Novel calreticulin-carrying oncolytic adenovirus as well as application and preparation method thereof

Abstract

The invention relates to the technical field of gene engineering, in particular to a novel calreticulin-carrying oncolytic adenovirus as well as application and a preparation method thereof. In the oncolytic adenovirus, a plasmid skeleton of a recombinant plasmid is type-5 adenovirus, and a nucleotide sequence of an E3 region of the plasmid skeleton has Gp19k fragment deletion; the recombinant plasmid comprises a CMV promoter and a nucleotide sequence used for coding calreticulin, the CMV promoter and the nucleotide sequence used for coding calreticulin are located at the deletion position of a Gp19k fragment, and the CMV promoter and the nucleotide sequence used for coding calreticulin are introduced into the deletion position of the Gp19k fragment of the type 5 adenovirus. The oncolytic virus can be normally replicated, calreticulin overexpression is realized under the condition that the virus activity is ensured, and the method has a good effect on various cancer cells, and can become an effective means for a'general cancer species' therapy.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a novel oncolytic adenovirus carrying calreticulin, and its application and preparation method. Background Art

[0002] With the rapid development of tumor immunotherapy, oncolytic viruses are gaining attention due to their strong immunogenicity and ability to carry and express exogenous immunostimulatory genes. Literature reports indicate that adenoviral vectors carrying multiple immune targets, such as GM-CSF, IFN-β, and CD40L, can enhance anti-tumor immunity.

[0003] Calreticulin (CRT) is a 46kDa endoplasmic reticulum-resident protein. As a molecular chaperone in the endoplasmic reticulum, calreticulin works synergistically with calnexin to recognize newly synthesized glycoproteins (through monoglucosylation modification) and promote their correct folding. If a protein fails to fold multiple times, calreticulin will direct it to the endoplasmic reticulum-associated degradation pathway (ERAD), ensuring that only correctly folded proteins enter subsequent transport.

[0004] In terms of immune regulation, calreticulin can be transferred to the cell surface or released extracellularly, such as in tumor cell death induced by chemotherapy drugs (such as doxorubicin and oxaliplatin) or radiotherapy, or viral infection. Calreticulin externalization is a key mechanism for signaling during cell stress, death, or infection, and is particularly valuable in the field of tumor immunotherapy. The regulatory mechanism of its exposure is complex, involving multiple factors such as endoplasmic reticulum stress, apoptotic signaling pathways, and pathogen interactions. Externalized calreticulin acts as an "eat me" signal, promoting the clearance of apoptotic cells by macrophages and activating immune responses. Furthermore, the exposure of calreticulin on the tumor cell surface can enhance the uptake and presentation of tumor antigens by DCs, thereby activating tumor-specific CD8+ T cells and collaborating with other immunoregulatory molecules (such as ATP and HMGB1) to enhance anti-tumor effects. CRT is considered a heat shock protein (HSP) with potent immunobiological activity.

[0005] Studies have shown that a recombinant fragment of mouse CRT (rCRT / 39-272) covering the N-terminus and P domain of part of CRT is a potent activator of B cells and macrophages. CRT / 39-272 also induces the maturation and activation of dendritic cells (DCs) and promotes the activation and maturation of antigen-specific T cell responses through the Toll-like receptor 4 (TLR4) and CR14 pathways. Studies have also found that CRT can enhance the immunoglobulin G (IgG) response to the SARS-CoV spike protein. Studies involving DNA vaccines encoding CRT and target antigen fusion proteins have shown that CRT can act as a molecular adjuvant. Calreticulin plays a "bridge" role in the immune system, connecting innate immunity with adaptive immunity, and coordinating cell death and immune activation.

[0006] Adenovirus is a non-integrating, non-enveloped, double-stranded DNA virus with a genome size of approximately 30-38 kb. Its viral particles are 80-110 nm in diameter, and its capsid is an icosahedron composed of 240 hexons and 12 pentons. Currently, adenovirus vectors are one of the most widely used vectors in preclinical and clinical studies of oncolytic viruses, attracting considerable attention from researchers due to their excellent biosafety, ease of obtaining high-titer viruses, and large capacity for accommodating foreign genes.

