Alkaline xylanase mutants and uses thereof

By modifying the protein of Paecilomyces xylanase by mutating the 165th amino acid to His, the heat resistance of xylanase was improved, solving the problems of low yield and insufficient temperature resistance of existing xylanases, and enabling wider industrial applications.

CN120624414BActive Publication Date: 2026-05-29QINGDAO VLAND BIOTECH GRP CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510728702.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-03
Publication Date
2026-05-29
Estimated Expiration
2045-06-03

AI Technical Summary

Technical Problem

Existing xylanases suffer from low yield, high cost, and insufficient temperature resistance, which limits their widespread application in the industrial field.

Method used

By protein engineering the xylanase derived from Paecilomyces, especially by mutating the 165th amino acid from Asn to His, its heat resistance was improved, and a heat-resistant xylanase mutant was constructed.

Benefits of technology

After treatment at 80℃ for 30 minutes, the enzyme activity residual rate increased by 47.24%, and after treatment at 85℃ for 30 minutes, the enzyme activity residual rate increased by 73.4%, significantly improving the enzyme's heat resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005431265900000061
    Figure BDA0005431265900000061
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering and protein engineering, and particularly relates to a basic xylanase mutant and application thereof. The present application provides a mutant containing a N165H mutation site based on wild-type xylanase H1. Compared with the wild type, the heat resistance of the xylanase mutant is significantly improved, which is conducive to the wide promotion and application of the xylanase mutant in the industrial field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein engineering, specifically to a basic xylanase mutant and its applications. Background Technology

[0002] Xylan is a polypentose sugar whose main component is D-xylose. Its backbone is a polymer composed of β-(1-4)-pyranotropic D-xylose units linked by β-1,4-glycosidic bonds. Most xylans are heteropolysaccharides, with the backbone often containing arabinose, coumaric acid, etc., and the branches containing various substituted glycosyl groups, such as ferulic acid and uronic acid. Because the residues of the xylan branches are linked to lignin, pectin, dextran, etc., xylan is difficult to degrade. Xylanase plays a crucial role in the degradation process, as it can open the backbone and branches of xylan and break it down into fermentable oligosaccharides or monosaccharides, facilitating biological utilization.

[0003] Xylanase (endo-1,4-β-D-xylanxylanohydrolase EC3.2.1.8) is a hydrolase, a complex enzyme system that degrades xylan into xylooligosaccharides or xylose. It typically includes both endonucleases and exonucleases. The xylanase commonly referred to is endo-β-1,4-D-xylanase (EC3.2.1.8), which primarily degrades the xylan backbone. The hydrolysis products are mainly xylobiose or higher-order oligosaccharides, with small amounts of xylose, arabinose, and mannose. It is considered one of the most crucial enzymes in xylan degradation. Based on their pH sensitivity, xylanases can be classified as acidophilic, basophilic, and neutral enzymes. They can also be classified based on their temperature sensitivity as thermophilic, mesophilic, and cryophilic enzymes.

[0004] Xylanases have a wide range of sources; nearly a hundred species and dozens of genera of microorganisms have been identified as xylanase producers, including bacteria, fungi, actinomycetes, and some yeasts. Currently reported bacteria include *Butyrivibro* and *Clostridium*; fungi include *Penicillium*, *Trichoderma*, and *Aspergillus*; actinomycetes include *Streptomyces sp.*, *Streptomyces flavogriseus*, and *Pseudomonos*; and yeasts include *Cryptococcus albidus*. Different types of microorganisms produce different types of xylanases, and even the same microorganism can produce different xylanases.

[0005] Due to the crucial role of xylanase in the degradation of xylan, it has been widely applied in various industries, including pulp and paper, animal feed, food, energy, pharmaceuticals, and textiles. Although xylanase can be obtained from animals, plants, and microorganisms, currently, large quantities are primarily obtained through fermentation of fungi and bacteria. Acidic xylanase maintains high enzyme activity even at pH below 4.0, and it is commonly used in the feed, brewing, and food industries, demonstrating its significant production potential.

[0006] However, xylanase currently faces limitations such as low yield, high cost, and difficulty in obtaining thermostable enzymes. Therefore, obtaining novel xylanases with high yield and low cost suitable for commercialization using genetic engineering and protein engineering methods has become an urgent problem to be solved. Summary of the Invention

[0007] The purpose of this invention is to provide a basic xylanase mutant. This invention achieves this by protein engineering a xylanase derived from *Paecilomyces sp.*, resulting in a mutant protein with significantly improved high-temperature tolerance, which is beneficial for its widespread industrial application.

