Preparation method and application of inclusion body based on double-promoter expression plasmid

Abstract

The invention discloses a preparation method and application of an inclusion body based on double promoter expression plasmids, and belongs to the technical field of biology. The method comprises the following steps: screening all-potent nuclease, purifying all-potent nuclease, verifying degradation activity of all-potent nuclease DNS on nucleic acid, constructing a double-promoter recombinant strain, culturing in a fermentation tank, recovering thalli, and crushing the thalli to obtain an inclusion body crude product. The T7 promoter is used for inducing high-efficiency expression of the recombinant human growth hormone gene, the cspA promoter is used for inducing high-activity expression of the totipotent nuclease gene DNS, the application effect in the recombinant human growth hormone is remarkable, in the preparation process, the thallus viscosity is low, the homogenate crushing effect is improved, the BL21 (DE3) / DGH thallus crushing rate is high, and the application range is wide. The content of inclusion bodies harvested by centrifuging fermentation liquor in unit volume is high, the residual quantity of HCD (host DNA residues) in target protein in unit mass is reduced, and the energy consumption is effectively reduced.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more particularly to a preparation method of inclusion bodies based on a dual-promoter expression plasmid and applications thereof. Background Art

[0002] Escherichia coli is the main vector for conventional expression of recombinant proteins. For E. coli and other non-secretory expression systems, protein recovery from cells is crucial, which often requires cell lysis. Common cell lysis methods include chemical methods (alkali or detergents), biochemical methods (lysozyme), and mechanical methods (cell disruptors, French filter presses, or ultrasonic treatment). These methods are not only time-consuming and labor-intensive, but also difficult to ensure consistent results. Some proteins may not tolerate the use of chemical lysis buffers, and mechanical methods may result in incomplete lysis and release of the target protein.

[0003] There are two main approaches for expressing recombinant human growth hormone in E. coli: periplasmic secretion and intracellular inclusion body expression. Intracellular inclusion body expression of human growth hormone protein requires cell disruption to obtain crude inclusion bodies, but mechanical disruption is often energy-intensive and time-consuming. Summary of the Invention

[0004] The present invention aims to overcome the shortcomings of the prior art by providing a method for preparing inclusion bodies based on a dual-promoter expression plasmid and its application. Through the efficient and highly active expression of the dual promoter, the present invention effectively reduces bacterial cell viscosity, improves homogenization and cell fragmentation, and increases cell fragmentation rate, effectively reducing energy consumption.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] A method for preparing inclusion bodies based on a dual-promoter expression plasmid comprises the following steps:

[0007] (1) Screening of omnipotent nucleases: The omnipotent nucleotide and amino acid sequences were codon-optimized to obtain the omnipotent nuclease DNS gene sequence, as shown in SEQ ID NO: 1. The obtained omnipotent nuclease DNS gene sequence was synthesized into a vector, and then the vector containing the omnipotent nuclease DNS gene was transformed into a BL21 (DE3) competent cell. LB-Kan plates were coated, and single clones were selected and inoculated into LB medium. Kan was added, and the cells were cultured overnight. The cells were transferred to new LB medium, Kan was added, and the cells were cultured until the OD 600 When the value reaches 0.6-0.8, IPTG is added for induction, cultured overnight at 25°C, and the cells are collected, resuspended, and ultrasonically disrupted;

[0008] (2) Purification of universal nuclease: Purification is performed using a chromatography column filled with Ni Seplife FF (NTA) filler. The purification steps include equilibration, sample loading, washing, elution, protein dialysis, column regeneration, and column storage.

[0009] (3) Construction of dual-promoter recombinant strain: The gene sequence of the universal nuclease DNS was synthesized into a plasmid containing the recombinant human growth hormone gene to obtain a dual-promoter plasmid, which was transformed into BL21(DE3) competent cells and plated on LB-Kan plates to obtain the engineered strain BL21(DE3) / DGH;

[0010] (4) Fermentation tank culture: Inoculate BL21(DE3) / DGH into LB medium, add kanamycin sulfate, culture at 30°C overnight, then transfer to a fermentation tank for fermentation culture at 30°C for 6-7 hours. The bacterial concentration OD 600 ≥100.0, add inducer IPTG for induction, after induction at 28℃, cool to 15℃, continue induction culture to obtain fermentation broth;

[0011] (5) Bacteria recovery: The fermentation broth is centrifuged to obtain bacteria;

[0012] (6) Crushing the cells to obtain crude inclusion bodies: adding lysis buffer to the cells, crushing them using a high-pressure homogenizer, collecting the inclusion body precipitate, and obtaining crude inclusion body products;

[0013] (7) Preparation of pure inclusion bodies: Wash the crude inclusion bodies to obtain pure inclusion bodies.