[0007] Based on the order of transcription, adenoviral genes can be broadly divided into early (E1A, E1B, E2A, E2B, E3, and E4) and late transcription units (L1-5). E1 is essential for adenoviral replication; therefore, its absence renders Ad unable to replicate itself, relying solely on trans-complementation provided by the virus-packaging 293 cells for replication and amplification. Transfection into 293 cells occurs. After 7-10 days of intracellular packaging, the massive production of active virus causes CPE in HEK293 cells. The E3 gene expression product of adenoviral vectors is unrelated to viral genome replication; its primary function is to subvert the host's immune defenses. The expression products of the E3 gene include gp19K protein, RIDα & β, and 14.7Kd protein, as well as the adenovirus death protein. The gp19K protein, the expression product of the E3 gene, can bind to the heavy chain of MHC class I molecules on the endoplasmic reticulum, preventing their transport to the cell surface and thereby delaying MHC I expression. The expression products of the E3 gene, RIDα & β, and 14.7Kd protein, can inhibit TNF-induced apoptosis, promote Fas degradation, and downregulate TNF receptor levels. The expression product of the E3 gene is the adenovirus death protein (ADP), also known as 11.6Kd. ADP can lyse cells and release viral particles in the late stages of viral infection. Genes in the E3 region, including gp19k, ADP, and E3B, all share a common expression cassette, a common promoter, and a polyA tail. Previous studies have shown that deleting a gene in the E3 region and inserting an exogenous gene can be used for exogenous gene expression, thereby achieving the goal of creating an oncolytic adenovirus product with an embedded exogenous gene.

[0008] However, it is currently unknown which genes in the E3 region can be deleted without affecting the anti-tumor effect of oncolytic adenovirus or even enhancing anti-tumor immunity. Summary of the Invention

[0009] The technical problem to be solved by the present invention is to provide a novel oncolytic adenovirus carrying calreticulin, and its application and preparation method.

[0010] The technical solution of the present invention to solve the above technical problems is as follows:

[0011] The present invention provides a recombinant plasmid, wherein the plasmid backbone of the recombinant plasmid is adenovirus type 5, and the nucleotide sequence of the E3 region of the plasmid backbone has a Gp19k fragment deletion; the recombinant plasmid comprises a CMV promoter and a nucleotide sequence for encoding calreticulin, and the CMV promoter and the nucleotide sequence for encoding calreticulin are located at the position where the Gp19k fragment is deleted.

[0012] On the basis of the above technical solution, the present invention can also be improved as follows.

[0013] Furthermore, the nucleotide sequence encoding calreticulin is shown as SEQ ID No. 1.

[0014] Furthermore, the nucleotide sequence of the E3 region of the recombinant plasmid is shown in SEQ ID No. 2.

[0015] Furthermore, the plasmid backbone has a deletion of the 920nt-946nt region of the E1 region.

[0016] The present invention also provides a novel oncolytic adenovirus carrying calreticulin, which is prepared using the recombinant plasmid as described above.

[0017] The present invention also provides a method for preparing the novel calreticulin-carrying oncolytic adenovirus as described above, wherein the recombinant plasmid is constructed by homologous recombination of BJ5183, gene synthesis, and in vitro ligation, and then the recombinant plasmid is purified and transfected to obtain the oncolytic adenovirus.

[0018] Further, the following steps are included:

[0019] constructing the plasmid backbone in vitro;

[0020] synthesizing the nucleotide sequence of calreticulin in vitro, and obtaining a gene fragment carrying a homologous recombination arm outside the vector based on the nucleotide sequence;

[0021] Connecting the gene fragment carrying the homologous recombination arm outside the vector and the plasmid backbone to construct a connection product;

[0022] The ligation product is transformed into a T1 competent cell, and the recombinant plasmid is obtained after cloning and identification;

[0023] After the recombinant plasmid is transfected into HEK293A cells, the oncolytic adenovirus is obtained.

