RISC-interacting clearing 3′-5′ exoribonuclease 1 (RICE 1) and RICE 2. The RNA exosome cofactors SKI2, SKI3, and SKI8 also play a crucial role in the degradation of the 5′ cleavage product. The cleavage product generated by the cleavage of the 22-nt miRNA-targeted transcript is not degraded but stabilized by gene silencing suppressors and subsequently converted into double-stranded RNA by RNA-dependent RNA polymerase 6 (RDR6). Double-stranded RNA is processed by DCL4 to produce 21 nt phasiRNAs, which can also guide AGO1 to cleave its target mRNA.

[0004] However, because anthocyanins not only give plants rich colors, but also have excellent health benefits, more research and discoveries on the regulatory mechanisms of anthocyanins in potato tubers are still of great significance for agricultural production practices and health product development. Summary of the Invention

[0005] In view of the above deficiencies in the prior art, the purpose of the embodiments of the present invention is to provide an application of potato miR828 in regulating anthocyanin biosynthesis, which can solve the technical problems existing in the prior art.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: The present invention provides an application of potato miR828 in regulating anthocyanin biosynthesis. The nucleotide sequence of the potato miR828 precursor sequence is shown in SEQ ID NO.1, and the mature sequence is shown in SEQ ID NO.2.

[0007] The present invention also provides a primer combination for amplifying the potato miR828 precursor sequence, the nucleotide sequence of the primer combination is shown in SEQ ID NO. 3 to SEQ ID NO. 4.

[0008] The present invention also provides an artificial precursor sequence for synthesizing a potato StTAS4-D4(-) mature sequence, wherein the nucleotide sequence of the potato StTAS4-D4(-) sequence is shown in SEQ ID NO. 5.

[0009] The present invention also provides a kit containing the primer combination.

[0010] The invention also provides a recombinant expression vector containing the potato miR828 precursor sequence and the potato StTAS4-D4(-) sequence.

[0011] The present invention also provides a host bacteria containing the potato miR828 precursor sequence, the potato StTAS4-D4(-) sequence or the recombinant expression vector.

[0012] The present invention also provides the use of the primer combination, the kit, the recombinant expression vector or the host bacteria in crop anthocyanin biosynthesis breeding.

[0013] Optionally, the crop is any one of the crops that require improvement in color depth.

[0014] Optionally, the crop is any crop that can produce anthocyanin-containing products.

[0015] The beneficial effects brought about by the technical solution provided by the embodiment of the present invention include at least: (1) The present invention uses dual luciferase and in vivo degradation experiments to find that compared with the control group injected with an empty vector, the fluorescence signal weakened and the LUC / REN ratio decreased significantly after the co-injection of pre-miR828 and StMYB3. However, after the co-injection of pre-miR828 and Mut-StMYB3, the fluorescence signal and the LUC / REN ratio did not change significantly compared with the control group; the StMYB3 gene fragment of the miR828 target was fused with the GFP fluorescent protein. At the same time, the STTM-miR828 sequence was designed and recombined into the PBI121 vector. Compared with the control group EV+MYB3-GFP, the fluorescence intensity of the co-injection of OE-pre-miR828+MYB3-GFP was significantly reduced, while the fluorescence intensity of the co-injection of STTM-miR828+MYB3-GFP was significantly increased. The above results further prove the cleavage effect of miR828 on StMYB3. The cleavage effect of miR828 on StMYB3 was proved.

[0016] (2) The present invention found through transient expression analysis experiments in tobacco that, based on the co-injection of StAN1 and StbHLH1, the co-injection of StMYB3+Pre-miR828 resulted in lighter leaf color and significantly decreased flavonoid and anthocyanin contents compared to the control group co-injected with StMYB3+EV. This suggests that miR828 may be a negative regulator of anthocyanin biosynthesis, rather than simply participating in anthocyanin biosynthesis by cleaving StMYB3.

[0017] (2) The present invention found through dual luciferase experiments that, based on the injection of StAN1 and StbHLH1, the co-injection of StMYB3 inhibited the activity of the StDFR promoter. On this basis, the co-injection of miR828 further reduced the activity of the StDFR promoter.

[0018] (3) The present invention found through luciferase complementation experiments that miR828 weakened the interaction between StMYB3 and StbHLH1 and inhibited the formation of the complex.

