A method for improving the ability of Yersinia lipolyticis to synthesize amino acid derivatives

By genetically modifying Yeast lipolyticis, a fermentation production pathway for HMB was constructed, solving the problems of chemical synthesis pollution and low microbial synthesis yield. This enabled efficient and green production of HMB, with a yield of 30 g/L, demonstrating potential for industrial application.

CN120665736BActive Publication Date: 2026-06-30TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Filing Date
2024-08-29
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing chemical synthesis methods for β-hydroxy-β-methylbutyric acid (HMB) are environmentally polluting and costly, while microbial synthesis yields low rates and involves complex reaction conditions.

Method used

By using genetic engineering technology, the branched-chain amino acid degradation metabolic pathway of Yersinia lipolytica was coupled with the mevalonate pathway to construct an engineered strain. The HMGCL and OCT genes were knocked out using the CRISPR/Cas9 system, and the genes of decarboxylase, hydratase, dehydrating enzyme and thioesterase were integrated to achieve the fermentation production of HMB using glucose as a carbon source.

Benefits of technology

The efficient and green synthesis of β-hydroxy-β-methylbutyric acid has been achieved, with a fermentation yield of up to 30 g/L, showing promising prospects for industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005018223060000011
    Figure BDA0005018223060000011
  • Figure BDA0005018223060000051
    Figure BDA0005018223060000051
  • Figure BDA0005018223060000061
    Figure BDA0005018223060000061
Patent Text Reader

Abstract

A method for improving the synthetic ability of *Yersinia lipolytica* to synthesize amino acid derivatives. This invention discloses an engineered strain for the biological synthesis of the amino acid derivative β-hydroxy-β-methylbutyric acid (β-methylbutyric acid) and its construction method. Using *Yersinia lipolytica* as the substrate cell, the HMGCL and OCT genes involved in branched-chain amino acid metabolism in its genome are knocked out to obtain a gene knockout strain. Decarboxylase genes, hydratase genes, dehydratase genes, and thioesterase genes are integrated into the genome of the gene knockout strain to obtain an engineered strain capable of de novo synthesis of β-hydroxy-β-methylbutyric acid. Further integration of the CcGCTB-CcGCTA fusion gene expression module enhances the expression level of key enzyme genes, thereby increasing the yield of β-hydroxy-β-methylbutyric acid in the strain. The engineered strain constructed in this invention can synthesize the target product β-hydroxy-β-methylbutyric acid using glucose as a carbon source through fermentation, with a maximum yield of up to 30 g / L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an engineered bacterium for de novo synthesis of β-hydroxy-β-methylbutyric acid and its construction method. Background Technology

[0002] β-hydroxy-β-methylbutyric acid (3-Hydroxy-3-methylbutyrate Hydrate, HMB) is a colorless crystal with the molecular formula C5H10O3, CAS: 625-08-1, and structural formula:

[0003]

[0004] HMB has long been used as a nutritional supplement in sports due to its anti-protein breakdown properties, which alter protein metabolic balance during new muscle tissue growth. Currently, HMB is widely used as an additive in animal feed, human sports nutrition products, and dietary foods. Research indicates that HMB holds promise for playing an important role in the treatment of cancer and malignant tumors, and can be used clinically to treat muscle atrophy, tumors, acquired immunodeficiency syndrome (AIDS), and other chronic diseases.

[0005] In the human body, HMB is a metabolite of L-leucine. Approximately 90% of HMB in the body comes from the breakdown of leucine, but only about 5% of leucine is converted into HMB. Leucine is an essential amino acid and can only be obtained through diet, such as brown rice, beans, meat, nuts, soy flour, and whole wheat.

[0006] Traditionally, HMB has been synthesized chemically, and various chemical synthesis routes have been developed and applied industrially. In 1877, the oxidation of 2-methylpentenol with chromic acid (H₂CrO₄) to prepare HMB was reported; in 1880 and 1889, the oxidation of the o-diol 4-methylpentane-1,2,4-triol with acidified potassium permanganate (KMnO₄) to prepare HMB was reported; and in 1892, the oxidation of 3-methylbutane-1,3-diol with permanganate was reported. In 1958, it was reported that HMB could be synthesized by the catalytic oxidation of diacetone alcohol using sodium hypochlorite. However, these chemical processes utilize and generate toxic organic reagents and substances, causing environmental pollution and increasing production costs, which is inconsistent with the concept of sustainable development.

[0007] Subsequently, Hasegawa et al. found in shake-flask experiments of *Galactomyces reessii* that HMB production was sensitive to dissolved oxygen levels, and that cell growth significantly decreased with increasing β-methylbutyric acid (MBA) concentration (Hasegawa J. Ogura M. Stereoselective conversion of isobutyric acid to β-hydroxyisobutyric acid by microorganisms. [J]. Ferment. Technol. 1981. 59: 203–208.). This work demonstrated the feasibility of producing HMB via the biocatalysis of MBA. Lee et al. found in *Galactomyces reessii* that MBA is converted to HMB via the leucine catabolism pathway. This design-based strategy of constructing whole-cell catalyst systems from L-leucine may serve as an alternative route for HMB synthesis (In Young Lee, John PNRosazza. Enzyme analyses demonstrate that beta-methylbutyricacidis converted to beta-hydroxy-beta-methylbutyricacid via the leucine catabolic pathway by Galactomyces reessii. Arch Microbiol (1998) 169:257–262.). Compared to traditional chemical synthesis, microbial synthesis of HMB offers advantages such as mild reaction conditions and the absence of harsh reagents. However, it still faces drawbacks such as low yields and complex reaction conditions. Therefore, designing and developing a green and efficient method for HMB production is crucial. Summary of the Invention

[0008] To construct a non-pathogenic microorganism capable of producing β-hydroxy-β-methylbutyric acid (β-methylbutyric acid) via fermentation using glucose as a carbon source, this invention utilizes genetic engineering technology to couple the existing branched-chain amino acid degradation metabolic pathway of *Yarrowia lipolytica* with the mevalonate pathway, constructing a new synthetic pathway for β-hydroxy-β-methylbutyric acid (β-methylbutyric acid), resulting in an engineered bacterium capable of directly producing β-hydroxy-β-methylbutyric acid through fermentation. Specifically, this invention includes the following technical solutions:

[0009] A method for constructing an engineered bacterium producing β-hydroxy-β-methylbutyric acid includes the following steps:

[0010] 1) Using Yarrowia lipolytica as chassis cells, the HMGCL and OCT genes in its genome, which are involved in the degradation and metabolism of branched-chain amino acids, were knocked out and inactivated to obtain gene knockout strains.

