A method for preparing inclusion bodies based on dual promoter expression plasmids and its application

By combining dual-promoter expression plasmids with a high-pressure homogenizer, the problems of high energy consumption and incomplete lysis in the expression of recombinant proteins in E. coli were solved, achieving efficient and low-energy inclusion body preparation, and improving the breakage rate and yield.

CN120624490BActive Publication Date: 2026-05-26浙江毓昌生物技术有限公司
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
浙江毓昌生物技术有限公司
Filing Date
2025-05-28
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

In existing technologies, when expressing recombinant proteins in E. coli, cell lysis methods are time-consuming, labor-intensive, and yield inconsistent results, while mechanical methods are energy-intensive and suffer from incomplete lysis of proteins expressed in intracellular inclusion bodies.

Method used

A dual-promoter expression plasmid method was adopted, which induced the efficient expression of recombinant human growth hormone gene by T7 promoter and totipotent nuclease gene DNS by cspA promoter. The bacterial cells were then disrupted by high pressure homogenizer to reduce bacterial viscosity and improve disruption efficiency.

Benefits of technology

This method achieves efficient expression and low-energy preparation of inclusion bodies, improves cell disruption rate and the yield of inclusion bodies per unit volume of fermentation broth, and reduces the amount of residual host DNA.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624490B_ABST
    Figure CN120624490B_ABST
Patent Text Reader

Abstract

This invention discloses a method for preparing inclusion bodies based on dual-promoter expression plasmids and its application, belonging to the field of biotechnology. The invention includes screening of totipotent nucleases, purification of totipotent nucleases, verification of the degradation activity of the totipotent nuclease DNS on nucleic acids, construction of dual-promoter recombinant strains, fermenter culture, cell recovery, and cell disruption to obtain crude inclusion bodies. This invention achieves high-efficiency expression of the recombinant human growth hormone gene induced by the T7 promoter and high-activity expression of the totipotent nuclease gene DNS induced by the cspA promoter, demonstrating significant effects in the application of recombinant human growth hormone. During the preparation process, the cell viscosity is low, the homogenization and disruption effect is improved, the BL21(DE3) / DGH cell disruption rate is high, the inclusion body content harvested by centrifugation per unit volume of fermentation broth is high, and the residual amount of HCD (host DNA residue) in the target protein per unit mass is reduced, effectively reducing energy consumption.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a method for preparing inclusion bodies based on dual promoter expression plasmids and their applications. Background Technology

[0002] Escherichia coli is a primary vector for the routine expression of recombinant proteins. For E. coli and other non-secretory expression systems, protein recovery from cells is crucial, often requiring cell lysis. Common cell lysis methods include chemical methods (alkali or detergents), biochemical methods (lysozyme), and mechanical methods (cell disruptors, French presses, or ultrasonic treatment). These methods are not only time-consuming and labor-intensive, but also inconsistent in their results. Some proteins may not tolerate chemical lysis buffers, while mechanical methods may lead to incomplete lysis and release of the target protein.

[0003] There are two main technical routes for expressing recombinant human growth hormone using E. coli: periplasmic space secretion and intracellular inclusion body expression. Intracellular inclusion body expression of human growth hormone protein requires cell wall disruption to obtain crude inclusion bodies, but this is often done mechanically, which is energy-intensive and time-consuming. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for preparing inclusion bodies based on dual-promoter expression plasmids and its application. This invention, through the high-efficiency and high-activity expression of dual promoters, effectively reduces bacterial cell viscosity, improves homogenization and disruption, increases cell breakage rate, and effectively reduces energy consumption.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A method for preparing inclusion bodies based on dual-promoter expression plasmids includes the following steps:

[0007] (1) Screening of totipotent nucleases: The amino acid sequence of the totipotent nuclease was codon optimized to obtain the totipotent nuclease DNS gene sequence, as shown in SEQ ID NO: 1. The obtained totipotent nuclease DNS gene sequence was synthesized into a vector. Subsequently, the vector containing the totipotent nuclease DNS gene was transformed into BL21(DE3) competent cells, plated on LB-Kan plates, single clones were selected, inoculated into LB medium, Kan was added, and cultured overnight. The cells were then transferred to new LB medium, Kan was added, and cultured until OD. 600 Adjust the pH to 0.6–0.8, add IPTG to induce incubation, incubate overnight at 25°C, collect the cells, resuspend, and sonicate to disrupt.