[0019] (4) The present invention found that StTAS4 has a miR828 cleavage site and contains a small RNA located in the D4(-) region, named StTAS4-D4(-). Through the tobacco transient expression colorimetric experiment, it was found that compared with EV+StMYBA1, the leaf color became lighter after co-injection of StTAS4-D4(-)+StMYBA1, and the content of flavonoids and anthocyanins were significantly reduced.

[0020] In summary, the present invention discovered the application of potato miR828 in the regulation of anthocyanin biosynthesis, which is of great significance for enriching the ideas of anthocyanin biosynthesis regulation, as well as in the breeding of crop anthocyanin biosynthesis and the subsequent preparation of anthocyanin-containing health products. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The accompanying drawings are only for the purpose of illustrating specific embodiments and are not to be considered as limiting the present invention. Throughout the drawings, the same reference symbols represent the same components. Obviously, the drawings described below are only some embodiments of the present invention. It is clear that those skilled in the art can derive other drawings based on these drawings without inventive effort.

[0022] Figure 1 1 is a diagram showing the sequencing results of the potato miR828 precursor sequence and the comparison results with the reference gene provided in Example 1 of the present invention; Figure 2 This is a graph showing the results of a dual luciferase experiment provided in Example 1 of the present invention; Figure 3 This is a verification diagram of miR828 cleaving StMYB3 in vivo provided in Example 1 of the present invention; Figure 4 This is a schematic diagram of the transient expression color development experiment provided in Example 1 of the present invention to verify the function of miR828; Figure 5 The transient expression colorimetric experiment provided in Example 1 of the present invention verifies the function of miR828; Figure 6 Schematic diagram of the miR828-StTAS4-StTAS4-D4(-)-MYBA1 regulatory pathway provided in Example 1 of the present invention. DETAILED DESCRIPTION

[0023] In order to enable those skilled in the art to better understand the technical solutions in the embodiments of the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the embodiments described are part of the embodiments of the present invention, rather than all of the embodiments. It should be understood that these descriptions are merely exemplary and are not intended to limit the scope of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative work should fall within the scope of protection of the present invention.

[0024] The application of potato miR828 in regulating anthocyanin biosynthesis provided by the embodiments of the present invention will be described in detail below with reference to the accompanying drawings through specific embodiments and application scenarios.

[0025] The present invention provides an application of potato miR828 in regulating anthocyanin biosynthesis. The nucleotide sequence of the potato miR828 precursor sequence is shown in SEQ ID NO.1, and the mature sequence is shown in SEQ ID NO.2.

[0026] SEQ ID NO. 1: ACCTAAGAGTTCGACTCCCTCGCTCTTTCCTAGATCCACCCCCGACTACAAGAAACAGGAAATTCAAAATTTCTCTCAATATATATACCTAAGTACAAACTTCCTGGTAAAACTTCTTGCCCAAATGAGTATCTCAAAGTATGTCA ATTAGACATTTGTTGGAATACTCATTTGAGCAAGAGGCTTTCCCAAAGAAGTGAATGCAAATATGAGTCTCCTCCATGAGAAAGTAAAGGAATATGTATAGTCATGTTACCTGCCAAAAACTCAGAGTTGGTTGTACCAGCCTTATG SEQ ID NO. 2: UCUUGCUCAAAUGAGUAUUCCA The present invention also provides a primer combination for amplifying the potato miR828 precursor sequence, the nucleotide sequence of the primer combination is shown in SEQ ID NO. 3 to SEQ ID NO. 4.

[0027] SEQ ID NO. 3: 5′-ACCTAAGAGTTCGACTCCCTCG-3′ SEQ ID NO. 4: 5′-CATAAGGCTGGTACAACCAACTCTG-3′ The present invention also provides an artificial precursor sequence for synthesizing a potato StTAS4-D4(-) mature sequence, wherein the nucleotide sequence of the potato StTAS4-D4(-) sequence is shown in SEQ ID NO. 5.

[0028] SEQ ID NO. 5: AAAGTAGAGAAGAATCTGTAATGAAGGTCCGAGGTTGAGGTATGATGATCACATTCGTTATCTATTTTTTAAACATCATCCTCGTACCTTCATTTGGCTCTTCTTACTACA The present invention also provides a kit containing the primer combination.