[0011] 2) The decarboxylase gene, hydratase gene, dehydratase gene, and thioesterase gene were integrated into the genome of the gene knockout strain to obtain an engineered bacterium that produces β-hydroxy-β-methylbutyric acid.

[0012] 2. The engineered bacteria producing β-hydroxy-β-methylbutyric acid as described in claim 1, characterized in that the decarboxylase genes CcGCTA and CcGCTB, the hydratase gene GrECH, the dehydratase gene AsMGCH, and the thioesterase gene LbTE are integrated into the genome of the gene knockout strain.

[0013] Preferably, the base sequence of gene CcGCTA is as shown in SEQ ID NO:1 or its degenerate sequence, the base sequence of gene CcGCTB is as shown in SEQ ID NO:2 or its degenerate sequence, the base sequence of gene GrECH is as shown in SEQ ID NO:3 or its degenerate sequence, the base sequence of gene AsMGCH is as shown in SEQ ID NO:4 or its degenerate sequence, and the base sequence of gene LbTE is as shown in SEQ ID NO:5 or its degenerate sequence.

[0014] More preferably, the CcGCTA and CcGCTB genes from Corallococcus coralloides, the GrECH gene from Galactomyces reessii, the AsMGCH gene from Acinetobacter, and the LbTE gene from Levilactobacillus brevis are integrated into the genome of the gene knockout strain.

[0015] 3) Select positive transformants and perform PCR verification on the genome to obtain engineered bacteria that produce β-hydroxy-β-methylbutyric acid.

[0016] In one implementation, the gene knockout inactivation process in step 1) is accomplished by gene editing using the CRISPR / Cas9 system.

[0017] The above-mentioned interruption and inactivation treatment of HMGCL and OCT genes can be achieved by using the CRISPR / Cas9 system to cut the YALI1_B29483g and YALI1_F34029g genes annotated in the Yersinia lipolytica genome.

[0018] Preferably, gene integration in step 2) is achieved by co-transforming the gene knockout strain obtained in step 1) with the CcGCTA, CcGCTB, GrECH, AsMGCH and LbTE gene expression modules, utilizing the cell's own DNA assembly and recombination capabilities.

[0019] In one implementation, step 2) uses the Nourseothricin Sulfate gene as a selection marker to integrate and assemble the gene expression modules onto the chromosome.

[0020] The aforementioned gene expression modules include: CcGCTA gene expression module P TEFin -CcGCTA-T PEX20 Contains promoter P TEFin Gene CcGCTA, terminator T PEX20 ;CcGCTB expression module P TEFin -CcGCTB-T PEX20 Contains promoter P TEFin Gene CcGCTB, terminator T PEX20 ; CcGCTA-CcGCTB fusion gene expression module PT EFin -CcGCTB-linker-CcGCTA-T PEX20 Contains promoter P TEFin fusion protein gene CcGCTB-linker-CcGCTA, terminator T PEX20 GrECH gene expression module P EXP1 -GrECH-T PEX20 Contains promoter P EXP1 GrECH gene, terminator T PEX20 ;AsMGCH gene expression module P TEFin -AsMGCH-T LIP2 Contains promoter P TEFin Gene AsMGCH, terminator T LIP2 LbTE gene expression module P TEFin -LbTE-T LIP2 Contains promoter P TEFin LbTE gene, terminator T LIP2 .

[0021] Preferably, the base sequence of the gene CcGCTA is SEQ ID NO:1, the base sequence of the gene CcGCTB is SEQ ID NO:2, the base sequence of the gene GrECH is SEQ ID NO:3, the base sequence of the gene AsMGCH is SEQ ID NO:4, and the base sequence of the gene LbTE is SEQ ID NO:5.

[0022] The aforementioned Yarrowia lipolytica basal cells are, for example, Yarrowia lipolytica W29.

[0023] According to a second aspect of the present invention, an engineered bacterium for de novo synthesis of β-hydroxy-β-methylbutyric acid using HMG-CoA as a substrate is provided, which is obtained by the method described above.

[0024] According to a third aspect of the invention, the use of the above-described engineered bacteria in the fermentation production of β-hydroxy-β-methylbutyric acid is provided.

[0025] Preferably, the engineered Yersinia lipolyticis strain uses glucose as the main carbon source for fermentation, and fed-batch fermentation is preferred.

[0026] The engineered *Yarrowia lipolytica* strain constructed in this invention can directly produce β-hydroxy-β-methylbutyric acid (β-HMA) through fermentation using glucose as the main carbon source. In a preferred embodiment, the recombinant strain obtained can achieve a β-hydroxy-β-methylbutyric acid yield of up to 30 g / L during fed-batch fermentation, demonstrating promising prospects for industrial development and application. Attached Figure Description

[0027] Figure 1 Schematic diagram of the biosynthetic pathway of β-hydroxy-β-methylbutyric acid

[0028] Figure 2 The production of β-hydroxy-β-methylbutyric acid in strains with knockout of HMGCL, OCT and integration of exogenous genes.

[0029] Figure 3 Increase the production of β-hydroxy-β-methylbutyric acid in strains with increased gene copy number.

