Application of dimethyl itaconate in preparation of medicine for treating adult Stetill disease and related macrophage activation syndrome

Abstract

The invention relates to an application of dimethyl itaconate in preparation of a medicine for treating adult Stetill disease and related macrophage activation syndrome. The invention provides a precise treatment scheme of targeted macrophage immunometabolism reprogramming, so that the systemic immunosuppression risk is reduced; a novel small-molecule inhibitor capable of simultaneously blocking abnormal activation of the TLR4 / TLR9 binary channel is developed; and an immunometabolism-inflammatory factor two-dimensional regulation system aiming at the cytokine storm is established.

Description

Technical Field

[0001] The present invention belongs to the technical field of treating adult-onset Still's disease, and in particular relates to the use of dimethyl itaconate in preparing a medicament for treating adult-onset Still's disease and related macrophage activation syndrome. Background Art

[0002] Adult-onset Still's disease (AOSD) is a systemic autoinflammatory disease characterized by polyarthritis, high fever, a transient salmon-like rash, hyperferritinemia, and hepatosplenomegaly. Its pathogenesis involves genetic background (e.g., HLA-associated genes), infectious triggers (e.g., viral or bacterial), and immune dysregulation, particularly a cytokine storm (e.g., IL-1β, IL-6, IL-18, and IFN-γ) mediated by neutrophils, macrophages, and T cells. The incidence rate is approximately 0.16-0.4 per 100,000 patients, affecting both sexes equally, with a bimodal age distribution (15-25 and 36-45 years). Macrophage activation syndrome (MAS) is a life-threatening complication of AOSD and systemic juvenile idiopathic arthritis (sJIA), characterized by persistent fever, pancytopenia, hepatosplenomegaly, and hyperferritinemia. It progresses rapidly and can lead to multi-organ failure, requiring urgent intervention. Approximately 20-50% of patients may develop MAS, with a mortality rate as high as 20-50%.

[0003] The main current treatment methods and their shortcomings are as follows:

[0004] 1. Traditional Treatment

[0005] (1) Glucocorticoids

[0006] Role: First-line treatment, rapid control of inflammation.

[0007] Disadvantages: Long-term use leads to osteoporosis, hypertension and infection risk (42-45% of patients are hormone-dependent); limited efficacy for chronic joint symptoms.

[0008] (2) Nonsteroidal anti-inflammatory drugs (NSAIDs)

[0009] Effect: Relieve mild symptoms.

[0010] Disadvantages: Only effective in 20% of patients and cannot suppress systemic inflammation.

[0011] (3) Disease-modifying antirheumatic drugs (DMARDs, such as methotrexate)

[0012] Function: Reduce the dosage of hormones and control the course of chronic diseases.

[0013] Disadvantages: Slow onset of effect, poor effect on severe or MAS patients.

[0014] 2. Biological Agents

[0015] (1) IL-1 inhibitors (anakinra, canakinumab)

[0016] Advantages: Effective for systemic symptoms and early sJIA, and can prevent arthritis progression.

[0017] Disadvantages: Some patients develop drug resistance (approximately 30% have an inadequate response); injection site reactions and infection risks.

[0018] (2) IL-6 inhibitor (tocilizumab)

[0019] Advantages: Significant improvement in joint and systemic symptoms.

[0020] Disadvantages: May induce MAS (especially in elderly patients), and long-term use increases the risk of dyslipidemia.

[0021] (3)JAK inhibitors (baricitinib, tofacitinib)

[0022] Advantages: Broad-spectrum anti-inflammatory, effective for refractory cases.

[0023] Disadvantages: Potential risks of thrombosis and infection (such as severe COVID-19); lack of long-term safety data.

[0024] (4) IFN-γ inhibitor (Emapalumab)

[0025] Role: Targeted therapy for MAS.

[0026] Disadvantages: High price, requires intravenous administration, and is suitable for a limited number of people.

[0027] MAS-specific treatment

[0028] (1) Etoposide

[0029] Function: Suppress excessive immune response.

[0030] Disadvantages: Myelosuppression and hepatotoxicity, used only in refractory cases.

[0031] (2) Plasma exchange

[0032] Function: Rapidly remove inflammatory mediators.

[0033] Disadvantages: Short-term effect, needs to be combined with other treatments.

[0034] In summary, the above-mentioned related treatments have the following defects:

[0035] (1) Heterogeneity of drug response: Some patients do not respond to IL-1 / IL-6 inhibitors and require individualized treatment strategies.

[0036] (2) Long-term safety issues: hormone dependence, infection risk of biological agents, and thrombosis issues of JAK inhibitors.

