Pichia pastoris capable of producing brazitame protein as well as construction method and application of pichia pastoris

Abstract

The invention relates to pichia pastoris for producing brazitame protein as well as a construction method and application of the pichia pastoris, and belongs to the technical field of microorganisms. ExpL SP is used as a signal peptide in pichia pastoris, heterologous expression of Brazilian sweet protein is carried out through an AOX1 promoter, the ExpL SP and a Pro region of an alpha mating factor are further fused and transformed to obtain a new signal peptide to enhance the secretion efficiency, and the new signal peptide and a ribosomal protein synthesis factor Bcy1 are co-expressed to improve the protein synthesis capacity. The constructed pichia pastoris can be used for efficiently secreting the Brazilian sweet protein, the problems that in the prior art, when microorganisms are used for fermenting the Brazilian sweet protein, the Brazilian sweet protein is mistakenly folded, the sweet taste is reduced or lost are solved, the shake flask yield is stabilized at 450 mg / L, the fermentation tank yield reaches 5.215 g / L, and a high-cost-performance scheme is provided for industrial production of the Brazilian sweet protein.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, in particular to a Pichia pastoris producing brasiliensis and a construction method and application thereof. Background Art

[0002] Brazzein is a sweet protein isolated and purified from the fruit of the wild plant Pentadiplandra Brazzeana Baillon in West Africa. It is a single-chain polypeptide consisting of 54 amino acid residues, containing eight cysteines forming four pairs of intramolecular disulfide bonds. Brazzein has a relative molecular mass of 6500 and an isoelectric point of 5. Its sweetness is 2000 times that of an equal mass of sucrose. Compared with other sweet proteins, brazzein has the smallest molecular weight and the best water solubility. Its aqueous solution retains its sweetness after heat treatment at 80°C for 4 hours and exhibits excellent thermal and pH stability. As a natural sweetener, brazzein offers the advantages of high sweetness, low calories, and safety. It also helps to improve bitterness, reduce astringency, and maintain a long-lasting sweetness. It can be used as a food flavoring ingredient and combined with other sweeteners to form a more palatable sweetener. It has the potential to be used as a low-calorie sugar substitute, meeting the needs of those seeking to reduce or control their sugar intake.

[0003] Existing Brazilian melamine is mainly extracted from plant fruits, and has many limitations such as low extraction efficiency, production area restrictions, and environmental pollution. At present, microbial fermentation is a green, environmentally friendly and more economical method for producing Brazilian melamine. Chinese patent CN117887749A uses Trichoderma reesei to produce Brazilian melamine, and Chinese patent CN119431606A uses Escherichia coli to produce Brazilian melamine fusion protein. However, when using microbial fermentation to produce Brazilian melamine, the secreted Brazilian melamine may not have the correct protein structure due to misfolding or inability to fold in the cell during the fermentation process, and its function may be unable to be expressed, and the sweetness will decrease or lose its sweetness. For example, because the prokaryotic fermentation system (such as Escherichia coli) lacks the ability of eukaryotic post-translational modification, Brazilian melamine (with 4 pairs of disulfide bonds) is difficult to fold correctly. Even through in vitro renaturation, there are problems such as low efficiency and high cost. As a sweetener, Brazilian melamine has higher purity requirements for its production, and the existing technology may have problems such as high loss and low purity in the process of purifying Brazilian melamine.

[0004] Pichia pastoris is a yeast that can grow in a basal medium with methanol as the sole carbon and energy source. Its genome was sequenced in 2009 and is now widely used in recombinant protein expression and metabolic engineering research. As a eukaryotic expression host, Pichia pastoris offers advantages such as simple genetic manipulation, the ability to undergo complex post-translational modifications, high-density fermentation in inorganic salt media, and strong recombinant protein secretion. It is also certified as a GRAS (Generally Recognized as Safe) strain. Summary of the Invention

[0005] To address the above technical issues, the present invention provides a brazilin-producing Pichia pastoris, as well as a method for its construction and application. A brazilin expression system was constructed in Pichia pastoris, comprising the strong promoter AOX1 and the ExpL SP signal peptide. To improve secretion efficiency, a new signal peptide was generated by fusing ExpL SP with the Pro region of the α-mating factor. Furthermore, attempts were made to co-express the ribosomal protein synthesis factor Bcy1 with brazilin to enhance the protein synthesis capacity of Pichia pastoris, resulting in a recombinant Pichia pastoris suitable for brazilin production.