[0014] Furthermore, in step (1), the vector is pET-28a(+) vector, the final concentration of Kan is 50 mg / L, the overnight culture temperature is 37° C., the rotation speed is 220 rpm, the final concentration of IPTG is 0.5 mM, and PBS with pH 7.0 is used for resuspension.

[0015] Furthermore, in step (4), the dual-promoter plasmid includes a T7 promoter and a cspA promoter, the recombinant human growth hormone gene is regulated by the T7 promoter, and the omnipotent nuclease DNS gene is regulated by the cspA promoter.

[0016] Furthermore, in step (5), the rotation speed of the fermentation tank culture is 600 rpm, the pH is adjusted to neutral with ammonia water, the ventilation volume is 3.0 L / min, and the dissolved oxygen is 60%.

[0017] Furthermore, in step (6), the centrifugation parameter is 15000 rpm / min for 30 minutes.

[0018] Furthermore, in step (7), the broken bacteria under a pressure of 1000 bar are centrifuged at 4° C. and 9000 rpm for 30 min to collect the inclusion body precipitate.

[0019] The invention discloses an application of inclusion bodies based on a dual-promoter expression plasmid in the preparation of recombinant human growth hormone.

[0020] In summary, the present invention has the following beneficial effects:

[0021] The present invention induces high-efficiency expression of the recombinant human growth hormone gene through the T7 promoter and high-activity expression of the omnipotent nuclease gene DNS through the cspA promoter, and has significant application effect in recombinant human growth hormone. During the preparation process, the bacterial cell viscosity is low, the homogenization fragmentation effect is improved, the BL21 (DE3) / DGH bacterial cell fragmentation rate is high, the inclusion body content harvested by centrifugation per unit volume of fermentation liquid is high, the HCD (host DNA residue) residue in the unit mass of the target protein is reduced, and energy consumption is effectively reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The SDS-PAGE electrophoresis diagram of the universal nuclease;

[0023] Figure 2 SDS-PAGE electrophoresis to verify the nucleic acid degradation activity of the universal nuclease DNS;

[0024] Figure 3 This is the map of the dual-promoter plasmid DGH;

[0025] Figure 4 This is a map of plasmid GH-2023 containing only the recombinant human growth hormone gene;

[0026] Figure 5 The SDS-PAGE electrophoresis diagram of BL21(DE3) / DGH and BL21(DE3) / GH-2023 after induction in fermenter culture;

[0027] Figure 6 This is a comparison of the centrifugation status of samples after cell wall disruption of BL21(DE3) / DGH and BL21(DE3) / GH-2023;

[0028] Figure 7 Comparison of Gram staining of BL21(DE3) / DGH and BL21(DE3) / GH-2023 bacterial cell wall broken samples;

[0029] Figure 8 The figure shows the comparison of colony growth of BL21(DE3) / DGH and BL21(DE3) / GH-2023 samples before and after cell wall disruption. DETAILED DESCRIPTION