[0030] Figure 4 Changes in β-hydroxy-β-methylbutyric acid production by recombinant strains during fed-batch fermentation. Detailed Implementation

[0031] Main culture medium:

[0032] LB medium contains: 5g yeast extract, 10g tryptone, and 10g sodium chloride per L. LB solid medium is supplemented with 15g / L agar powder.

[0033] LB+AMP medium, each L volume of LB medium containing ampicillin contains: 5g yeast extract, 10g tryptone, 10g sodium chloride, with a final concentration of 100mg ampicillin.

[0034] YPD medium, each L volume of YPD medium contains: 20g peptone, 10g yeast extract, 20g glucose, and 20g agar powder (added to YPD solid medium).

[0035] YPD plates containing norsulcin contain the following per L volume of YPD medium containing kanamycin: 20 g peptone, 10 g yeast extract, 20 g glucose, 20 g agar powder, and 250 mg norsulcin.

[0036] Delft liquid medium, each L volume of Delft liquid medium contains: 20g glucose, 7.5g ammonium sulfate, 0.5g magnesium sulfate heptahydrate, 14.4g potassium dihydrogen phosphate, 2ml trace metal salt stock solution (1L volume contains 3.0g ferric sulfate heptahydrate, 4.5g zinc sulfate heptahydrate, 4.5g calcium chloride dihydrate, 0.84g manganese chloride dihydrate, 0.3g cobalt chloride hexahydrate, 0.3g copper sulfate pentahydrate, 0.4g sodium molybdate dihydrate, 1.0g boric acid, 0.1g potassium iodide, 19.0g disodium EDTA), and 1ml vitamin stock solution (1L volume contains 0.05g D-biotin, 1.0g D-pantothenic acid, 1.0g vitamin B1, 1.0g pyridoxine, 1.0g nicotinic acid, 0.2g 4-aminobenzoic acid, 25.0g inositol).

[0037] The supplemental culture medium contains, per L volume: 700g glucose, 5g ammonium sulfate, 0.5g magnesium sulfate heptahydrate, 3g potassium dihydrogen phosphate, 10ml trace metal salt stock solution, and 5ml vitamin stock solution.

[0038] PCR amplification system and amplification procedure:

[0039] PCR amplification system: The amplification system was prepared using PrimSTAR HSDNA polymerase (TAKARA). The amplification system consisted of: 10 μL of 5×PS Buffer, 4 μL of dNTP Mix, 1 μL each of primers F and R, 1 μL of DNA template, 0.5 μL of HS polymerase (2.5 U / μL), and distilled water to a total volume of 50 μL.

[0040] PCR amplification program: 98℃ pre-denaturation for 1 minute (1 cycle); 98℃ denaturation for 10 seconds, 55℃ annealing for 5 seconds, 72℃ extension for x minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle). The amplification rate of PrimeSTAR HSDNA polymerase is 1 kb / min, so x depends on the fragment length.

[0041] Conditions for HPLC determination of β-hydroxy-β-methylbutyric acid:

[0042] The mobile phase was 5 mM H₂SO₄, with a flow rate of 0.6 mL / min; the column temperature was 63.0℃, and the RID optical element temperature was 35℃; the injection volume was 5 μL, the stop time was 25 min, and the run time was 0 min. The chromatographic column was an Aminex HPX-87H column (7.8 × 300 mm, 1250140, Bio-Rad). The peak time for β-hydroxy-β-methylbutyric acid standard was 14.8 min.

[0043] Example 1: Construction of gRNA plasmid and DNA fragment

[0044] 1. Selection of relevant enzymes and their combinations

[0045] This invention screened two decarboxylases, two dehydrating enzymes, two hydrating enzymes, and three thioesterases from different sources, testing a total of 24 enzyme combinations. The combination of the decarboxylases CcGCTA (H8MN93) and CcGCTB (H8MN92) from *Corallococcus coralloides*, the hydrating enzyme GrECH (KAF5095362.1) from *Galactomyces reessii*, the dehydrating enzyme AsMGCH (WP_092768409.1) from *Acinetobacter*, and the thioesterase LbTE (ABJ63754.1) from *Levilactobacillus brevis* showed the best results, enabling the construction of an efficient β-hydroxy-β-methylbutyrate synthesis pathway.

[0046] 2. Construction of recombinant plasmids containing gRNA:

[0047] Yersinia lipolyticis W29 was used as the chassis cell. To maximize the production of the target product β-hydroxy-β-methylbutyric acid, the genes involved in the reverse competitive steps of HMG-CoA and AcAc-CoA in the known pathway were first knocked out (see [link to relevant documentation]). Figure 1 Plasmids for targeted cleavage of the HMGCL (YALI1_B29483g) and OCT (YALI1_F34029g) genes were selected and constructed.

[0048] The gRNA plasmid construction process is as follows: Using the pET32a vector as a template, the fragment containing the AmpR expression cassette and the ori fragment is amplified using the corresponding primers. Using the Yeast lipolyticis genome as a template, the fragment P is amplified using the corresponding primers. POT CEN1, P EXP1 P tRNA and T rpr1The norovirus resistance gene and tracrRNA gene were synthesized by Suzhou Genewiz Biotechnology Co., Ltd. Subsequently, the norovirus resistance gene expression cassette and gRNA expression cassette fragments were obtained using overlap PCR with appropriate primers. These fragments were then recombined in vitro using the CloneExpress II kit (Novizan) and transformed into DH5α competent cells. The transformants were then transferred to LB medium containing 100 μg / ml ampicillin and cultured overnight. Plasmid extraction was performed using the Axygen plasmid extraction kit, and sequencing was performed to confirm vector correctness.

[0049] The names of the gRNA plasmids used in this invention and their target sequences are as follows:

[0050]

[0051]

[0052] 3. Construction of DNA fragments

[0053] The exogenous genes involved in this invention include CcGCTA (H8MN93) and CcGCTB (H8MN92) from *Corallococcus coralloides*, GrECH (KAF5095362.1) from *Galactomyces reessii*, AsMGCH (WP_092768409.1) from *Acinetobacter*, and LbTE (ABJ63754.1) from *Levilactobacillus brevis*. These genes were synthesized by Tianjin Qingke Biotechnology Co., Ltd. after codon optimization.