[0037] (3) Dilemma in MAS treatment: Etoposide is highly toxic and new targeted drugs (such as Emapalumab) are not readily available. Summary of the Invention

[0038] The technical problem to be solved by the present invention is to provide the use of dimethyl itaconate in the preparation of a drug for treating adult-onset Still's disease and related macrophage activation syndrome. Dimethyl itaconate can simultaneously block the abnormal activation of the TLR4 / TLR9 dual pathways.

[0039] The present invention provides the use of dimethyl itaconate in preparing a medicament for treating adult-onset Still's disease and related macrophage activation syndrome.

[0040] Furthermore, the dimethyl itaconate serves as a TLR4 / TLR9 dual pathway inhibitor.

[0041] Furthermore, the drug further comprises a pharmaceutically acceptable carrier and / or excipient.

[0042] Furthermore, the pharmaceutically acceptable carrier and / or excipient includes at least one of a diluent, a binder, a surfactant, a wetting agent, an adsorption carrier, a lubricant, a filler, and a disintegrant.

[0043] Furthermore, the dosage form of the drug includes at least one of tablets, pills, powders, solutions, suspensions, emulsions, and granules.

[0044] Furthermore, the administration method of the drug includes intravenous injection.

[0045] Beneficial effects

[0046] (1) The present invention provides a precise treatment plan that targets macrophage immune metabolic reprogramming, reducing the risk of systemic immunosuppression; (2) The present invention develops a novel small molecule inhibitor that can simultaneously block abnormal activation of the TLR4 / TLR9 dual pathway;

[0047] (3) The present invention establishes a two-dimensional regulatory system of "immunometabolism-inflammatory factors" for cytokine storm. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 Interleukin-1β (a) and interleukin-6 (b) levels in the culture supernatant of monocytes from AOSD patients stimulated with lipopolysaccharide (LPS) or cytosine-phosphate-guanine oligodeoxynucleotide 1826 (CPG ODN1826). *p < 0.05; **p < 0.01; ***p < 0.001.

[0049] Figure 2 (a) Schematic diagram of the CPG ODN-induced MAS mouse model and DMI treatment method; (b) Representative images of spleen and (c) liver from mice treated with phosphate buffered saline (PBS), CPG ODN, and with or without DMI treatment, respectively; (d) Spleen index (spleen weight / body weight) and (e) Liver index (liver weight / body weight), data from mice treated with PBS (black dots, n=4), CPG ODN (blue dots, n=4), and CPG ODN plus DMI treatment (red dots, n=5); (f) Platelet (PLT) and (g) Red blood cell (RBC) counts, data from mice treated with PBS (black dots, n=3), CPG ODN (blue dots, n=4), and CPG ODN plus DMI treatment (red dots, n=5). Whole blood samples from mice treated with ODN plus DMI (red dots, n = 5); Serum levels of (h) tumor necrosis factor-α and (i) interleukin-18 were measured by flow cytometry. Data were collected from mice treated with PBS (black dots, n = 4), CPG ODN (blue dots, n = 5), and CPG ODN plus DMI (red dots, n = 5); (j) Representative immunohistochemical staining of CD45 in liver tissues from mice treated with PBS, CPG ODN, and CPG ODN plus DMI. Scale bar = 20 μM; (k) Liver mRNA expression levels of inflammatory cytokines such as interleukin-1β, interleukin-6, and tumor necrosis factor-α. Data were collected from mice treated with PBS (black dots, n = 3), CPG ODN (blue dots, n = 4), and CPG ODN plus DMI (red dots, n = 5). Bar graphs represent mean ± standard error. DMI: dimethyl itaconate; PLT: platelet; RBC: red blood cell. *p < 0.05; **p < 0.01; ***p < 0.001. DETAILED DESCRIPTION

[0050] Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiments are only used to illustrate the present invention and are not used in limiting the scope of the present invention.In addition, should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall equally within the scope limited by the appended claims of the application.

[0051] Example 1

[0052] 1. Experimental Methods

[0053] (1) Dimethyl itaconate (DMI): purchased from Sigma-Aldrich (Merck, Shanghai, China).

[0054] (2) Mice: 8- to 10-week-old C57 / BL6 mice (weighing 18 to 22 g) were purchased from Weitonglihua Animal Co., Ltd. (Jiaxing, China). Mice were housed in a specific pathogen-free (SPF) environment. All experiments were approved by the Animal Care and Use Committee of Ruijin Hospital, Shanghai Jiao Tong University School of Medicine.