[0006] The first object of the present invention is to provide a Pichia pastoris that produces brazilian thaumatin, in which the brazilian thaumatin having a nucleotide sequence as shown in SEQ ID NO.1 is heterologously expressed using ExpL SP as a signal peptide, and the nucleotide sequence of the signal peptide is shown in SEQ ID NO.4.

[0007] Furthermore, the signal peptide and the brazilin are expressed using an AOX1 promoter.

[0008] Furthermore, the Pichia pastoris is Pichia pastoris X33.

[0009] Furthermore, the signal peptide is modified, and the modification is to combine it with the α mating factor to obtain a fusion signal peptide.

[0010] Furthermore, the modification is to connect the Pro region of the α mating factor to the C-terminus of the signal peptide ExpL SP.

[0011] Furthermore, the nucleotide sequence of the Pro region of the α mating factor is shown in SEQ ID NO.14.

[0012] Furthermore, the brazilin is co-expressed with a ribosomal protein synthesis factor.

[0013] Furthermore, the ribosomal protein synthesis factor is protein kinase A regulatory subunit Bcy1.

[0014] A second object of the present invention is to provide a method for constructing the above-mentioned Pichia pastoris, comprising the following steps:

[0015] Step S1, constructing a recombinant expression vector that sequentially expresses the signal peptide and brazilin;

[0016] Step S2: Transform the recombinant expression vector into competent Pichia pastoris to obtain recombinant Pichia pastoris.

[0017] Furthermore, the recombinant expression vector uses pPICZα as a skeleton.

[0018] The third object of the present invention is to provide a microbial agent comprising the above-mentioned Pichia pastoris.

[0019] A fourth object of the present invention is to provide the use of the above-mentioned Pichia pastoris or the above-mentioned microbial agent in the production of brazilian thaumatin.

[0020] A fifth object of the present invention is to provide a method for producing brasiliensis, comprising adding the above-mentioned Pichia pastoris or the above-mentioned microbial agent to a fermentation system, and adding methanol to the fermentation system for induction.

[0021] Furthermore, the steps include activating the Pichia pastoris and inoculating it into a seed culture medium to obtain a seed liquid, inoculating the seed liquid into a fermentation culture medium for fermentation, and obtaining brazilian tamarind after purifying the fermentation supernatant.

[0022] Furthermore, the fermentation time is 96-134 hours.

[0023] Preferably, the fermentation time is 134 hours.

[0024] Furthermore, the methanol is added 18-24 hours after the start of fermentation, at which time the glycerol in the fermentation system is completely consumed.

[0025] In one embodiment of the present invention, 12 mL of PTM1 trace salts are contained per liter of methanol applied.

[0026] In one embodiment of the present invention, the methanol feed rate is 3.6 mL / h per liter of initial fermentation volume, which is increased to 7.3 mL / h / L of initial fermentation volume after the culture is adapted to methanol, and further increased to 7.3 mL / h / L after 2 hours.

[0027] Beneficial effects of the present invention:

[0028] The present invention achieves high production of brassinolide by protein engineering of Pichia pastoris. The endoplasmic reticulum-Golgi system of Pichia pastoris can efficiently form disulfide bonds, so that brassinolide is correctly folded and has the correct native conformation. The use of the strong AOX1 promoter can drive the efficient secretion of brassinolide to the extracellular space, simplifying the downstream purification steps and reducing production costs. The modified fusion signal peptide is used to increase the secretion efficiency of brassinolide and avoid the toxicity caused by intracellular accumulation. The Bcy1 ribosomal protein synthesis factor is further used to co-express brassinolide to increase the target protein synthesis rate. The constructed Pichia pastoris is used for fermentation production of brassinolide, with a shake flask yield stable at 450 mg / L and a fermentation tank yield of 5.215 g / L, providing a tool for large-scale industrial production of Pichia pastoris and having good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0030] Figure 1 This is a graph showing the relative fluorescence intensity of the signal peptide-brazil fermentation broth in Example 2 of the present invention;