[0054] (1) Construction of HMGCL knockout fragment

[0055] Using the genome of *Yarrowia lipolyticis* strain W29 as a template, the upstream sequence HMGCL-UP (GenBank: CP028449.1, Range 2935674-2936212) and the downstream sequence HMGCL-DW (GenBank: CP028449.1, Range 2937170-2937713) of the HMGCL gene ORF region were amplified. Subsequently, overlap PCR was performed using primers HMGCL-UP-F and HMGCL-DW-R to fuse HMGCL-UP and HMGCL-DW, obtaining the homologous repair fragment ΔHMGCL required for HMGCL knockout. The primers used are as follows:

[0056] HMGCL-UP-F: GTTCTGAGAGAGCTGGTGGGC

[0057] HMGCL-UP-R:TTTTGACGAGTTTGGTGACGATTGG

[0058] HMGCL-DW-F:CCAATCGTCACCAAACTCGTCAAAATGTGTGTTTAGCAGTCGTTAG GATCG

[0059] HMGCL-DW-R: CTCACTGGCCTCTGGAGAAGCC.

[0060] (2) Construction of OCT knockout fragments

[0061] Using the genome of *Yarrowia lipolyticis* strain W29 as a template, the upstream sequence OCT-UP (GenBank: CP028453.1, Range 3372227-3372850) and the downstream sequence OCT-DW (GenBank: CP028453.1, Range 3374390-3374888) of the OCT gene ORF region were amplified. Subsequently, overlap PCR was performed using primers OCT-UP-F and OCT-DW-R to fuse OCT-UP and OCT-DW, obtaining the homologous repair fragment ΔOCT required for OCT knockout. The primers used are as follows:

[0062] OCT-UP-F: CCACACCCTAATGGAGGATTCG

[0063] OCT-UP-R: GTAACACGGAGGTAACTCAACTATCCAGACAAAAGCACAAGTATATTA GAAGGTG

[0064] OCT-DW-F: TGGATAGTTGAGTTACCTCCGTGTTAC

[0065] OCT-DW-R:GCATACCACCGGTTACCGTAGA.

[0066] (3) Construction of CcGCTA gene expression module

[0067] Using the genome of Yersinia lipophila strain W29 as a template, PCR was performed to amplify the promoter P. TEFin (GenBank:CP028450.1, Range 1226844-1227373), Termination Sub-T PEX20The fragment (GenBank: CP028452.1, Range 816666-816978), the upstream (GenBank: CP028450.1, Range 1815612-1816086) and downstream homologous arm (GenBank: CP028450.1, Range 1815065-1815579) sequences of the integration site Int1 were obtained. Simultaneously, the CcGCTA gene fragment was amplified using primers CcGCTA-F and CcGCTA-R. Overlap PCR was performed using primers Int1-UP-F and Int1-DW-R, respectively, to fuse the CcGCTA gene, promoter, terminator, and upstream and downstream homologous arms to obtain the integrated fragment Int1-UP-P. TEFin -CcGCTA-T PEX20 -Int1-DW.

[0068] The primers used are as follows:

[0069] P TEFin -F: GAGACCGGGTTGGCGGCG

[0070] P TEFin -R: CTGCGGTTAGTACTGCAAAAAGTGCTG

[0071] T PEX20 -F: AAGGTGTGGATGGGGAAGTGAGTGAGTG

[0072] T PEX20 -R:ACGCAACTAACATGAATGAATACG

[0073] Int1-UP-F:GATTGAAACGCCTGACAAAAACGC

[0074] Int1-UP-R: CAAATACGCCGCCAACCCGGTCTCATACCTCCGAGTGTGCAGCC

[0075] Int1-DW-F: TATTCATTCATGTTAGTTGCGTAAGCGTTGCACGTTTCCATCTAAGACCTACATTTGTC

[0076] Int1-DW-R:AATTCGACGACCTGAACACTCGG

[0077] CcGCTA-F: CACTTTTTGCAGTACTAACCGCAGAACCGTGCTCGTTGGTCTAG

[0078] CcGCTA-R:CACTCACTTCCCCATCCACACTTTTACGCGGCAGAGCGAG.

[0079] (4) Construction of CcGCTB gene expression module

[0080] Using the genome of Yersinia lipophila strain W29 as a template, PCR was performed to amplify the promoter P. TEFin (GenBank:CP028450.1, Range 1226844-1227373), Termination Sub-T PEX20 The fragment (GenBank: CP028452.1, Range 816666-816978), the upstream (GenBank: CP028450.1, Range 548795-549254) and downstream homologous arm (GenBank: CP028450.1, Range 548249-548750) sequences of the integration site Int2 were obtained. Simultaneously, the CcGCTB gene fragment was amplified using primers CcGCTB-F and CcGCTB-R. Overlap PCR was performed using primers Int2-UP-F and Int2-DW-R, respectively, to fuse the CcGCTB gene, promoter, terminator, and upstream and downstream homologous arms to obtain the integrated fragment Int2-UP-P. TEFin -CcGCTB-T PEX20 -Int2-DW.

[0081] The primers used are as follows:

[0082] P TEFin -F: GAGACCGGGTTGGCGGCG

[0083] P TEFin -R: CTGCGGTTAGTACTGCAAAAAGTGCTG

[0084] T PEX20 -F: AAGGTGTGGATGGGGAAGTGAGTGAGTG

[0085] T PEX20 -R:ACGCAACTAACATGAATGAATACG

[0086] Int2-UP-F:AATTATTGCACAGGACACACACAAGGTTTC

[0087] Int2-UP-R: CAAATACGCCGCCAACCCGGTCTCGCCATAGCACTATTGTAGAGTGGCCInt2-DW-F: CGTATTCATTCATGTTAGTTGCGTAAGCGTTGCACGTTACAGTGTCTATC AACGGGGC

[0088] Int2-DW-R:AAAAAAACTGTAGTAGTGTGGTGATGGAGTC

[0089] CcGCTB-F: GCACTTTTTGCAGTACTAACCGCAGACCACCACCACTGTTGACGC

[0090] CcGCTB-R: CACTCACTTCCCCATCCACACTTTTAGCCACCTACCAGCGCG.