[0008] One aspect of this invention relates to a xylanase mutant, which is obtained by mutating the 165th amino acid of the xylanase with the amino acid sequence SEQ ID NO:1 from Asn to His.

[0009] The present invention also relates to DNA molecules encoding the above-mentioned xylanase mutants.

[0010] The present invention also relates to recombinant expression plasmids comprising the above-described DNA molecules.

[0011] The present invention also relates to a host cell comprising the above-described recombinant expression plasmid.

[0012] When the plasmids described above were transferred into host cells, the heat tolerance of the recombinant xylanase mutant was significantly improved.

[0013] In some embodiments of the present invention, the host cell is Pichia pastoris.

[0014] Compared with wild-type xylanase H1, the mutant containing the N165H mutation site provided by this invention has significantly improved heat resistance. After treatment at 80°C for 30 min, the enzyme activity residual rate increased by 47.24%, and after treatment at 85°C for 30 min, the enzyme activity residual rate increased by 73.4%, achieving unexpected technical effects and making it more conducive to its widespread application in the industrial field. Detailed Implementation

[0015] This invention discloses a basic xylanase mutant and its applications, the DNA molecule encoding the xylanase mutant, a vector, and a host cell. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0016] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECMLAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENT PROTOCOLS IN MOLECMLAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention:

[0017] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0018] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutagenesis kits from Beijing Bomais Biotechnology Co., Ltd.

[0019] Culture medium formulation:

[0020] BMGY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10⁻⁶ ppm -5 % Biotin, 1% Glycerin;

[0021] BMMY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10⁻⁶ -5 % Biotin, 0.5% Methanol;

[0022] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0023] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;

[0024] The present invention will be further illustrated below with reference to the embodiments:

[0025] Example 1 Construction of recombinant plasmid

[0026] The xylanase gene derived from *Paecilomyces sp.* was optimized according to the codon preference of *Pichia pastoris*, with the addition of six bases GAATTC (EcoR I cleavage site) before the start codon ATG and GCGGCCGC (Not I cleavage site) after the stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. This xylanase was named H1, with its amino acid sequence SEQ ID NO: 1 and encoding nucleotide sequence SEQ ID NO: 2.

[0027] The xylanase gene was digested with restriction endonucleases EcoRI and Not I (Fermentas); simultaneously, plasmid pPIC9K was digested with the same restriction endonucleases. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α *E. coli* (Invitrogen) and selected using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).

[0028] The plasmid was purified from the correctly sequenced E. coli clone using the Plasmid Mini-Preparation Kit (Omega) to obtain one recombinant plasmid, which was named pPIC9K-H1.

[0029] Example 2: Screening of thermostable xylanase mutants

[0030] To further improve the thermostability of xylanase H1, its protein structure was analyzed. This protein belongs to the GH11 family of xylanases, and its structure is a β-jelly roll structure, with both the protein surface and the active site exposed to the external environment. Therefore, changes in the external environment, especially high temperatures, can directly affect both the stability of the enzyme's surface structure and the stability of its active site. To improve the enzyme's tolerance to high temperatures, it is necessary to increase the overall rigidity of the protein and stabilize its overall structure. This can be achieved by further mutation of the gene without disrupting the enzyme's secondary structure and active site.

[0031] 1.1 Design of PCR primers H1-F1 and H1-R1:

[0032] H1-F1: GGC GAATTC ATGATGATTGGTATCACTTCTTTTGC (The underlined part is the EcoRI restriction enzyme recognition site);

[0033] H1-R1: ATA GCGGCCGC TTAACCGACGTCTGCAACGGTAATTC (The underlined part is the NotI restriction enzyme recognition site).

[0034] Using the H1 gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutagenesis PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The ligation product was then transformed into Escherichia coli BL21(DE3), plated on LB-Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain E. coli cell lysate containing xylanase.

[0035] Two lysis buffers were taken and treated as follows: the first lysis buffer was diluted with pH 8.0 buffer, and the second lysis buffer was diluted with pH 8.0 buffer and then treated at 75℃ for 5 min. Then, 30 μL of the above-treated lysis buffer was taken into two new 96-well plates. 30 μL of substrate prepared with the corresponding buffer was added to each of the two 96-well plates. After reacting at 50℃ for 30 min, the reducing sugar generated was determined by the DNS method, and the residual enzyme activity of the mutant was calculated.