[0030] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0031] Example

[0032] Step 1: Universal nuclease screening

[0033] The amino acid sequence of the universal nuclease was codon-optimized to obtain the DNS gene sequence, and the optimized sequence is shown in SEQ ID NO: 1. GenScript Biotech Co., Ltd. was commissioned to synthesize the target gene into the pET-28a(+) vector. The recombinant plasmid was transformed into the competent Escherichia coli BL21 (DE3) by heat shock at 42°C. After the transformation, the bacterial liquid was spread on the LB-Kan plate, and a single clone was selected and inoculated into 100 mL LB medium. Kan (i.e., kanamycin, Kan final concentration of 50 mg / L) was added, and cultured at 37°C, 220 rpm overnight. It was then transferred to a new 100 mL LB medium, Kan (final concentration of 50 mg / L) was added, and cultured at 37°C, 220 rpm until the OD 600 The value was raised to 0.7, IPTG was added to a final concentration of 0.5 mM, and the cells were induced at 25°C overnight. After the cells were collected, they were resuspended in PBS with pH = 7.0 and ultrasonically disrupted. The supernatant was obtained and submitted for SDS-PAGE. The SDS-PAGE electrophoresis of the universal nuclease is shown in Figure 2. Figure 1 As shown (in the figure, M: marker; lane 1: supernatant obtained by screening and breaking the cell wall with the universal nuclease; lane 2: precipitate obtained by screening and breaking the cell wall with the universal nuclease; lane 3: impurities not attached to the column in step 3 of purification of the universal nuclease; lane 4: target protein eluted in step 4 of purification of the universal nuclease), the universal nuclease is expressed in a soluble form.

[0034] SEQ ID NO 1:

[0035] GCAGATACGTTAGAAAGCATCGATAATTGCGCCGTTGGTTGTCCGACGGGGTGGTAGTAGCAATGTGTCTATTGTTCGTCATGCCTATACCCTGAATAATAATTCAACAACCAAATTTGCCAATTGGGTTGCGTATCATATCACCAAAGATACACCAGCGAGCGGTAAAACCCGCAATTGGAAAA CCGATCCTGCTCTGAATCCAGCGGATACGCTGGCTCCGCCCGATTATACGGGTGCTAATGCTGCACTGAAAGTGGATCGCGGTCATCAGGCCCCTTTAGCTAGTTTAGCTGGTGTGAGTGATTGGGAATCTCTGAATTATTTAAGTAATATTACACCTCAGAAAAGCGATTTAAATCAGGGCGCA TGGGCTCGCTTAGAAGATCAGGAACGCAAACTGATCGATCGTGCAGACATTTCTTCTGTGTATACAGTGACAGGTCCACTGTATGAACGCGATATGGGCAAACTGCCTGGCACACAGAAAGCACATACCATCCCGAGTGCGTATTGGAAAGTTATCTTTATCAATAATAGTCCAGCCGTTAATC ATTATGCAGCCTTTCTGTTTGATCAGAATACGCCTAAAGGCGCCGATTTTTGCCAGTTTCGCGTGACCGTGGATGAAT

[0036] Step 2: Purification of universal nuclease

[0037] Purification was performed using a 10 mL column containing Ni Seplife FF (NTA). The specific purification steps were as follows:

[0038] 1. Equilibration: Rinse with buffer A (i.e., pure water) until the conductivity equilibrium is 0, then pre-wash with buffer D (50 mM Tris, 250 mM NaCl, 500 mM imidazole, pH = 8.0) for 3 CV, and then rinse with buffer B (50 mM Tris, 250 mM NaCl, 25 mM imidazole, pH = 8.0) until equilibrium;

[0039] 2. Load the sample;

[0040] 3. Wash: Use buffer B to rinse until UV280 reaches equilibrium;

[0041] 4. Elution: Wash with C buffer (50 mM Tris, 250 mM NaCl, 250 mM imidazole, pH = 8.0);

[0042] 5. Protein dialysis: Add the eluted sample to a dialysis bag, clamp the upper end of the dialysis bag with a dialysis clip, and suspend the dialysis bag in dialysis storage solution (ensure that the sample is immersed in the dialysis storage solution, the volume ratio of sample to dialysis storage solution is 1:20; the dialysis storage solution is: 20mM Tris, pH=7.5, 50mM NaCl, 1mM MgCl2, 50% glycerol), place it in a chromatography refrigerator and perform magnetic stirring dialysis for 4 hours. Remove the obtained DNS enzyme solution sample and store it at -20°C;

[0043] 6. Column regeneration: flush with D buffer for 3CV, then flush with A buffer for 3CV;

[0044] 7. Column storage: Rinse with E buffer (20% ethanol) for 3CV.