[0091] (5) Construction of CcGCTB-CcGCTA fusion expression module

[0092] Using the genome of Yersinia lipophila strain W29 as a template, PCR was performed to amplify the promoter P. TEFin (GenBank:CP028450.1, Range 1226844-1227373), Termination Sub-T PEX20 The fragment (GenBank: CP028452.1, Range 816666-816978) was amplified, along with the upstream (GenBank: CP028452.1, Range 2868676-2869150) and downstream homologous arm (GenBank: CP028452.1, Range 2868103-2868622) sequences of the integration site Int3. Simultaneously, the CcGCTA and CcGCTB gene fragments were amplified using primers CcGCTA-F2 and CcGCTA-R, and CcGCTB-F and CcGCTB-R2. Overlap PCR was performed using primers Int3-UP-F and Int3-DW-R, respectively, to amplify the P... TEFin CcGCTA, CcGCTB, T PEX20 By fusing with upstream and downstream homologous arms, the integrated fragment Int3-UP-P is obtained. TEFin -CcGCTB-linker-CcGCTA-T PEX20 -Int3-DW.

[0093] The primers used are as follows:

[0094] P TEFin -F: GAGACCGGGTTGGCGGCG

[0095] P TEFin -R: CTGCGGTTAGTACTGCAAAAAGTGCTG

[0096] T PEX20 -F: AAGGTGTGGATGGGGAAGTGAGTGAGTG

[0097] T PEX20 -R:ACGCAACTAACATGAATGAATACG

[0098] Int3-UP-F:TTAACACTGGACCGTACTGCCCAG

[0099] Int3-UP-R: CATTCATGTTAGTTGCGTAAGCGTTGCACGTTCCCCTCCCCACGGTG

[0100] Int3-DW-F: CGCCGCCAACCCGGTCTCAACAGGGAACATCGACTCTGAGAC

[0101] Int3-DW-R: GCGGAGGAGCAATAGACATACGATTTG

[0102] CcGCTA-F2: GGCGGAGGGAGCGGCGGAGGGAGCAACCGTGCTCGTTGGTCTAG

[0103] CcGCTA-R:CACTCACTTCCCCATCCACACTTTTACGCGGCAGAGCGAG.

[0104] CcGCTB-F: GCACTTTTTGCAGTACTAACCGCAGACCACCACCACTGTTGACGC

[0105] CcGCTB-R2: GCTCCCTCCGCCGCTCCCTCCGCCGCCACCTACCAGCGCGTC.

[0106] (6) Construction of GrECH expression module

[0107] Using the genome of Yersinia lipophila strain W29 as a template, PCR was performed to amplify the promoter P. EXP1 (GenBank:CP028450.1, Range 1637803-1638803), Termination Sub-T PEX20The fragment (GenBank: CP028452.1, Range 816666-816978), and the sequences upstream (GenBank: CP028452.1, Range 1721682-1722148) and downstream homologous arms (GenBank: CP028452.1, Range 1721135-1721634) of the integration site Int4 were extracted. Simultaneously, the GrECH gene fragment was amplified using primers GrECH-F and GrECH-R. Overlap PCR was performed using primers Int4-UP-F and Int4-DW-R, respectively, to amplify the P... EXP1 GrECH, T PEX20 By fusing with upstream and downstream homologous arms, the integrated fragment Int4-UP-P is obtained. EXP1 -GrECH-T PEX20 -Int4-DW.

[0108] The primers used are as follows:

[0109] P EXP1 -F:AAGGAGTTTGGCGCCCGTTTTTTC

[0110] P EXP1 -R: TGCTGTAGATATGTCTTGTGTGTAAGGGG

[0111] T PEX20 -F: AAGGTGTGGATGGGGAAGTGAGTGAGTG

[0112] T PEX20 -R:ACGCAACTAACATGAATGAATACG

[0113] GrECH-F: CCCCTTACACAGACATATCTACAGCAATGCTGCGAACCATCCACC

[0114] GrECH-R:CACTCACTTCCCCATCCACACTTTTACTCCAGCTCGGTAGAGAACAC

[0115] Int4-UP-F:GTTAGAAGCAATTGGAGAAGAAACGTTCAG

[0116] Int4-UP-R: GAAAAAACGGGGCCAAACTCCTTTTGTGTCGAAATACAACAGCCAGT CC

[0117] Int4-DW-F: CGTATTCATTCATGTTAGTTGCGTAAGCGTTGCACGTAAGCACTATCCTC TGCTGCG

[0118] Int4-DW-R:TTGATATGGTGTAACAATGATAAACCAAGGCC.

[0119] (7) Construction of the AsMGCH gene expression module

[0120] Using the genome of Yersinia lipophila strain W29 as a template, PCR was performed to amplify the promoter P. TEFin (GenBank:CP028450.1, Range 1226844-1227373), Termination Sub-T LIP2 The fragment (GenBank: CP028448.1, Range 2089124-2090060), the upstream (GenBank: CP028452.1, Range 1837511-1838024) and downstream homologous arm (GenBank: CP028452.1, Range 1838090-1838558) sequences of the integration site Int5 were obtained. Simultaneously, the AsMGCH gene fragment was amplified using primers AsMGCH-F and AsMGCH-R. Overlap PCR was performed using primers Int5-UP-F and Int5-DW-R, respectively, to fuse the AsMGCH gene, promoter, terminator, and upstream and downstream homologous arms to obtain the integrated fragment Int5-UP-P. TEFin -AsMGCH-T LIP2 -Int5-DW.