[0008] (2) Purification of pluripotent nuclease: Purification was performed using a chromatography column packed with Ni Seplife FF (NTA) packing material. The purification steps were: equilibration, sample loading, washing, elution, protein dialysis, column regeneration, and column preservation.

[0009] (3) Construction of dual promoter recombinant strain: The totipotent nuclease DNS gene sequence was synthesized into a plasmid containing the recombinant human growth hormone gene to obtain a dual promoter plasmid, which was transformed into BL21(DE3) competent cells and plated on LB-Kan plates to obtain the engineered strain BL21(DE3) / DGH;

[0010] (4) Fermenter culture: BL21(DE3) / DGH was inoculated into LB medium, kanamycin sulfate was added, and the culture was carried out overnight at 30°C. The culture was then transferred to a fermenter for fermentation and cultured at 30°C for 6–7 hours. The cell concentration OD 600 ≥100.0, add IPTG inducer for induction, induce at 28℃, cool to 15℃, continue induction culture to obtain fermentation broth;

[0011] (5) Cell recovery: Cells were obtained by centrifuging the fermentation broth;

[0012] (6) Obtaining crude inclusion bodies by cell disruption: The cells were added to lysis buffer and disrupted using a high-pressure homogenizer. The inclusion body precipitate was collected to obtain crude inclusion bodies.

[0013] (7) Preparation of pure inclusion bodies: Wash the crude inclusion bodies to obtain pure inclusion bodies.

[0014] Furthermore, in step (1), the vector was pET-28a(+), the final concentration of Kan was 50 mg / L, the overnight culture temperature was 37°C, the rotation speed was 220 rpm, the final concentration of IPTG was 0.5 mM, and PBS with pH 7.0 was used for resuspension.

[0015] Furthermore, in step (4), the dual promoter plasmid includes the T7 promoter and the cspA promoter. The recombinant human growth hormone gene is regulated by the T7 promoter, and the totipotent nuclease DNS gene is regulated by the cspA promoter.

[0016] Furthermore, in step (5), the fermentation tank is operated at 600 rpm, the pH is adjusted to neutral with ammonia, the aeration rate is 3.0 L / min, and the dissolved oxygen is 60%.

[0017] Furthermore, in step (6), the centrifugation parameters are 15000 rpm / min for 30 minutes.

[0018] Furthermore, in step (7), the bacterial cells broken at 1000 bar pressure are centrifuged at 4°C and 9000 rpm for 30 min to collect the inclusion body precipitate.

[0019] Application of inclusion bodies based on dual promoter expression plasmids in the preparation of recombinant human growth hormone.

[0020] In summary, the present invention has the following beneficial effects:

[0021] This invention achieves significant results in the application of recombinant human growth hormone by inducing high-efficiency expression of the recombinant human growth hormone gene through the T7 promoter and high-activity expression of the totipotent nuclease gene DNS through the cspA promoter. During the preparation process, the cell viscosity is low, the homogenization and disruption effect is improved, the BL21(DE3) / DGH cell disruption rate is high, the inclusion body content harvested by centrifugation per unit volume of fermentation broth is high, and the HCD (host DNA residue) residue in the target protein per unit mass is reduced, effectively reducing energy consumption. Attached Figure Description

[0022] Figure 1 SDS-PAGE electrophoresis image of a totipotent nuclease;

[0023] Figure 2 SDS-PAGE electrophoresis image to verify the nucleic acid degradation activity of the pluripotent nuclease DNS;

[0024] Figure 3 The DGH map of the dual promoter plasmid;

[0025] Figure 4 The image shows the plasmid GH-2023 containing only the recombinant human growth hormone gene.