[0045] Step 3: Verification of the nucleic acid degradation activity of the universal nuclease DNS

[0046] The plasmid DNA extracted from BL21 was used as a sample to test the activity of the purified universal nuclease DNS, specifically:

[0047] 1. Prepare sample solutions: undiluted DNS enzyme solution, 2-fold diluted DNS enzyme solution, 4-fold diluted DNS enzyme solution, 8-fold diluted DNS enzyme solution, 16-fold diluted DNS enzyme solution, and 5uL storage solution (same as the dialysis storage solution in step 2); DNS enzyme solution is diluted with ddH2O.

[0048] 2. Reaction steps: Take 5uL of sample solution, add 5ug plasmid DNA, make up the volume to 20uL with ddH2O, heat in a water bath at 37℃ for 30min, and add 2μL 50mM EDTA to terminate the reaction. After terminating the reaction, take 5μL of the reaction sample for agarose gel electrophoresis detection. The test results are as follows: Figure 2 As shown (in the figure: M: marker; lane 1: undiluted DNS enzyme solution; lane 2: 2-fold diluted DNS enzyme solution; lane 3: 4-fold diluted DNS enzyme solution; lane 4: 8-fold diluted DNS enzyme solution; lane 5: 16-fold diluted DNS enzyme solution; lane 6: plasmid DNA added with 5uL storage solution; lane 7: plasmid DNA). Figure 2It can be seen that the purified universal nuclease has a good degradation effect on plasmid DNA samples.

[0049] Step 4: Construction of dual-promoter recombinant strain

[0050] GenScript Biotech was commissioned to synthesize the gene sequence of the omnipotent nuclease DNS into a plasmid containing the recombinant human growth hormone gene, named DGH. Figure 3 As shown, the T7 promoter induces expression of the recombinant human growth hormone gene, while the cspA promoter induces expression of the dnuclide gene. A lacO regulatory sequence was inserted downstream of the cspA promoter. The dual-promoter plasmid DGH was transformed into competent BL21(DE3) cells via heat shock at 42°C and plated onto LB-Kan plates to generate the engineered strain BL21(DE3) / DGH.

[0051] Step 5: Fermentation Tank Culture

[0052] LB medium parameters: 5 g / L yeast powder, 10 g / L sodium chloride, 10 g / L peptone, adjusted to neutral pH with sodium hydroxide, sterilized at 121°C;

[0053] Fermentation tank culture medium parameters: 5.8 g / L yeast powder, 4 g / L dipotassium hydrogen phosphate, 4 g / L potassium dihydrogen phosphate, 7 g / L disodium hydrogen phosphate, 1.2 g / L magnesium sulfate, 0.2 g / L ammonium chloride, 1.2 g / L ammonium sulfate, 0.02 g / L calcium chloride, sterilized at 121°C;

[0054] Feed medium parameters: 30 g / L peptone, 15 g / L yeast powder, 7 g / L dipotassium hydrogen phosphate, 7 g / L potassium dihydrogen phosphate, 10 g / L disodium hydrogen phosphate, 2.5 g / L magnesium sulfate, 10 g / L ammonium chloride, sterilized at 121 °C.

[0055] BL21(DE3) / DGH was inoculated into 180 mL of LB medium, and kanamycin sulfate (final concentration 50 mg / L) was added. The culture was incubated at 30°C and 220 rpm overnight.

[0056] 180mL of shake flask seeds were transferred to a fermenter (5L) filled with 1.8L of fermenter medium for fermentation culture. The culture temperature was 30.0℃ and the rotation speed was 600rpm. During the culture, the pH was adjusted to neutral with ammonia water, the ventilation volume was controlled at 3.0L / min, and the dissolved oxygen was 60%. During the culture process, when the carbon source was consumed, the pH value showed an upward trend, and the dissolved oxygen increased, the feed medium was used for feeding and the feeding rate was adjusted to maintain sufficient carbon source, neutral pH, and 60% dissolved oxygen in the fermenter. After culturing for 6 hours, the bacterial concentration OD 600≥100.0 (the culture time can be adjusted between 6 and 7 h according to the bacterial concentration), add 2 g of IPTG inducer for induction, induce at 28 ° C for 3 h, then cool to 15 ° C, continue induction culture for 3 h, and take samples for SDS-PAGE inspection.