[0055] (3) Peripheral blood tests in AOSD patients:

[0056] Peripheral blood mononuclear cells (PBMCs) of AOSD patients were isolated by density gradient centrifugation using Lymphoprep separation medium (Serumwerk Bernburg AG, Bernburg, Germany). After washing with PBS, the cells were centrifuged at a concentration of 1 × 10 6 PBMCs were cultured at a concentration of 100 μM / well in a 96-well flat-bottom cell culture plate at 37°C for 3 hours. The adherent monocytes were obtained after removing the supernatant. Monocytes pretreated with DMI (100 μM) for 2 hours were stimulated with either 100 ng / mL LPS (purchased from Sigma) or 1 μM CpG ODN 1826 for 5 hours. 5 mM ATP was added 30 minutes before the end of stimulation. The cell culture supernatant was collected and assayed for IL-1β and IL-6 concentrations using human ELISA kits (R&D systems, Minneapolis, MN, USA).

[0057] (4) Construction of a macrophage activation syndrome-like mouse model:

[0058] Cytosine-phosphate-guanine oligodeoxynucleotide (CpG ODN) 1826 (TCCATGACGTTCCTGACGTT), containing a phosphorothioate backbone, was synthesized by Sangon Biotech (Shanghai) Co., Ltd. 8- to 10-week-old C57 / BL6 wild-type (WT) mice were intraperitoneally injected with 50 μg (2.5 μg / g body weight) of CpG ODN 1826 (dissolved in phosphate buffered saline) on days 1, 3, 5, 7, and 9 to induce macrophage activation syndrome (MAS). On day 10, the mice were sacrificed by cervical dislocation. For treatment with itaconic acid derivatives, CpG ODN-induced mice were intraperitoneally injected daily for 9 consecutive days (days 2 to 10) with 20 mg of DMI (dissolved in 500 μl of phosphate buffered saline) or a control solvent. The mice were sacrificed on day 11. The spleens and livers of the mice were weighed and stored at −80°C until use. The number of white blood cells (WBCs), red blood cells (RBCs), and platelets (PLTs) was measured using an impedance hematology analyzer (pocH-100iV Diff, Sysmex, Kobe, Japan). Serum was stored at −80°C until use. Peritoneal macrophages were isolated and selected. Mouse serum was assayed for TNF-α and IL-18 concentrations using mouse ELISA kits (R&D systems, Minneapolis, MN, USA). Mouse livers were sectioned and stained with an antibody against CD45, a total leukocyte marker (Wuhan Sevier Biotechnology Co., Ltd.).

[0059] 2. Experimental Results

[0060] (1) Regulatory effect of DMI on inflammatory factors in patients with AOSD

[0061] The monocytes of patients were stimulated by TLR4 agonist (LPS) and TLR9 agonist (CpG ODN 1826). ELISA test showed that the IL-1β level in the DMI treatment group decreased by 46% and 50% (p < 0.001), and the IL-6 level decreased by 67% and 38% (p < 0.01), respectively, demonstrating that it has significant anti-inflammatory activity ( Figure 1 ab).

[0062] (2) The therapeutic mechanism of DMI in cytokine storm model

[0063] In a CpG ODN-induced mouse model, DMI treatment (intraperitoneal injection for 9 consecutive days) produced the following effects:

[0064] Improvement of organ pathology: spleen / liver weight ratio decreased by 53% / 21% (p<0.01) ( Figure 2 be);

[0065] Blood index recovery: platelet count increased to (766±103)×10^9 / L (vs 572±110 in the model group), and red blood cell count recovered to (8.05±0.34)×10^12 / L (vs 7.57±0.25 in the model group) ( Figure 2 fg);

[0066] Inflammatory factor inhibition: serum TNF-α level decreased from (60.20±22.67) pg / mL to (28.51±14.74), IL-18 level decreased from (331.4±85.7) pg / mL to (228.1±38.4) (p<0.001) ( Figure 2 hi);

[0067] Immune cell regulation: liver CD45 + Immune cell infiltration decreased, IL-1β mRNA expression decreased by 2 times, IL-6 mRNA expression decreased by 3.5 times, and TNF-α mRNA expression decreased by 1.6 times (qPCR p < 0.001) ( Figure 2 jk).

Claims

1. Use of dimethyl itaconate in the preparation of drugs for the treatment of adult-onset Still's disease and related macrophage activation syndrome.

2. The use according to claim 1, characterized in that: The dimethyl itaconate serves as a TLR4 / TLR9 dual pathway inhibitor.

3. The use according to claim 1, characterized in that: The drug further comprises a pharmaceutically acceptable carrier and / or excipient.

4. The use according to claim 3, characterized in that: The pharmaceutically acceptable carrier and / or excipient includes at least one of a diluent, a binder, a surfactant, a wetting agent, an adsorption carrier, a lubricant, a filler, and a disintegrant.

5. The use according to claim 1, characterized in that: The dosage form of the drug includes at least one of tablets, pills, powders, solutions, suspensions, emulsions, and granules.

6. The use according to claim 1, characterized in that: The administration method of the drug includes intravenous injection.

Images