[0026] Figure 5 SDS-PAGE electrophoresis images of BL21(DE3) / DGH and BL21(DE3) / GH-2023 after induction in the fermenter;

[0027] Figure 6 Comparison of centrifugation status of BL21(DE3) / DGH and BL21(DE3) / GH-2023 samples after cell disruption;

[0028] Figure 7 Gram staining comparison of BL21(DE3) / DGH and BL21(DE3) / GH-2023 samples after cell disruption;

[0029] Figure 8 Comparison of colony growth in BL21(DE3) / DGH and BL21(DE3) / GH-2023 samples before and after cell disruption. Detailed Implementation

[0030] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0031] Example

[0032] Step 1: Screening for omnipotent nucleases

[0033] The amino acid sequence of the totipotent nuclease was codon-optimized to obtain the DNS gene sequence, as shown in SEQ ID NO: 1. Genscript Biotech Co., Ltd. was commissioned to synthesize the target gene into the pET-28a(+) vector. The recombinant plasmid was transformed into competent E. coli BL21(DE3) cells by heat shock at 42℃. After transformation, the bacterial culture was plated onto LB-Kan plates, and single colonies were selected and inoculated into 100 mL LB medium with the addition of Kan (i.e., kanamycin, final Kan concentration of 50 mg / L). The culture was incubated overnight at 37℃ and 220 rpm, and then transferred to a fresh 100 mL LB medium with the addition of Kan (final concentration of 50 mg / L), and incubated at 37℃ and 220 rpm until OD. 600 The pH was adjusted to 0.7, and IPTG was added to a final concentration of 0.5 mM. The cells were induced overnight at 25°C. After collecting the cells, they were resuspended in PBS (pH 7.0) and sonicated to obtain the supernatant, which was then sent for SDS-PAGE analysis. The SDS-PAGE electrophoresis image of the totipotent nuclease is shown below. Figure 1 As shown in the figure (M: marker; lane 1: supernatant obtained by screening and breaking the cell wall of the totipotent nuclease; lane 2: precipitate obtained by screening and breaking the cell wall of the totipotent nuclease; lane 3: impurities that did not adhere to the column in step 3 of the totipotent nuclease purification; lane 4: target protein obtained by elution in step 4 of the totipotent nuclease purification), this totipotent nuclease is soluble and expressed.

[0034] SEQ ID NO 1:

[0035] GCAGATACGTTAGAAAGCATCGATAATTGCGCCGTTGGTTGTCCGACGGGGTGGTAGTAGCAATGTGTCTATTGTTCGTCATGCCTATACCCTGAATAATAATTCAACAACCAAATTTGCCAATTGGGTTGCGTATCATATCACCAAAGATACACCAGCGAGCGGTAAAACCCGCAATTGGAAAA CCGATCCTGCTCTGAATCCAGCGGATACGCTGGCTCCGCCCGATTATACGGGTGCTAATGCTGCACTGAAAGTGGATCGCGGTCATCAGGCCCCTTTAGCTAGTTTAGCTGGTGTGAGTGATTGGGAATCTCTGAATTATTTAAGTAATATTACACCTCAGAAAAGCGATTTAAATCAGGGCGCA TGGGCTCGCTTAGAAGATCAGGAACGCAAACTGATCGATCGTGCAGACATTTCTTCTGTGTATACAGTGACAGGTCCACTGTATGAACGCGATATGGGCAAACTGCCTGGCACACAGAAAGCACATACCATCCCGAGTGCGTATTGGAAAGTTATCTTTATCAATAATAGTCCAGCCGTTAATC ATTATGCAGCCTTTCTGTTTGATCAGAATACGCCTAAAGGCGCCGATTTTTGCCAGTTTCGCGTGACCGTGGATGAAT

[0036] Step 2: Purification of totipotent nuclease

[0037] Purification was performed using a 10 mL chromatography column containing Ni Seplife FF (NTA). The specific purification steps were as follows:

[0038] 1. Equilibration: Rinse with buffer A (i.e., pure water) until conductivity is 0, then prewash with buffer D (50mM Tris, 250mM NaCl, 500mM imidazole, pH=8.0) for 3CV, and then rinse with buffer B (50mM Tris, 250mM NaCl, 25mM imidazole, pH=8.0) until equilibrium is reached;

[0039] 2. Sample loading;

[0040] 3. Washing: Rinse with B buffer until UV280 is reached to achieve equilibration;

[0041] 4. Elution: Wash with C buffer (50mM Tris, 250mM NaCl, 250mM imidazole, pH=8.0);

[0042] 5. Protein dialysis: Add the eluted sample to the dialysis bag, clamp the top of the dialysis bag with dialysis clamps, and suspend the dialysis bag in the dialysis storage solution (ensure that the sample is submerged in the dialysis storage solution, and the volume ratio of sample to dialysis storage solution is 1:20; the dialysis storage solution is: 20mM Tris, pH=7.5, 50mM NaCl, 1mM MgCl2, 50% glycerol). Place the bag in a chromatography refrigerator and perform magnetic stirring dialysis for 4 hours. Take out the obtained DNS enzyme solution sample and store it at -20℃.