[0121] The primers used are as follows:

[0122] P TEFin -F: GAGACCGGGTTGGCGGCG

[0123] P TEFin -R: CTGCGGTTAGTACTGCAAAAAGTGCTG

[0124] P LIP2 -F:CTTCTGTTCGGAATCAACCTCAAGG

[0125] P LIP2 -R:CAGATGCATTCTTGGGCGGTC

[0126] AsMGCH-F: CAGCACTTTTTGCAGTACTAACCGCAGTCCTACGAGTTCCTGCAGCTGAsMGCH-R: CCTTGAGGTTGATTCCGAACAGAAGTTACTGCTCAGCGGTGGCTTG

[0127] Int5-UP-F:TAACTTTTTTCGTGACTCTGTTCCCCAC

[0128] Int5-UP-R: CGCCGCCAACCCGGTCTCTGTTTGATGTCTTGAGTTTGAGGTCATTTC

[0129] Int5-DW-F: GACCGCCCAAGAATGCATCTGAGTGGCCTTCTGGCACAGAAATGACCA CAC

[0130] Int5-DW-R:GTGAAGGAAATGCCTAAAACCTGAATTG.

[0131] (8) Construction of LbTE gene expression module

[0132] Using the genome of Yersinia lipophila strain W29 as a template, PCR was performed to amplify the promoter P. TEFin (GenBank:CP028450.1, Range 1226844-1227373), Termination Sub-T LIP2 The LbTE gene fragment (GenBank: CP028448.1, Range 2089124-2090060), the upstream (GenBank: CP028453.1, Range 3917440-3918034) and downstream homologous arm (GenBank: CP028453.1, Range: 3915506-3916075) sequences of the integration site Int6 were obtained. Simultaneously, the LbTE gene fragment was amplified using primers LbTE-F and LbTE-R. Overlap PCR was performed using primers Int6-UP-F and Int6-DW-R, respectively, to fuse the LbTE gene, promoter, terminator, and upstream and downstream homologous arms to obtain the integrated fragment Int6-UP-P. TEFin -LbTE-T LIP2 -Int6-DW.

[0133] The primers used are as follows:

[0134] P TEFin -F: GAGACCGGGTTGGCGGCG

[0135] PTEFin -R: CTGCGGTTAGTACTGCAAAAAGTGCTG

[0136] P LIP2 -F:CTTCTGTTCGGAATCAACCTCAAGG

[0137] P LIP2 -R:CAGATGCATTCTTGGGCGGTC

[0138] LbTE-F: CAGCACTTTTTGCAGTACTAACCGCAGGCAGCAAACGAATTCTCTGAAAC TC

[0139] LbTE-R: CCTTGAGGTTGATTCCGAACAGAAGTTAGCGATTGTCCCACTGAATGGTAG

[0140] Int6-UP-F:CTTGAGCGCCACGGTACATTCC

[0141] Int6-UP-R: CGCCGCCAACCCGGTCTCTGTTGGATTGGAGGATTGGATAGTGG

[0142] Int6-DW-F: GACCGCCCAAGAATGCATCTGGGCAATTAACAGATAGTTTGCCGGTG

[0143] Int6-DW-R: CGGTTAAATCTCCGCCTCACTGC.

[0144] Example 2: Construction of recombinant strains

[0145] Transformation and screening of Yersinia lipophila:

[0146] The host bacterium W29 was streaked onto YPD solid medium and incubated at 30°C for 1 day. The cells were then collected for transformation. Cells were collected in a clean bench. 2 ml of sterile water was added to the W29-enriched medium, and the cells were repeatedly rinsed with a pipette tip to obtain as many cells as possible. The cells were collected at 3000 rpm for 30 seconds, centrifuged, and the supernatant was removed. The cells were then washed again, resuspended in 1 ml of sterile water, washed, and centrifuged at 3000 rpm for 30 seconds, removing the supernatant. This step was repeated twice. The OD of the cells was measured; 3 OD was required for transformation. The target volume was taken and centrifuged to remove water. In a 1.5 ml centrifuge tube, 500 ng of recombinant vector, 10 μl of sDNA, 5 μl of DTT, 5 μl of LiAc, and 80 μl of 60% PEG were added sequentially, and the mixture was resuspended. The tube was incubated at 39°C for 1 hour to allow the plasmids and fragments to enter the recipient bacteria. Collect bacterial cells by centrifugation, add 500 μl of antibiotic-free YPD liquid medium to the bacterial culture, and incubate at 30°C and 200 rpm for 2 h. Centrifuge to remove the supernatant, wash the bacterial cells with 1 ml of sterile water, resuspend in 200 μl of sterile water, and spread on YPD+Nat solid medium. Select strains growing on the plates and incubate in 300 μl of YPD+Nat liquid medium at 30°C for 24 h. Take 100 μl of bacterial culture in a clean bench, centrifuge to remove the supernatant, add 100 μl of LiAC, mix well, and incubate at 60°C for 20 min. Add 300 μl of 95% ethanol, centrifuge for 3 min, and remove the supernatant. Add 300 μl of 70% ethanol and wash twice. Then open the lid and dry at 60°C for 5 min. Add 30 μl of water to dissolve the genome, and take 1 μl for subsequent PCR to detect whether the band is the target band. After extracting the correct bacterial strain, it is necessary to shake it again with antibiotic-free YPD to discard the plasmid, and then streak a single colony onto YPD solid medium. To verify successful plasmid loss, first streak on YPD+Nat solid medium, then on YPD solid medium, selecting strains that do not show signs of antibiotic resistance but grow well on YPD solid medium for subsequent preservation. The correct strain is then shaken with 2 ml of YPD, with the final glycerol concentration for preservation being 15%-20%.