[0057] Step 6: Bacteria recovery

[0058] The fermentation broth was centrifuged to obtain the bacterial cells, and the centrifugation parameters were 15000 rpm / min and 30 minutes.

[0059] Step 7: Crush the cells to obtain crude inclusion bodies

[0060] At a bacterial concentration of 150 g / L, the bacteria were added to a lysis buffer (containing 20 mM Tris (tromethamine), 2 mM metal ion chelator EDTA, 1.2 M denaturant urea, 3% non-ionic surfactant Triton X-100, pH 7.5), and then the resuspended mixture was broken using a high-pressure homogenizer at a pressure of 600 bar. The homogenate was broken three times and samples were taken to detect the cell wall breakage. (As needed, the Tris (tromethamine) content in the lysis buffer can be adjusted between 10 and 50 mM; the metal chelator EDTA can be adjusted between 0.1 and 5 mM, and replacing it with EGTA can achieve the same effect as EDTA; the denaturant urea can be adjusted between 0.5 and 2 M, and replacing it with 0.1 to 0.5 M guanidine hydrochloride can achieve the same effect as urea; the non-ionic surfactant Triton X-100 can be adjusted between 1 and 5%, and replacing it with Tween-20 can achieve the same effect as Triton X-100; the pH can be adjusted between 7.0 and 8.5)

[0061] At a bacterial concentration of 150 g / L, the bacteria were added to a lysis buffer (with the same parameters as the above lysis buffer) and crushed three times at a pressure of 1000 bar to completely lyse the bacteria. The mixture was centrifuged at 4°C and 9000 rpm for 30 min, and the inclusion body precipitate was collected. The inclusion body yield was calculated.

[0062] Step 8: Preparation of pure inclusion bodies

[0063] According to the "step 6, inclusion body washing" operation described in the patent publication number CN118515782A, pure inclusion bodies were obtained.

[0064] Step 9: Application of inclusion bodies in the preparation of recombinant human growth hormone

[0065] The inclusion bodies were taken and the recombinant human growth hormone was obtained according to "steps 7 to 15" described in the patent publication number CN118515782A.

[0066] Comparative Example

[0067] We commissioned GenScript Biotech to construct a plasmid containing the recombinant human growth hormone gene, named GH-2023. Figure 4 After heat shock at 42°C, the cells were transformed into competent BL21(DE3) strains and plated onto LB-Kan plates to obtain engineered strain BL21(DE3) / GH-2023. The cells were then operated according to steps 5 to 7 of the example.

[0068] The SDS-PAGE electrophoresis diagram of the embodiment and the comparative example is as follows: Figure 5 As shown in the figure (M: marker; lane 1: BL21(DE3) / DGH; lane 2: BL21(DE3) / GH-2023), it was found that the recombinant human growth hormone was expressed at 22KD, and the DGH band at 65KD was wider, which was expressed by a small amount of omnipotent nuclease.

[0069] The cell wall breaking detection method in step 7 of the embodiment and the comparative example is as follows: (1) an equal amount of cell wall breaking samples are taken and centrifuged at a speed of 8500 rpm and 4°C for 10 minutes to observe the cell wall breaking. Figure 6 As shown in the figure, both were centrifuged without stratification, indicating that the inclusion bodies were of good quality and uniform. (2) An equal amount of cell wall-broken samples were taken for Gram staining, and the cell wall-broken state was observed under a 100× oil immersion lens. Figure 7 As shown in the figure, DGH had no complete bacterial cells, while GH-2023 had complete bacterial cells; (3) 50uL of the broken cell samples were taken and evenly spread on LB-Kan plates with glass beads. The plates were cultured at 37℃ for 17h and the growth of the colonies was observed (the growth of the colonies was shown in the figure). Figure 8 The wall-breaking rate was calculated as shown in Table 1.

[0070] Table 1

[0071]

[0072] The inclusion body yields in step 7 of the Examples and Comparative Examples are shown in Table 2.