[0031] Figure 2 This is a diagram showing the SDS-PAGE electrophoresis results of the signal peptide-brasidin fermentation broth in Example 2 of the present invention;

[0032] Figure 3 This is a graph showing the Western Blot results of the signal peptide-brasidin fermentation broth in Example 2 of the present invention;

[0033] Figure 4 This is a schematic diagram of the purification and detection process of brasilin in Example 2 of the present invention;

[0034] Figure 5 This is a diagram showing the SDS-PAGE electrophoresis results of the optimized signal peptide-brasidin in Example 3 of the present invention;

[0035] Figure 6 This is a graph showing the protein yield of the optimized signal peptide-brasitan after purification and desalting in Example 3 of the present invention;

[0036] Figure 7 This is a graph showing the SDS-PAGE electrophoresis results of the ExpL SP-α-brasidin fermentation broth and the purified solution in Example 3 of the present invention;

[0037] Figure 8 This is a fluorescence co-localization result diagram in Example 4 of the present invention;

[0038] Figure 9This is a gel image of the co-expressed proteins of the molecular chaperones in Example 4 of the present invention;

[0039] Figure 10 This is a protein gel image of the co-expression of ribosomal proteins and transcription factors in Example 4 of the present invention, wherein A is the co-expression result of ribosomal proteins and B is the co-expression result of transcription factors;

[0040] Figure 11 This is a data diagram of the scale-up verification process of the recombinant Pichia pastoris 5-L tank in Example 4 of the present invention;

[0041] Figure 12 This is a gel image of the fusion protein with different signal peptide segments in the comparative example of the present invention. DETAILED DESCRIPTION

[0042] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0043] The detection method involved in the present invention is as follows:

[0044] Fluorescent protein detection: microplate reader;

[0045] Bicinchoninic acid (BCA) method: BCA kit (Biyuntian Biotechnology), microplate reader, 37°C constant temperature box.

[0046] Example 1: Construction of a recombinant Pichia pastoris strain secreting extracellular brasiliensis

[0047] (1) Based on the protein sequence of brazzein published on Uniprot (UniProt ID: P56552), codon optimization was performed according to the codon preference of Pichia pastoris and the whole gene was synthesized. The gene sequence after synthesis is shown in SEQ ID NO.1. The pPICZα plasmid was used as the backbone (AOX1 as the promoter) to construct the pPICZα-Brazzein recombinant plasmid. To detect whether brazzein is secreted extracellularly, primers A-Bra-F1, eGFP-Bra-R1, Fra-eGFP-F2, and Fra-A-R2 were used to amplify the brazzein gene fragment and the plasmid framework with the eGFP gene sequence.

[0048] The primer sequences are as follows (5'-3'):

[0049] Fra-A-R2:ACCTTCTTACACTTGTCCTGcgtttcgaataattagttgttttttgatcttctcaa;

[0050] A-Bra-F1: caactaattattcgaaacgCAGGACAAGTGTAAGAAGGTGTACGAA;

[0051] eGFP-Bra-R1:CCGCTGCCGCTACCATACTCACAGTAGTCGCAAATGCATT;

[0052] Fra-eGFP-F2:GTGAGTATGGTAGCGGCAGCGGC.

[0053] (2) The gene fragment obtained above was connected to the plasmid framework through one-step fusion PCR, and the connected product was transferred into the competent Escherichia coli DH5α, and then spread on the LB plate supplemented with bleomycin after culture. After inverted culture at 37°C overnight, single colonies were picked for colony PCR, and the positive colonies were transferred to 2 mL LB (supplemented with bleomycin). After culture at 37°C for 12 hours, the plasmid was extracted and sequenced.

[0054] (3) The above-mentioned correctly sequenced plasmid was linearized and electroporated into Pichia pastoris X33 competent cells. After culture, it was spread on YPD plates supplemented with bleomycin and cultured at 30°C until single colonies were obtained. Single colonies were picked for colony PCR. Positive single colonies and blank control colonies were transferred to 2 mL YPD (supplemented with bleomycin) and cultured overnight.