[0024] The present invention also provides a use of the novel oncolytic adenovirus carrying calreticulin as described above, which can be used to prepare a preparation for treating cancer.

[0025] Furthermore, the cancer treatment preparation is a drug, a pharmaceutical raw material, a tumor therapeutic vaccine or a targeted inhibitor.

[0026] The present invention also provides a preparation for treating cancer, comprising the above-mentioned recombinant plasmid and / or the above-mentioned novel oncolytic adenovirus carrying calreticulin.

[0027] The beneficial effects of the present invention are:

[0028] (1) The novel oncolytic adenovirus carrying calreticulin of the present invention introduces a CMV promoter and a nucleotide sequence encoding calreticulin at the position where the Gp19k fragment of type 5 adenovirus is deleted, so that the oncolytic virus can replicate normally and achieve overexpression of calreticulin while ensuring viral activity;

[0029] (2) The novel oncolytic adenovirus carrying calreticulin of the present invention has a good effect on a variety of cancer cells and can become an effective means of "pan-cancer" therapy;

[0030] (3) The method for preparing the novel oncolytic adenovirus carrying calreticulin of the present invention has simple steps, high efficiency and good accuracy, which is conducive to the preparation and promotion of the novel oncolytic adenovirus carrying calreticulin. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Schematic diagram of the gene structure of the novel calreticulin-carrying oncolytic adenovirus of the present invention, oAd-CALR and oAd-EGFP in Example 1;

[0032] Figure 2 Schematic diagram of the gene structure of the novel calreticulin-carrying oncolytic adenovirus of the present invention, oAd-CALR-1, oAd-CALR-2, and oAd-CALR-3 in Example 2;

[0033] Figure 3 The novel oncolytic adenovirus carrying calreticulin of the present invention, the protein expression amount outside the cell membrane of each experimental group in Example 2, Figure 3 A in the middle is OVCAR8 cells, Figure 3 Middle B is A2780 cells;

[0034] Figure 4 This is the electrophoresis diagram of the western blot results in Example 3 for the novel oncolytic adenovirus carrying calreticulin of the present invention;

[0035] Figure 5 This is a graph showing the flow cytometry results of the novel calreticulin-carrying oncolytic adenovirus of the present invention, as shown in Example 3. Figure 5 A in the middle is A2780 cells, Figure 5 Middle B is OVCAR8 cells, Figure 5 Middle C is SW780 cells, Figure 5 D in the middle is A549 cells, Figure 5 E in the middle is Hela cells, Figure 5 Middle F is HapT1 cells;

[0036] Figure 6 This is a graph showing the relative expression test results of the novel calreticulin-carrying oncolytic adenovirus of the present invention, in Example 4. Figure 6 A in the middle is OVCAR8 cells, Figure 6 Middle B is A2780 cells;

[0037] Figure 7 This is a graph showing the cell viability test results of the novel calreticulin-carrying oncolytic adenovirus of the present invention, Figure 7 A in the middle is A2780 cells, Figure 7 Middle B is A549 cells, Figure 7 Middle C is SW780 cells, Figure 7 D in the middle is HapT1 cells, Figure 7 E in the middle is Hela cells, Figure 7 F in the middle is OVCAR8 cells. DETAILED DESCRIPTION

[0038] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0039] The novel oncolytic adenovirus carrying calreticulin of the present invention has a recombinant plasmid whose plasmid backbone is a type 5 adenovirus, and the nucleotide sequence of the E3 region of the plasmid backbone has a Gp19k fragment deletion; the recombinant plasmid includes a CMV promoter and a nucleotide sequence for encoding calreticulin, and the CMV promoter and the nucleotide sequence for encoding calreticulin are located at the position where the Gp19k fragment is deleted.