[0043] 6. Column regeneration: Wash 3CV with D buffer, then wash 3CV with A buffer;

[0044] 7. Column preservation: Wash with E buffer (20% ethanol) for 3CV.

[0045] Step 3: Verification of the degradation activity of the totipotent nuclease DNS on nucleic acids.

[0046] Using plasmid DNA extracted from BL21 as a sample, the activity of the purified totipotent nuclease DNS was tested, specifically:

[0047] 1. Prepare sample solutions: undiluted DNS enzyme solution, DNS enzyme solution diluted 2 times, DNS enzyme solution diluted 4 times, DNS enzyme solution diluted 8 times, DNS enzyme solution diluted 16 times, and 5 μL of stock solution (same as the dialysis stock solution in step 2); the DNS enzyme solution is diluted with ddH2O.

[0048] 2. Reaction Procedure: Take 5 μL of each sample solution, add 5 μg of plasmid DNA, and bring the volume to 20 μL with ddH2O. Heat in a water bath at 37°C for 30 min. Stop the reaction by adding 2 μL of 50 mM EDTA. After stopping the reaction, take 5 μL of each sample for agarose gel electrophoresis. The results are shown below. Figure 2 As shown in the figure (M: marker; Lane 1: undiluted DNS enzyme solution; Lane 2: DNS enzyme solution diluted 2-fold; Lane 3: DNS enzyme solution diluted 4-fold; Lane 4: DNS enzyme solution diluted 8-fold; Lane 5: DNS enzyme solution diluted 16-fold; Lane 6: plasmid DNA with 5 μL of stock solution; Lane 7: plasmid DNA). Figure 2It can be seen that the purified totipotent nuclease has a good degradation effect on plasmid DNA samples.

[0049] Step 4: Construction of dual-promoter recombinant strains

[0050] The totipotent nuclease DNS gene sequence was synthesized by GenScript Biotech Co., Ltd. and inserted into a plasmid containing the recombinant human growth hormone gene, named DGH. Figure 3 As shown, the T7 promoter induces the expression of the recombinant human growth hormone gene, and the cspA promoter induces the expression of the totipotent nuclease gene DNS. A lacO regulatory sequence is inserted downstream of the cspA promoter. The dual-promoter plasmid DGH was transformed into BL21(DE3) competent cells by heat shock at 42℃ and plated on LB-Kan plates to obtain the engineered strain BL21(DE3) / DGH.

[0051] Step 5: Fermentation tank cultivation

[0052] LB medium parameters: 5 g / L yeast extract, 10 g / L sodium chloride, 10 g / L peptone, pH adjusted to neutral with sodium hydroxide, sterilized at 121°C;

[0053] Fermentation tank culture medium parameters: 5.8 g / L yeast extract, 4 g / L dipotassium hydrogen phosphate, 4 g / L potassium dihydrogen phosphate, 7 g / L disodium hydrogen phosphate, 1.2 g / L magnesium sulfate, 0.2 g / L ammonium chloride, 1.2 g / L ammonium sulfate, 0.02 g / L calcium chloride, sterilized at 121℃;

[0054] Feeding medium parameters: 30 g / L peptone, 15 g / L yeast extract, 7 g / L dipotassium hydrogen phosphate, 7 g / L potassium dihydrogen phosphate, 10 g / L disodium hydrogen phosphate, 2.5 g / L magnesium sulfate, 10 g / L ammonium chloride, sterilized at 121℃.

[0055] Inoculate BL21(DE3) / DGH into 180 mL of LB medium, add kanamycin sulfate (final concentration 50 mg / L), and incubate overnight at 30 °C and 220 rpm.