[0029] The present invention also provides a recombinant expression vector containing the potato miR828 precursor sequence and the potato StTAS4-D4(-) sequence.

[0030] The present invention also provides a host bacteria containing the potato miR828 precursor sequence, the potato StTAS4-D4(-) sequence or the recombinant expression vector.

[0031] The present invention also provides the use of the primer combination, the kit, the recombinant expression vector or the host bacteria in crop anthocyanin biosynthesis breeding.

[0032] Optionally, the crop is any one of the crops that require improvement in color depth.

[0033] Optionally, the crop is any crop that can produce anthocyanin-containing products.

[0034] Example 1 1. Construction of plant expression vector This study cloned the miR828 precursor sequence as a target fragment to analyze the role of this miRNA in anthocyanin biosynthesis. The target gene sequence was identified based on the complete potato genome sequence. Primers were designed 100 bp upstream and downstream of the precursor sequence. The forward sequence was 5′-ACCTAAGAGTTCGACTCCCTCG-3′ (SEQ ID NO. 3); the reverse sequence was 5′-CATAAGGCTGGTACAACCAACTCTG-3′ (SEQ ID NO. 4). Takara's high-fidelity polymerase (PrimeSTAR HS DNA Polymerase) was used for amplification using purple potato DNA as a template. The specific PCR reaction system and amplification cycles are shown in Tables 1 and 2, respectively.

[0035] Table 1 PCR reaction system Table 2 PCR amplification cycles After amplification of the target fragment, perform electrophoresis on the PCR product to verify its integrity. Recover the PCR product using the Jinsha Biotech DNA Gel Recovery Kit; refer to the instructions for specific procedures. Determine the concentration of the purified PCR product using an ultra-micro spectrophotometer before proceeding with the subsequent vector ligation test.

[0036] After selecting the monoclonal bacterial solution with brighter bands and culturing overnight, the plasmid was extracted and sequenced. Figure 1 As shown, analysis of the sequencing results showed that the cloned gene sequence was completely consistent with the reference genome.

[0037] 2. Molecular Verification of miR828 Target Genes Preliminary prediction of miR828 target genes was performed using the psRNATarget and psRobot websites. Combined with degradome screening, StMYB3 was identified as the target gene of miR828. The StMYB3 fragment, a target of miR828, was amplified, and a mutant Mut-StMYB3 fragment was designed and amplified. StMYB3 and Mut-StMYB3 were inserted into the pGreenII0800-miRNA vector as reporter genes, and pre-miR828 was inserted into the PBI121 vector as an effector. The cells were co-injected into Nicotiana benthamiana leaves. Fluorescence signals were detected using an in vivo imaging system, and dual-luciferase reporter assays were performed.

[0038] The StMYB3 gene fragment, a target of miR828, was further fused to the GFP fluorescent protein. Simultaneously, the STTM-miR828 sequence was designed and recombined into the PBI121 vector. GFP fluorescence images were captured in a darkroom using a handheld UV analyzer.

[0039] The experimental results are as follows Figure 2 and Figure 3 shown.

[0040] from Figure 2 As can be seen, compared with the empty vector control group, the fluorescence signal weakened and the LUC / REN ratio decreased significantly after co-injection of pre-miR828 and StMYB3. However, after co-injection of pre-miR828 and Mut-StMYB3, the fluorescence signal and LUC / REN ratio did not change significantly compared with the control group, indicating that miR828 has a cleavage effect on StMYB3.

[0041] from Figure 3 As can be seen, compared with the control group EV+MYB3-GFP (a+d), the fluorescence intensity of co-injection of OE-pre-miR828+MYB3-GFP (b+d) was significantly reduced, while the fluorescence intensity of co-injection of STTM-miR828+MYB3-GFP (c+d) was significantly increased, further demonstrating the cleavage effect of miR828 on StMYB3.

[0042] 3. Tobacco Transient Expression Experiment and Analysis 3.1 Tobacco leaf color development experiment The function of miR828 in regulating anthocyanin biosynthesis was preliminarily confirmed by transient expression colorimetric experiments in tobacco. The specific procedures are as follows: (1) Activation and cultivation of Agrobacterium: Spread the bacterial solution stored at -80℃ on LB solid medium containing Kan+Rif, and culture it upside down in the dark at 28℃ for 2 days.