[0040] The novel calreticulin-carrying oncolytic adenovirus of the present invention introduces a CMV promoter and a nucleotide sequence encoding calreticulin at the location of the Gp19k fragment deletion of adenovirus type 5, enabling the oncolytic virus to replicate normally and overexpress calreticulin while ensuring viral activity. Calreticulin within the endoplasmic reticulum is externalized to the cell membrane surface, and this externalization is observed in different types of cancer, making it an effective means of "pan-cancer" therapy, especially for "cold tumors" that are insensitive to immunotherapy or tumors with an immunosuppressive microenvironment.

[0041] The nucleotide sequence encoding calreticulin of the present invention is shown in SEQ ID No. 1, and the nucleotide sequence of the E3 region of the recombinant plasmid is shown in SEQ ID No. 2.

[0042] Preferably, the plasmid backbone has a deletion of the 920nt-946nt region of the E1 region, so that Ad cannot complete self-replication.

[0043] The present invention's method for preparing a novel calreticulin-carrying oncolytic adenovirus involves constructing the recombinant plasmid using BJ5183 homologous recombination, gene synthesis, and in vitro ligation, followed by purification and transfection to obtain the oncolytic adenovirus. This method is simple, efficient, and accurate, facilitating the preparation and promotion of the novel calreticulin-carrying oncolytic adenovirus.

[0044] The novel oncolytic adenovirus carrying calreticulin of the present invention can be used to prepare a preparation for treating cancer.

[0045] Preferably, the cancer treatment preparation is a drug, a pharmaceutical raw material, a tumor therapeutic vaccine or a targeted inhibitor.

[0046] The preparation for treating cancer of the present invention comprises the above-mentioned recombinant plasmid and / or the novel oncolytic adenovirus carrying calreticulin.

[0047] Preferably, the cancer includes ovarian cancer, lung cancer, cervical cancer, and bladder cancer.

[0048] The present invention is described below by means of specific examples.

[0049] Example 1 Preparation of oncolytic adenovirus

[0050] This example uses BJ5183 homologous recombination technology, gene synthesis technology, and in vitro ligation technology to construct conditional replicative adenoviral vectors oAd-CALR and oAd-EGFP, where oAd-EGFP serves as the control group in subsequent examples.

[0051] The plasmid vector structure of this embodiment is as follows Figure 1 The specific preparation process of this embodiment is as follows:

[0052] (1) In vitro gene synthesis of E1A / Δ27bp (ad5 920-926nt deletion) was used, and Pshuttle-E1A / Δ27bp was constructed using double enzyme digestion technology and seamless cloning and ligation technology.

[0053] (2) Using BJ5183 homologous recombination technology, the Pshuttle-E1A / Δ27bp and Padeasy-1 plasmids were co-transfected into BJ5183 to achieve homologous recombination and obtain Pad-E1A / Δ27bp.

[0054] (3) In vitro gene synthesis of ad5 E3 / delgp19k was performed, and a ClaI restriction site was introduced into the region corresponding to the missing gp19k.

[0055] (4) The ad5 E3 / delgp19k gene fragment and Pad-E1A / Δ27bp were co-transfected into BJ5183 to achieve homologous recombination and obtain Pad-E1A / Δ27bp-E3 / delgp19k.

[0056] (5) The Pad-E1A / Δ27bp-E3 / delgp19k plasmid was digested using the ClaI specific restriction site and the product was purified.

[0057] (6) In vitro gene synthesis of calreticulin CALR gene;

[0058] (7) PCR was used to obtain the gene fragment carrying the homologous recombination arm outside the vector. The specific sequences of the primers are as follows:

[0059] SEQ ID No.3(gp19K-CMV-CALR-F):

[0060] gtattaggccaaaggcgcaATCGatgtggctgcagagcctgct

[0061] SEQ ID No.4(gp19K-CMV-CALR-R):

[0062] gcatatcccacatagagtATCGATtcactcctggactggctccca

[0063] (8) The Pad-E1A / Δ27bp-E3 / delgp19k linearized fragment and the gp19k-CMV-CALR product were ligated in vitro using the NEBuider HiFi DNA Assembly Master Mix Kit to obtain oAd-CMV-CALR. The reaction conditions are shown in Table 1:

[0064] Table 1

[0065]

[0066]

[0067] (9) Transform the ligation product into a T1 competent cell, and select a clone for sequencing and identification. A single clone is selected for sequencing and identification to obtain the oAd-CMV-CALR plasmid;

[0068] (10) The oAd-CMV-CALR plasmid was digested with PacI and purified, and then transfected into HEK293A cells to finally obtain the novel oncolytic adenovirus oAd-CALR carrying calreticulin of the present invention.

[0069] oAd-CMV-EGFP was prepared using the same procedure, except that CALR was replaced with EGFP.

[0070] Example 2 Comparison of effects of different insertion areas

[0071] In this example, the gp19k region, ADP region, and E3B region of adenovirus type 5 were deleted by homologous recombination technology, gene synthesis technology, and in vitro ligation technology similar to those in Example 1, and three oncolytic adenovirus recombinant vectors carrying calreticulin were constructed, respectively named oAd-CALR-1, oAd-CALR-2, and oAd-CALR-3. The gene structures of the three are shown in FIG. Figure 2 The ligation product was transformed into T1 competent cells, clones were picked and sequenced, and then purified by PacI digestion and transfected into HEK293A cells.

[0072] After testing, only the oAd-CALR-2 (ADP-CALR) plasmid with the ADP region deleted and CALR inserted successfully produced infectious progeny viruses, while the other modification methods failed to generate biologically active viruses.

[0073] Compare the expression levels of oAd-GP19K-CMV-CALR and ADP-CALR externalized to the cell membrane, such as Figure 3 As shown in the figure, the expression level of oAd-GP19K-CMV-CALR was stronger than that of oAd-ADP-CALR.

[0074] Example 3 Verification of Calreticulin Expression by Oncolytic Adenovirus

[0075] 2×10^5 cells were plated in a six-well plate. After 12 hours, oAd-CALR and oAd-EGFP were added at an MOI of 1. Protein was collected 24, 48, and 72 hours later, and then quantified by western blot. The results are shown in the figure. Figure 4 shown.

[0076] according to Figure 4 It can be seen that CALR calreticulin was expressed after oAd-CALR was added at 48 and 72 hours, and the expression level at 72 hours was higher than that at 48 hours.

[0077] Afterwards, A2780 cells, OVCAR8 cells, SW780 cells, A549 cells, Hela cells and HapT1 cells were plated on six-well plates, and flow cytometry was performed after 72 h. Calreticulin antibodies were incubated. The results were as follows: Figure 5 shown.

[0078] according to Figure 5The experimental results show that the oncolytic virus oAd-CALR that overexpresses calreticulin has calreticulin in the endoplasmic reticulum everted to the cell membrane surface, and eversion is found in different types of cancer, such as ovarian cancer, lung cancer, cervical cancer, and bladder cancer. It can be seen that the oncolytic virus of the present invention can be applied to "pan-cancer" therapy, especially "cold tumors" that are insensitive to immunotherapy or tumors with an immunosuppressive microenvironment. The reason is that the mechanism of action of calreticulin does not depend on the molecular characteristics of a specific cancer, or there are similar immune escape mechanisms in multiple cancers that can be targeted.

[0079] Example 4 Verification of oncolytic virus replication

[0080] This example further examines the effect of the calreticulin target on viral replication. Specifically, the oAd-CALR and oAd-EGFP prepared in Example 1 were used for the experiment. The specific experimental process is as follows:

[0081] DNA was extracted from tissue or cell samples using the FastPure Cell / Tissue DNA Isolation Mini Kit (Vazyme, China). After extraction, DNA was quantified using a NanoDrop (Thermo Fisher Scientific, USA). Subsequently, qRT-PCR analysis was performed using the ChamQ Universal SYBR qPCR Master Mix (Vazyme, China) and a CFX96 (Bio-Rad, USA).