[0056] 180 mL of seed culture from a shake flask was transferred to a 5 L fermenter containing 1.8 L of fermentation medium for fermentation culture. The culture temperature was 30.0 °C, the rotation speed was 600 rpm, and the pH was adjusted to neutral with ammonia water during culture. The aeration rate was controlled at 3.0 L / min and the dissolved oxygen was 60%. During the culture process, when the carbon source was consumed, the pH value showed an upward trend, and the dissolved oxygen increased, feed medium was added and the feed rate was adjusted to maintain sufficient carbon source, neutral pH, and 60% dissolved oxygen in the fermenter. After 6 hours of culture, the cell concentration OD was measured. 600≥100.0 (the culture time can be adjusted between 6 and 7 hours depending on the bacterial concentration), add 2g of IPTG inducer for induction, induce at 28℃ for 3 hours, then cool to 15℃ and continue induction culture for 3 hours, then take samples and send them for SDS-PAGE testing.

[0057] Step 6: Bacterial cell recovery

[0058] The fermentation broth was centrifuged to obtain bacterial cells at 15,000 rpm / min for 30 minutes.

[0059] Step 7: Cell disruption to obtain crude inclusion bodies

[0060] The bacterial cells were added to a lysis buffer (containing 20 mM Tris (tromethamine), 2 mM EDTA (metal ion chelating agent), 1.2 M urea (denaturant), 3% Triton X-100 (nonionic surfactant), pH 7.5) at a concentration of 150 g / L. The resuspended mixture was then homogenized at 600 bar using a high-pressure homogenizer. The homogenization was repeated three times, and samples were taken to test the cell disruption. (As needed, the Tris (tromethamine) in the lysis buffer can be adjusted between 10 and 50 mM; the metal chelating agent EDTA can be adjusted between 0.1 and 5 mM, and replacing it with EGTA can achieve the same effect as EDTA; the denaturing agent urea can be adjusted between 0.5 and 2 mM, and replacing it with 0.1 to 0.5 mM of the denaturing agent guanidine hydrochloride can achieve the same effect as urea; the nonionic surfactant Triton X-100 can be adjusted between 1 and 5%, and replacing it with Tween-20 can achieve the same effect as Triton X-100; the pH can be adjusted between 7.0 and 8.5.)

[0061] Add the bacterial cells to the lysis buffer (with the same parameters as the lysis buffer mentioned above) at a bacterial cell concentration of 150 g / L, and break them up three times at a pressure of 1000 bar until the cells are completely lysed. Centrifuge at 4°C and 9000 rpm for 30 min, collect the inclusion body precipitate, and calculate the inclusion body yield.

[0062] Step 8: Preparation of pure inclusion bodies

[0063] Following the "step 6 inclusion body washing" operation described in the patent with publication number CN118515782A, pure inclusion bodies are obtained.

[0064] Step 9: Application of inclusion bodies in the preparation of recombinant human growth hormone

[0065] Inclusion bodies were collected and processed according to steps 7 to 15 as described in patent publication number CN118515782A to obtain recombinant human growth hormone.

[0066] Comparative Example

[0067] We commissioned GenScript Biotech to construct a plasmid containing the recombinant human growth hormone gene, named GH-2023. Figure 4 As shown. The cells were transformed into BL21(DE3) competent cells by heat shock at 42℃, and then plated onto LB-Kan plates to obtain the engineered strain BL21(DE3) / GH-2023. Then, the operation was carried out according to steps 5 to 7 of the example.

[0068] Examples and comparative examples: SDS-PAGE electrophoresis images taken in step 5 and sent for testing are shown below. Figure 5 As shown in the figure (M: marker; lane 1: BL21(DE3) / DGH; lane 2: BL21(DE3) / GH-2023), recombinant human growth hormone was found to be expressed at 22KD, and DGH showed a wider band at 65KD, which was expressed by a small amount of totipotent nuclease.

[0069] In the examples and comparative examples, the cell wall disruption detection method in step 7 was as follows: (1) Equal amounts of the disrupted samples were centrifuged at 8500 rpm and 4℃ for 10 minutes, and the cell wall disruption was observed. Figure 6 As shown, both did not separate into layers after centrifugation, indicating that the inclusion bodies were of good quality and uniform; (2) Equal amounts of the samples after cell disruption were taken for Gram staining, and the cell disruption was observed under a 100× oil immersion microscope. Figure 7 As shown, no intact bacterial cells were observed in DGH, while intact bacterial cells were observed in GH-2023; (3) Take 50 μL of each sample after cell disruption, spread it evenly on LB-Kan plates with glass beads, and incubate at 37°C for 17 h to observe the colony growth (colony growth is shown in the figure). Figure 8 As shown in Table 1, the cell wall breakage rate was calculated.