[0036] Experimental results showed that different mutants retained varying activities after high-temperature treatment. Some mutations had no effect on the thermostable properties of xylanase, while others even worsened its thermostable properties or enzyme activity. Still others, although improving the thermostable properties of xylanase, caused significant changes in its enzymatic properties, which did not meet the requirements. Ultimately, the applicant screened a mutation site, N165H, that could significantly improve the thermostable properties of xylanase H1 without affecting its enzyme activity and original enzymatic properties.

[0037] Based on wild-type xylanase H1, this invention provides a mutant containing a single point mutation of N165H.

[0038] Example 3: Expression of xylanase in Pichia pastoris

[0039] 3.1 Construction of expression plasmids

[0040] Based on the codon preference of Pichia pastoris, the gene sequences of alkaline xylanase H1 and its mutants were optimized and synthesized by Shanghai Jierui Biotechnology Co., Ltd., with EcoRI and NotI restriction sites added at the 5' and 3' ends of the synthesized sequences, respectively.

[0041] Following the method described in Example 1, the gene sequences of the synthesized xylanase H1 and its mutants were double-digested with EcoRI and NotI, respectively. Then, they were ligated into the pPIC-9K vector, which had undergone similar digestion, overnight at 16°C, and transformed into *E. coli* DH5α. The transformed samples were plated on LB-Amp plates and incubated upside down at 37°C. After transformants appeared, colony PCR was performed (reaction system: single clones picked from the template, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM) 0.5 μL, 3' AOX primer 0.5 μL, ddH2O 14.5 μL; reaction program: 95°C pre-denaturation for 5 min, 30 cycles: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). Positive clones were verified, and the correct recombinant expression plasmid was obtained after sequencing.

[0042] 3.2 Construction of Pichia pastoris engineered strains

[0043] 3.2.1 Preparation of competent yeast cells

[0044] Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30°C for 48 h. Then, a single activated GS115 colony was inoculated into 6 mL of YPD liquid medium and cultured at 30°C and 220 rpm for approximately 12 h. The culture was then transferred to 30 mL of YPD liquid medium. In Erlenmeyer flasks containing YPD liquid culture medium, the cells were incubated at 30°C and 220 rpm for approximately 5 hours. Cell density was measured using a UV spectrophotometer. Once the OD600 value was within the range of 1.1–1.3, 4 mL of cells were collected by centrifugation at 9000 rpm for 2 minutes at 4°C into sterile EP tubes. The supernatant was gently discarded, and any remaining supernatant was blotted dry with sterile filter paper. The cells were then resuspended in 1 mL of pre-cooled sterile water. After centrifugation at 9000 rpm for 2 minutes at 4°C, the supernatant was gently discarded. The cells were washed once more with 1 mL of sterile water, then centrifuged again at 9000 rpm for 2 minutes at 4°C, and the supernatant was gently discarded. The cells were then resuspended in 1 mL of pre-cooled sorbitol (1 mol / L). Finally, the cells were centrifuged again at 9000 rpm for 2 minutes at 4°C, and the supernatant was gently discarded. The cells were then gently resuspended in 100–150 μL of pre-cooled sorbitol (1 mol / L).

[0045] 3.2.2 Conversion and Screening

[0046] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were screened on MD plates, and multi-copy transformants were then screened on YPD plates (0.5 mg / mL-8 mg / mL) containing different concentrations of genimycin.

[0047] The obtained transformants were transferred to BMGY medium and cultured at 30℃ and 250 rpm for 1 day with shaking. They were then transferred to BMMY medium and cultured at 30℃ and 250 rpm with shaking. 0.5% methanol was added daily to induce expression for 4 days. The cells were removed by centrifugation at 9000 rpm for 10 min to obtain fermentation supernatants containing xylanase H1 and xylanase mutants, respectively.

[0048] 1. Xylanase activity assay

[0049] (1) Definition of xylanase activity unit

[0050] Under conditions of 50℃ and pH 8.0, the amount of enzyme required to degrade and release 1 μmol of reducing sugar per minute from a xylan solution with a concentration of 5 mg / mL is defined as one unit of enzyme activity, denoted by U.