[0147] 1. Construction of recombinant strain HMB01

[0148] Using Yersinia lipophila W29 as the starting strain, competent cells were prepared, and plasmids gRNA-HMGCL and gRNA-OCT, as well as fragments ΔHMGCL and ΔOCT, were added before transformation. The transformed cells were plated on YPD plates containing norsinolate to screen for positive clones. Then, positive clones were selected and transferred to antibiotic-free YPD liquid medium to remove the plasmids. The strain that was correctly identified after plasmid removal was named HMB01 and stored.

[0149] 2. Construction of recombinant strain HMB02

[0150] Competent cells were prepared using recombinant strain HMB01 as the starting strain, and plasmid gRNA1 and fragment Int1-UP-P were added. TE Fin -CcGCTA-T PEX20 After Int1-DW, transformation was performed. Transformed cells were plated onto YPD plates containing noroside for screening of positive clones. Positive clones were then selected and transferred to antibiotic-free YPD liquid medium for plasmid removal. Plasmid removal was completed, and the correct strain was identified. Using this correct strain as the starting strain, competent cells were prepared, and plasmid gRNA2 and the fragment Int2-UP-P were added. TEFin -CcGCTB-T PEX20 After Int2-DW, the cells were transformed and plated onto YPD plates containing norsinolate to screen for positive clones. The positive clones were then selected and transferred to YPD liquid medium without antibiotics to remove the plasmid. The plasmid was removed and the correct strain was identified, named HMB02, and stored.

[0151] (3) Construction of recombinant strain HMB03

[0152] Using recombinant strain HMB01 as the starting strain, competent cells were prepared, and plasmid gRNA3 and fragment Int3-UP-P were added. TE Fin -CcGCTB-linker-CcGCTA-T PEX20 After Int3-DW, the cells were transformed and plated onto YPD plates containing norsinolate to screen for positive clones. The positive clones were then selected and transferred to YPD liquid medium without antibiotics to remove the plasmid. The plasmid was removed and the correct strain was identified, named HMB03, and stored.

[0153] (4) Construction of recombinant strain HMB04

[0154] Using recombinant strain HMB02 as the starting strain, competent cells were prepared, and plasmid gRNA4 and fragment Int4-UP-P were added. E XP1 -GrECH-T PEX20 After Int4-DW, transformation was performed. Transformed cells were plated onto YPD plates containing noroside for screening of positive clones. Positive clones were then selected and transferred to antibiotic-free YPD liquid medium for plasmid removal. Plasmid removal was completed, and the correct strain was identified. Using this correct strain as the starting strain, competent cells were prepared, and plasmid gRNA5 and the fragment Int5-UP-P were added. TEFin -AsMGCH-T lip2After Int5-DW, the cells were transformed and plated onto YPD plates containing norsinolate to screen for positive clones. The positive clones were then selected and transferred to YPD liquid medium without antibiotics to remove the plasmid. The plasmid was removed and the correct strain was identified, named HMB04, and stored.

[0155] (5) Construction of recombinant strain HMB05

[0156] Using recombinant strain HMB04 as the starting strain, competent cells were prepared, and plasmid gRNA6 and fragment Int6-UP-P were added. TE Fin -LbTE-T lip2 After Int6-DW, the cells were transformed and plated onto YPD plates containing norsinolate to screen for positive clones. The positive clones were then selected and transferred to YPD liquid medium without antibiotics to remove the plasmid. The plasmid was removed and the correct strain was identified, named HMB05, and stored.

[0157] (6) Construction of recombinant strain HMB06

[0158] Using recombinant strain HMB05 as the starting strain, competent cells were prepared, and plasmid gRNA3 and fragment Int3-UP-P were added. TE Fin -CcGCTB-linker-CcGCTA-T PEX20 After Int3-DW, the cells were transformed and plated onto YPD plates containing norsinolate to screen for positive clones. The positive clones were then selected and transferred to YPD liquid medium without antibiotics to remove the plasmid. The plasmid was removed and the correct strain was identified, named HMB06, and stored.

[0159] Example 3: Application of engineered strains in the production of β-hydroxy-β-methylbutyric acid

[0160] (1) Culture of engineered strains and extraction of products

[0161] Production of β-hydroxy-β-methylbutyric acid by shake-flask fermentation: The *Yarrowia lipolytica* strain constructed in Example 2 was removed from a -80°C freezer and thawed on an ice pack. The strain was then activated by streaking on YPD plates. Three single colonies were selected and placed in test tubes containing seed culture medium (Delft pH 6.0), 3 ml of medium per tube, and cultured at 30°C and 250 rpm for 24 h. The OD of the seed culture was measured and transferred to 100 ml shake flasks containing 20 ml of Delft pH 6.0 medium, and cultured at 30°C and 250 rpm for a total of 96 h. Samples were taken every 24 h for later use.

[0162] Fed-feed fermentation for the production of β-hydroxy-β-methylbutyric acid: Strain HMB06 was activated in Delft liquid medium, and a primary seed culture was prepared in Delft pH 6.0 liquid medium (30℃, 250 rpm, 36 h). This seed culture was then transferred at an appropriate inoculum size to a 500 mL Erlenmeyer flask containing 100 mL of Delft pH 6.0 liquid medium to allow the initial OD to reach the target value. 600nm =0.1, 30℃, 250rpm for 24h to prepare secondary seed culture. Then, the cells were collected by centrifugation, resuspended in sterile water, and inoculated into the fermenter. When the glucose in the initial culture medium was depleted, fed-batch culture medium was started to maintain the glucose concentration in the fermenter below 5g / L until fermentation was completed. During this period, samples were taken at appropriate time points, and appropriate amounts of fermentation broth were collected for later use.

[0163] (2) Qualitative and quantitative analysis of β-hydroxy-β-methylbutyric acid production by engineered bacteria

[0164] The retained fermentation broth was appropriately diluted, centrifuged at 14000g for 10 min. The supernatant was collected, filtered through a 0.22μm filter membrane, and then analyzed by HPLC. The specific detection method is the same as that for the HPLC determination of β-hydroxy-β-methylbutyric acid.