[0070] Table 1

[0071]

[0072] The inclusion body yields in step 7 of the examples and comparative examples are shown in Table 2.

[0073] Table 2

[0074] name Inclusion body yield BL21(DE3) / DGH 29% BL21(DE3) / GH-2023 25%

[0075] The above description is merely a preferred embodiment of the present invention. The scope of protection of the present invention is not limited to the above embodiments. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention. It should be noted that for those skilled in the art, any improvements and modifications made without departing from the principles of the present invention should also be considered within the scope of protection of the present invention.

Claims

1. A method for preparing inclusion bodies based on dual-promoter expression plasmids, characterized in that, Includes the following steps: (1) Screening of totipotent nucleases: The amino acid sequence of the totipotent nuclease was codon optimized to obtain the totipotent nuclease DNS gene sequence, as shown in SEQ ID NO:

1. The obtained totipotent nuclease DNS gene sequence was synthesized into a vector. Subsequently, the vector containing the totipotent nuclease DNS gene was transformed into BL21(DE3) competent cells, plated on LB-Kan plates, single clones were selected, inoculated into LB medium, Kan was added, and cultured overnight. The cells were then transferred to new LB medium, Kan was added, and cultured until OD. 600 Adjust the pH to 0.6-0.8, add IPTG to induce incubation, incubate overnight at 25°C, collect the cells, resuspend, and sonicate to disrupt. (2) Purification of pluripotent nuclease: Purification was performed using a chromatography column packed with Ni Seplife FF (NTA) packing material. The purification steps were: equilibration, loading, washing, elution, protein dialysis, column regeneration, and column preservation. (3) Construction of dual promoter recombinant strain: The totipotent nuclease DNS gene sequence was synthesized into a plasmid containing the recombinant human growth hormone gene to obtain a dual promoter plasmid, which was transformed into BL21(DE3) competent cells and plated on LB-Kan plates to obtain the engineered strain BL21(DE3) / DGH; Dual promoter plasmids include the T7 promoter and the cspA promoter. The recombinant human growth hormone gene is regulated by the T7 promoter, and the totipotent nuclease DNS gene is regulated by the cspA promoter. (4) Fermentation tank culture: BL21(DE3) / DGH was inoculated into LB medium, kanamycin sulfate was added, and the culture was carried out overnight at 30°C. Then, it was transferred to a fermenter for fermentation culture and cultured at 30°C for 6-7 hours. The cell concentration OD 600 ≥100.0, add IPTG inducer for induction, induce at 28℃, cool down to 15℃, continue induction culture to obtain fermentation broth; (5) Cell recovery: Cells are obtained by centrifuging the fermentation broth; (6) Obtaining crude inclusion bodies by cell disruption: The cells were added to lysis buffer and disrupted using a high-pressure homogenizer. The inclusion body precipitate was collected to obtain crude inclusion bodies. (7) Preparation of pure inclusion bodies: Wash the crude inclusion bodies to obtain pure inclusion bodies.

2. The method for preparing inclusion bodies based on dual-promoter expression plasmids according to claim 1, characterized in that, In step (1), the vector is pET-28a(+) vector, the final concentration of Kan is 50 mg / L, the overnight culture temperature is 37℃, the rotation speed is 220 rpm, the final concentration of IPTG is 0.5 mM, and PBS with pH 7.0 is used for resuspension.

3. The method for preparing inclusion bodies based on dual-promoter expression plasmids according to claim 1, characterized in that, In step (4), the fermentation tank is operated at 600 rpm, the pH is adjusted to neutral with ammonia, the aeration rate is 3.0 L / min, and the dissolved oxygen is 60%.

4. The method for preparing inclusion bodies based on dual-promoter expression plasmids according to claim 1, characterized in that, In step (5), the centrifugation parameters are 15000 rpm and 30 minutes.

5. The method for preparing inclusion bodies based on dual-promoter expression plasmids according to claim 1, characterized in that, In step (6), the bacterial cells broken at 1000 bar pressure are centrifuged at 4°C and 9000 rpm for 30 min to collect the inclusion body precipitate.

6. The application of inclusion bodies based on dual promoter expression plasmids according to any one of claims 1 to 5 in the preparation of recombinant human growth hormone.

Citation Information

Patent Citations

  • Fusion protein and method for preparing recombinant human growth hormone based on fusion protein

    CN118515782A