[0051] (2) Method for determining xylanase activity

[0052] Take 10.0 mL of xylan solution and equilibrate at 50 °C for 20 min.

[0053] Take 10.0 mL of appropriately diluted enzyme solution and equilibrate at 50°C for 5 min.

[0054] Blank sample determination: Pipette 2.00 mL of appropriately diluted enzyme solution (equilibrated at 50℃) into a graduated test tube, add 5 mL of DNS reagent, and vibrate electromagnetically for 3 s. Then add 2.0 mL of xylan solution, equilibrate at 50℃ for 30 min, and heat in a boiling water bath for 5 min. Cool to room temperature with tap water, add water to a final volume of 25 mL, and vibrate electromagnetically for 3–5 s. Using the standard blank sample as a blank control, measure the absorbance A at 540 nm. B .

[0055] Sample determination: Pipette 2.00 mL of appropriately diluted enzyme solution (equilibrated at 50℃) into a graduated test tube, then add 2.0 mL of xylan solution (equilibrated at 50℃), vibrate electromagnetically for 3 s, and precisely incubate at 50℃ for 30 min. Add 5.0 mL of DNS reagent, vibrate electromagnetically for 3 s to terminate the enzymatic reaction. Heat in a boiling water bath for 5 min, cool to room temperature with tap water, and dilute to 25 mL with water, vibrating electromagnetically for 3 s. Using a standard blank sample as a blank control, measure the absorbance A at 540 nm. E .

[0056] Formula (1): X D =[(A E -A B )×K+C0]×1000 / (M×t).

[0057] In the formula:

[0058] X D — Xylanase activity in the sample dilution, U / mL;

[0059] A E —Absorbance of the enzyme reaction solution;

[0060] A B —Absorbance of the enzyme blank sample;

[0061] K—the slope of the standard curve;

[0062] C0—The intercept of the standard curve;

[0063] M—Molar mass of xylose M(C5XYN) 110 O5) = 150.2 g / mol;

[0064] t—Enzymatic hydrolysis reaction time, min;

[0065] 1000 — conversion factor, 1 mmol = 1000 μmol;

[0066] X DThe value should be between 0.04 and 0.10 U / mL. If it is not within this range, the enzyme dilution should be changed and the analysis should be performed again.

[0067] Formula (2): X = X D ·D f .

[0068] In the formula:

[0069] X—Xylanase activity in the sample, U / mL;

[0070] D f —The dilution factor of the sample.

[0071] The calculated enzyme activity values ​​are retained to three significant figures.

[0072] 2. Heat resistance analysis

[0073] The supernatant from the fermentation of the above-mentioned recombinant Pichia pastoris strain was diluted to 200 U / mL with 0.1 M disodium hydrogen phosphate-0.05 M citric acid, and then diluted 10-fold with a buffer preheated for 10 min. After mixing thoroughly, the mixture was treated at 80℃ and 85℃ for 30 min respectively. Samples were taken at the end of the treatment and cooled to room temperature. The xylanase activity was then measured, and the enzyme activity residual rate was calculated as 100% of the enzyme activity of the untreated sample. The specific results are shown in Table 1.

[0074] Enzyme activity residual rate (%) = enzyme activity of treated sample / enzyme activity of untreated sample × 100%.

[0075] Table 1. Heat resistance analysis of xylanase H1 and its mutants

[0076]

[0077] As shown in Table 1, compared with wild-type xylanase H1, the mutant containing the N165H mutation site provided by this invention has significantly improved heat resistance. After treatment at 80℃ for 30 min, the enzyme activity residual rate increased by 47.24%, and after treatment at 85℃ for 30 min, the enzyme activity residual rate increased by 73.4%, achieving unexpected technical effects.

[0078] In summary, the heat resistance of the alkaline xylanase mutant provided by this invention is significantly improved, which is conducive to its widespread promotion and application in the industrial field.

Claims

1. A xylanase mutant, characterized in that, The mutant is obtained by mutating the 165th amino acid of xylanase with the amino acid sequence SEQ ID NO:1 from Asn to His.

2. A DNA molecule encoding the xylanase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3.

5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ).

Citation Information

Patent Citations

  • Pichia pastoris for highly producing alkaline xylanase and application of pichia pastoris

    CN104450542A

  • High-specific-activity alkaline xylanase mutant and application thereof

    CN116218818A