[0165] Qualitative and quantitative analysis was performed using a standard of β-hydroxy-β-methylbutyric acid, with a peak elution time of 14.8 min. The fermentation broth collected in step (1) showed a peak at the corresponding time, indicating that the fermentation broth collected in step (1) contained β-hydroxy-β-methylbutyric acid.

[0166] The results are as follows Figure 2 and Figure 3 As shown, the yields of β-hydroxy-β-methylbutyric acid by each strain after 96 h of fermentation in shake flasks were as follows: W29: 0 g / L, HMB01: 0 g / L, HMB02: 0.19 g / L, HMB03: ​​0.17 g / L, HMB04: 1.55 g / L, HMB05: 1.67 g / L, and HMB06: 2.38 g / L.

[0167] Furthermore, strain HMB06 was subjected to fed-batch fermentation in a fermenter for 159 hours, and the yield of β-hydroxy-β-methylbutyric acid from strain HMB06 was 30 g / L.

[0168] This embodiment demonstrates that the engineered bacteria constructed in this invention can use glucose as a carbon source to ferment and synthesize the target product β-hydroxy-β-methylbutyric acid, with a fermenter yield of up to 30 g / L.

Claims

1. An engineered bacterium producing β-hydroxy-β-methylbutyric acid, constructed by a method comprising the following steps: 1) Using Yarrowia lipolytica as the chassis cell, the HMGCL and OCT genes involved in branched-chain amino acid metabolism in its genome were knocked out to obtain gene knockout strains. 2) The decarboxylase genes CcGCTA and CcGCTB, the hydratase gene GrECH, the dehydratase gene AsMGCH, and the thioesterase gene LbTE were integrated into the genome of the gene knockout strain. The base sequence of the gene CcGCTA is shown in SEQ ID NO:1, the base sequence of the gene CcGCTB is shown in SEQ ID NO:2, the base sequence of the gene GrECH is shown in SEQ ID NO:3, the base sequence of the gene AsMGCH is shown in SEQ ID NO:4, and the base sequence of the gene LbTE is shown in SEQ ID NO:

5. The lipophilic Yarrowia lipolytica basal cells were Yarrowia lipolytica W29. The method for constructing the HMGCL gene knockout fragment is as follows: Using the genome of Yersinia lipophila strain W29 as a template, the upstream sequence HMGCL-UP of the HMGCL gene ORF region in GenBank: CP028449.1, Range 2935674-2936212 and the downstream sequence HMGCL-DW of the HMGCL gene ORF region in GenBank: CP028449.1, Range 2937170-2937713 were amplified. Then, overlapping PCR was performed using primers to fuse HMGCL-UP and HMGCL-DW to obtain the homologous repair fragment ΔHMGCL required for HMGCL knockout. The method for constructing the OCT gene knockout fragment is as follows: Using the genome of Yersinia lipophila strain W29 as a template, the upstream sequence OCT-UP of the OCT gene ORF region in GenBank: CP028453.1, Range 3372227-3372850 and the downstream sequence OCT-DW of the OCT gene ORF region in GenBank: CP028453.1, Range 3374390-3374888 were amplified. Then, using primers, OCT-UP and OCT-DW were fused to obtain the homologous repair fragment ΔOCT required for OCT knockout.

2. The engineered bacteria producing β-hydroxy-β-methylbutyric acid as described in claim 1, characterized in that, The gene knockout inactivation process in step 1) was accomplished by gene editing using the CRISPR / Cas9 system.

3. The engineered bacterium producing β-hydroxy-β-methylbutyric acid as described in claim 1, characterized in that, Step 2) uses the Nourseothricin Sulfate gene as a selection marker to integrate and assemble the gene expression modules onto the chromosome.

4. The engineered bacteria producing β-hydroxy-β-methylbutyric acid as described in claim 1, characterized in that, The gene expression module includes: a promoter P TEFin Gene CcGCTA, terminator T PEX20 The CcGCTA gene expression module; containing the promoter P TEFin Gene CcGCTB, terminator T PEX20 The CcGCTB expression module; containing the promoter P TEFin CcGCTB and CcGCTA fusion protein genes, terminator T PEX20 The CcGCTA-CcGCTB fusion gene expression module; containing the promoter P EXP1 GrECH gene, terminator T PEX20 GrECH gene expression module; containing promoter P TEFin Gene AsMGCH, terminator T LIP2 The AsMGCH gene expression module; containing the promoter P TEFin LbTE gene, terminator T LIP2 The LbTE gene expression module; The promoter P TEFin It is the bases from positions 1226844 to 1227373 in GenBank: CP028450.1, the terminator T. LIP2 It is the bases from position 2089124 to 2090060 in GenBank: CP028448.1, the promoter P. EXP1 It is the bases from position 1637803 to 1638803 in GenBank: CP028450.1; the terminator T PEX20 It is base position 816666-816978 in GenBank: CP028452.

1.

5. The engineered bacteria producing β-hydroxy-β-methylbutyric acid as described in claim 2, characterized in that, The knockout and inactivation of the HMGCL and OCT genes was performed by cutting the YALI1_B29483g and YALI1_F34029g genes using the CRISPR / Cas9 system.

6. Use of the engineered bacteria producing β-hydroxy-β-methylbutyric acid as described in any one of claims 1 to 5 in the fermentation production of β-hydroxy-β-methylbutyric acid.

7. A method for producing β-hydroxy-β-methylbutyric acid, characterized in that, It includes the following steps: fermenting and culturing the engineered bacteria that produce β-hydroxy-β-methylbutyric acid as described in any one of claims 1 to 5, and collecting the produced β-hydroxy-β-methylbutyric acid.

8. The method as described in claim 7, characterized in that, Glucose is used as the carbon source during fermentation culture.

Citation Information

Patent Citations

  • CN109251940A

  • CN116445311A