[0043] (2) Use an inoculation loop to scrape the cultured Agrobacterium. After scraping a full loop, place it in the infection solution and let it stand at 28°C for 1 hour. Gently invert the solution to allow the bacteria at the bottom to float, and let it stand again for 1 hour. Keep the concentration of the bacteria solution between OD600 of 0.8 and 1.0. Try to complete the injection of the bacteria solution within 3 hours to avoid damage to the vitality of the Agrobacterium strain.

[0044] (3) Select tobacco plants K326 with robust morphology and suitable growth period for tobacco injection. StAN1+StbHLH1+EV and StMYB3+StbHLH1+EV were co-injected on one side of the tobacco leaf, and StAN1+StbHLH1+StMYB3+EV and StAN1+StbHLH1+StMYB3+Pre-miR828 were co-injected on the other side of the leaf. The needle was removed with a 1 mL syringe and the bacterial solution was slowly injected into the back of the tobacco leaf. After a short dark treatment, the injected tobacco leaf was placed in an artificial climate chamber for culture. After 3-5 days, the leaf color change was observed and samples were taken for the determination of flavonoid and anthocyanin content.

[0045] 3.2 Determination of flavonoid content Flavonoid content was determined using an aluminum salt colorimetric method. The flavonoid content in tobacco leaves was determined using the Solebio Plant Anthocyanin Content Assay Kit (BC1385). The experimental procedures were followed according to the kit instructions.

[0046] 3.3 Determination of anthocyanin content Anthocyanin content in tobacco leaves was determined using the pH differential method. The plant flavonoid content assay kit (BC1330) from Solebo was used to determine anthocyanin content in tobacco leaves. The experimental procedures were described in the kit instructions.

[0047] The experimental results are as follows Figure 4 As shown in the results, based on the co-injection of StAN1 and StbHLH1, the leaf color became lighter and the flavonoid and anthocyanin contents decreased significantly after the co-injection of StMYB3+Pre-miR828, compared with the control group co-injected with StMYB3+EV. It was previously expected that after the co-injection of StAN1+StMYB3+Pre-miR828, miR828 would inhibit the expression of StMYB3, weaken the competition with StAN1, and thus promote color accumulation. However, after the injection of Pre-miR828, the leaf color did not deepen, but became lighter. This indicates that miR828 may be a negative regulator of anthocyanin biosynthesis, and it is not simply involved in anthocyanin biosynthesis by cutting StMYB3.

[0048] 4. Luciferase Complementation Assay Previous studies have found that both StMYB3 and StAN1 form a complex with StbHLH1 to regulate tuber anthocyanin biosynthesis. StbHLH1 was fused to NLuc, while StMYB3 and StAN1 were fused to CLuc, respectively. Different combinations of recombinant plasmids were co-injected into Nicotiana benthamiana leaves. In vivo fluorescence imaging was used to observe and photograph the cells. The specific experimental steps are as follows: (1) Select Nicotiana benthamiana with healthy growth and 4 to 6 leaves as experimental materials.

[0049] (2) Take out the frozen bacterial solution from the -80℃ refrigerator and insert it into ice. When the top of the bacterial solution starts to melt slightly, scrape the bacterial solution with an inoculating loop and evenly spread it on LB solid medium containing the corresponding antibiotics. Place it in an incubator at 28℃ and incubate it upside down for 48 hours.

[0050] (3) Scrape the Agrobacterium with an inoculating loop until the loop is full. Place the loop firmly in the infection solution and immerse it in the infection solution, making sure that the scraped Agrobacterium does not touch the tube opening. Place the centrifuge tube in a 28°C incubator and gently shake it upside down every hour. After the second shaking, ensure that the Agrobacterium is fully dissolved and the OD600 of the bacterial solution is between 0.8 and 1.0. Remove the tube and set aside.

[0051] (3) Use a 1ml syringe to draw up the mixed bacterial solution and inject it on the back of the leaf. After the injection, culture in the dark for 24 hours and then in the light for 24 hours.

[0052] (4) Collect the injected leaves, spray the luciferase potassium salt solution on the back of the leaves, shade the reaction for 5 minutes, and then use the in vivo fluorescence imaging system to observe and photograph the fluorescent signals of the injected leaves.