[0082] The primer sequences for qRT-PCR are as follows:

[0083] GAPDH forward primer (F): GGAGCGAGATCCCTCCAAAAT, rear primer (R): GGCTGTTGTCATACTTCTCATGG;

[0084] Hexon forward primer (F): ACTATATGGACAACGTCAACCCATT, rear primer (R): AACTTCTGAGGCACCTGGATGT.

[0085] CCK8 cell viability was used to analyze whether the calreticulin target had an effect on cell killing. The experimental process was as follows: cells were seeded in a 96-well plate, and after the cells adhered, virus dilutions of different MOIs were added for treatment. After 72 hours of culture, the original culture medium was removed and 100 μl of culture medium containing 10% CCK-8 was added to each well. Subsequently, the culture plate was placed in an incubator and incubated for 1 to 4 hours. After the incubation, the absorbance was detected at a wavelength of 450 nm using a microplate reader (Bio-Rad, USA), and the cell inhibition rate was calculated according to the corresponding formula.

[0086] Figure 6is the relative expression level of oAd-CALR and oAd-EGFP in OVCAR8 cells and A2780 cells, Figure 7 The cell viability changes of different cells.

[0087] According to the above experimental results, it can be seen that carrying the calreticulin target does not affect the replication of the virus, indicating that the oncolytic virus has good activity and can be effectively used in practice.

[0088] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A recombinant plasmid, characterized in that The plasmid backbone of the recombinant plasmid is adenovirus type 5, and the nucleotide sequence of the E3 region of the plasmid backbone has a Gp19k fragment deletion; the recombinant plasmid includes a CMV promoter and a nucleotide sequence for encoding calreticulin, and the CMV promoter and the nucleotide sequence for encoding calreticulin are located at the position where the Gp19k fragment is deleted.

2. The recombinant plasmid according to claim 1, characterized in that The CMV promoter and the nucleotide sequence encoding calreticulin are shown in SEQ ID No.

1.

3. The recombinant plasmid according to claim 2, characterized in that The nucleotide sequence of the E3 region of the recombinant plasmid is shown in SEQ ID No.

2.

4. The recombinant plasmid according to claim 1, characterized in that The plasmid backbone has a deletion of the 920nt-946nt region of the E1 region.

5. A novel oncolytic adenovirus carrying calreticulin, characterized in that: The recombinant plasmid is prepared using the recombinant plasmid according to any one of claims 1 to 4.

6. A method for preparing the novel oncolytic adenovirus carrying calreticulin according to claim 5, characterized in that: The recombinant plasmid was constructed by using BJ5183 homologous recombination, gene synthesis and in vitro ligation, and then the recombinant plasmid was purified and the oncolytic adenovirus was obtained after transfection.

7. The method for preparing a novel oncolytic adenovirus carrying calreticulin according to claim 6, characterized in that: The following steps are involved: constructing the plasmid backbone in vitro; synthesizing the nucleotide sequence of calreticulin in vitro, and obtaining a gene fragment carrying a homologous recombination arm outside the vector based on the nucleotide sequence; Connecting the gene fragment carrying the homologous recombination arm outside the vector and the plasmid backbone to construct a connection product; The ligation product is transformed into a T1 competent cell, and the recombinant plasmid is obtained after cloning and identification; After the recombinant plasmid is transfected into HEK293A cells, the oncolytic adenovirus is obtained.

8. A use of the novel oncolytic adenovirus carrying calreticulin as claimed in claim 5, characterized in that: It can be used to prepare preparations for treating cancer.

9. The use of a novel oncolytic adenovirus carrying calreticulin according to claim 8, characterized in that: The cancer treatment preparation is a drug, a pharmaceutical raw material, a tumor therapeutic vaccine or a targeted inhibitor.

10. A preparation for treating cancer, characterized in that The preparation comprises the recombinant plasmid according to any one of claims 1 to 4 and / or the novel oncolytic adenovirus carrying calreticulin according to claim 5.

Images