[0073] Table 2

[0074] name Inclusion body yield BL21(DE3) / DGH 29％ BL21(DE3) / GH-2023 25％

[0075] The above description is merely a preferred embodiment of the present invention. The scope of protection of the present invention is not limited to the above embodiment. All technical solutions based on the concept of the present invention are within the scope of protection of the present invention. It should be noted that for those skilled in the art, various improvements and modifications that do not depart from the principles of the present invention should also be considered within the scope of protection of the present invention.

Claims

1. A method for preparing inclusion bodies based on a dual promoter expression plasmid, characterized in that: The following steps are involved: (1) Screening of omnipotent nucleases: The omnipotent nucleotide and amino acid sequences were codon-optimized to obtain the omnipotent nuclease DNS gene sequence, as shown in SEQ ID NO:

1. The obtained omnipotent nuclease DNS gene sequence was synthesized into a vector, and then the vector containing the omnipotent nuclease DNS gene was transformed into a BL21 (DE3) competent cell. LB-Kan plates were coated, and single clones were selected and inoculated into LB medium. Kan was added, and the cells were cultured overnight. The cells were transferred to new LB medium, Kan was added, and the cells were cultured until the OD 600 When the value reaches 0.6-0.8, IPTG is added for induction, cultured overnight at 25°C, and the cells are collected, resuspended, and ultrasonically disrupted; (2) Purification of universal nuclease: Purification is performed using a chromatography column filled with Ni Seplife FF (NTA) filler. The purification steps include equilibration, sample loading, washing, elution, protein dialysis, column regeneration, and column storage. (3) Construction of dual-promoter recombinant strain: The gene sequence of the universal nuclease DNS was synthesized into a plasmid containing the recombinant human growth hormone gene to obtain a dual-promoter plasmid, which was transformed into BL21(DE3) competent cells and plated on LB-Kan plates to obtain the engineered strain BL21(DE3) / DGH; (4) Fermentation tank culture: Inoculate BL21(DE3) / DGH into LB medium, add kanamycin sulfate, culture at 30°C overnight, then transfer to a fermentation tank for fermentation culture at 30°C for 6-7 hours. The bacterial concentration OD 600 ≥100.0, add inducer IPTG for induction, cool to 15°C after induction at 28°C, continue induction culture to obtain fermentation broth; (5) Bacteria recovery: The fermentation broth is centrifuged to obtain bacteria; (6) Crushing the cells to obtain crude inclusion bodies: adding lysis buffer to the cells, crushing them using a high-pressure homogenizer, collecting the inclusion body precipitate, and obtaining crude inclusion body products; (7) Preparation of pure inclusion bodies: Wash the crude inclusion bodies to obtain pure inclusion bodies.

2. The method for preparing inclusion bodies based on a dual promoter expression plasmid according to claim 1, characterized in that: In step (1), the vector is pET-28a(+) vector, the final concentration of Kan is 50 mg / L, the overnight culture temperature is 37° C., the rotation speed is 220 rpm, the final concentration of IPTG is 0.5 mM, and PBS with pH 7.0 is used for resuspension.

3. The method for preparing inclusion bodies based on a dual promoter expression plasmid according to claim 1, characterized in that: In the step (4), the dual-promoter plasmid includes a T7 promoter and a cspA promoter, the recombinant human growth hormone gene is regulated by the T7 promoter, and the omnipotent nuclease DNS gene is regulated by the cspA promoter.

4. The method for preparing inclusion bodies based on a dual promoter expression plasmid according to claim 1, characterized in that: In the step (5), the rotation speed of the fermentation tank is 600 rpm, the pH is adjusted to neutral with ammonia water, the ventilation volume is 3.0 L / min, and the dissolved oxygen is 60%.

5. The method for preparing inclusion bodies based on a dual promoter expression plasmid according to claim 1, characterized in that: In the step (6), the centrifugation parameters are 15000 rpm / min and 30 minutes.

6. The method for preparing inclusion bodies based on a dual promoter expression plasmid according to claim 1, characterized in that: In the step (7), the broken bacteria under a pressure of 1000 bar are centrifuged at 4° C. and 9000 rpm for 30 min to collect the inclusion body precipitate.

7. Use of the inclusion body based on the dual promoter expression plasmid according to any one of claims 1 to 6 in the preparation of recombinant human growth hormone.

Images