[0053] The experimental results are as follows Figure 5 As shown, luminescence was observed in the region containing StMYB3-cluc and StbHLH-nluc, while no luminescence was observed in the region containing StMYB3-cluc and empty nluc. Co-injection of OE-pre-miR828 with StMYB3-cluc and StbHLH1-nluc at a ratio of 1:1:1 observed a decrease in the fluorescence signal. Co-injection of OE-pre-miR828 with StMYB3-cluc and StbHLH1-nluc at a ratio of 5:1:1 further weakened the fluorescence signal. This suggests that miR828 weakens the interaction between StMYB3 and StbHLH1, inhibiting complex formation.

[0054] 5. miR828 cleaves TAS4 to produce ta-siRNA MiRNAs can cleave TAS gene transcripts to produce ta-siRNAs. Ta-siRNAs also bind to the AGO protein to form the RISC complex, which recognizes and cleaves target mRNAs through complementary base pairing. The cleavage of TAS by miRNAs to produce ta-siRNAs is a cascade amplification mechanism, enabling efficient regulation of the expression of multiple target genes. Using artificial miRNA technology (amiRNA), a precursor sequence carrying StTAS4-D4(-) was designed and synthesized using miR390b as a backbone. The detailed sequence is shown in SEQ ID NO. 5.

[0055] SEQ ID NO. 5: AAAGTAGAGAAGAATCTGTAATGAAGGTCCGAGGTTGAGGTATGATGATCACATTCGTTATCTATTTTTTAAACATCATCCTCGTACCTTCATTTGGCTCTTCTTACTACA Through dual luciferase and tobacco transient expression experiments, it was found that miR828 triggered the production of secondary siRNA (StTAS4-D4(-)) by cutting StTAS4 transcripts. The target genes of StTAS4-D4(-) included the anthocyanin positive regulatory factor StMYBA1. StTAS4-D4(-) inhibited the activation of MYBA1 on anthocyanin synthesis, and the content of flavonoids and anthocyanins was reduced.

[0056] The experimental results are as follows Figure 6 As shown, compared with the control group injected with empty vector and miR828, the fluorescence signal of the experimental group co-injected with StTAS4 and miR828 weakened, and the LUC / REN ratio also decreased significantly, proving that miR828 has a cutting effect on StTAS4. Analysis of the target genes of StTAS4-D4(-) revealed that there are multiple MYB transcription factors among the target genes of StTAS4-D4(-), indicating that StTAS4-D4(-) may play an important regulatory role in the biosynthesis of flavonoid metabolites. Among these target MYB transcription factors, we found MYBA1, a positive regulator of anthocyanin biosynthesis. In order to verify whether StTAS4-D4(-) would affect the function of MYBA1, a tobacco transient expression colorimetric experiment showed that compared with EV+StMYBA1, the leaf color became lighter after co-injection of StTAS4-D4(-)+StMYBA1, and the content of flavonoids and anthocyanins were significantly reduced. The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of potato miR828 in regulating anthocyanin biosynthesis, characterized in that: The nucleotide sequence of the potato miR828 precursor sequence is shown in SEQ ID NO.1, and the mature sequence is shown in SEQ ID NO.

2.

2. A primer combination for amplifying the potato miR828 precursor sequence of claim 1, characterized in that: The nucleotide sequences of the primer combinations are shown in SEQ ID NO. 3 to SEQ ID NO.

4.

3. An artificial precursor sequence for synthesizing the potato StTAS4-D4(-) mature sequence of claim 1, characterized in that: The nucleotide sequence of the potato StTAS4-D4(-) sequence is shown in SEQ ID NO.

5.

4. A kit comprising the primer combination according to claim 2.

5. A recombinant expression vector comprising the potato miR828 precursor sequence of claim 1 and the potato StTAS4-D4(-) sequence of claim 3.

6. A host bacteria containing the potato miR828 precursor sequence of claim 1, the potato StTAS4-D4(-) sequence of claim 3, or the recombinant expression vector of claim 5.

7. Use of the primer combination of claim 2, the kit of claim 4, the recombinant expression vector of claim 5, or the host bacteria of claim 6 in crop anthocyanin biosynthesis breeding.

8. The use according to claim 7, characterized in that The crop is any one of the crops requiring improved color depth.

9. The use according to claim 7, characterized in that The crop is any crop that can produce anthocyanin-containing products.

Images