[0055] (4) 2 mL of the above-cultured seed solution was inoculated into a 250 mL conical flask containing 25 mL of BMMY medium. After culturing at 30°C and 220 rpm for 24 h, the fermentation broth was centrifuged (4000 × g, 5 min), the supernatant was discarded, and the cells were resuspended in 10 mL of sterile water. The cells were centrifuged under the same conditions, the supernatant was discarded, and 25 mL of BMGY medium was added to resuspend the cells. The cells were transferred to a 250 mL conical flask and cultured with methanol at 30°C and 220 rpm for 5 days. 1% by volume of methanol was added every 24 h.

[0056] (5) The fermentation broth was centrifuged (4000 × g, 5 minutes), and the supernatant was collected and the fluorescence value was measured using a microplate reader. The excitation wavelength of eGFP fluorescent protein was 488 nm, the emission wavelength was 523 nm, and the gain was 50. The fluorescence value was expressed in RFU (relative fluorescence units), where RFU = fluorescence intensity of the supernatant of the corresponding signal peptide fermentation broth - fluorescence intensity of the supernatant of the reference fermentation broth. No fluorescence intensity was found in the fermentation supernatant, indicating that brazilin could not be secreted extracellularly.

[0057] Example 2: Screening of signal peptides to promote extracellular secretion of brazilin

[0058] (1) Combining literature research with Signal IP 6.0 prediction, it was determined that brazilin itself did not contain a signal peptide sequence. Twelve signal peptides were screened. The signal peptide names and sequences are shown in Table 1. Thirteen pairs of primers were used to amplify the corresponding brazilin sequences and their corresponding signal peptide expression frameworks.

[0059] Table 1 Signal peptide sequence

[0060] Signal peptide name Signal peptide sequence (5'-3') α-MF SEQ ID NO.2 ExpL KR SEQ ID NO.3 ExpL SP SEQ ID NO.4 UTH1 SEQ ID NO.5 SUC2 SEQ ID NO.6 PROSCW10 SEQ ID NO.7 SCW10 SEQ ID NO.8 PHO11 SEQ ID NO.9 OST1 SEQ ID NO.10 MEL1 SEQ ID NO.11 INU1 SEQ ID NO.12 0030 SEQ ID NO.13

[0061] The primer sequences are as follows (5'-3'):

[0062] Fra-α-R2: ACCTTCTTACACTTGTCCTGAGCTTCAGCCTCTCTTTTCT CG;

[0063] α-Bra-F1: GGCTGAAGCTCAGGACAAGTGTAAGAAGGTGTACG;

[0064] Fra-UTH1-R2:ACTTGTCCTGGGAGGCCACCAGAGAGGC;

[0065] UTH1-Bra-F1: CTGGTGGCCTCCCAGGACAAGTGTAAGAAGGTGTA CG;

[0066] Fra-SUC2-R2: ACTTCTTACACTTGTCCTGTGCAGATATTTTGGCTGCAAAACCAG;

[0067] SUC2-Bra-F1: GCCAAAATATCTGCACAGGACAAGTGTAAGAAGGTGTACG;

[0068] Fra-SP-R2:CGTACACCTTCTTACACTTGTCCTGAGCTGAGACAACGGCGG;

[0069] SP-Bra-F1:TCTCAGCTCAGGACAAGTGTAAGAAGGTGTACG;

[0070] Fra-PROSCW10-R2:ACCTTCTTACACTTGTCCTGTCTCTTGTCATGTTGATGGTGGGC;

[0071] PROSCW10-Bra-F1: CAACATGACAAGAGACAGGACAAGTGTAAGAAGGTGTACG;

[0072] Fra-SCW10-R2:GTCCTGGGCCACGGCCAACG;

[0073] SCW10-Bra-F1:TTGGCCGTGGCCCAGGACAGTGTAAGAAGGTGTACG;

[0074] From-PHO11-R2:CACCTTCTTACACTTGTCCTTGTGCATTAACCAAAGAGAGCGGCTAAAATTG;

[0075] PHO11-Bra-F1:CTTCTTTGGTTAATGCACAGGACAAGTGTAAGAAAGGTGTACG;

[0076] Fra-Ost1-R2:TCTTACACTTGTCCTGAGCAGAAGACACGTTGAAAAAACATAGG;

[0077] Ost1-Bra-F1:ACGTGTCTTCTGCTCAGGACAAGTGTAAGAAAGGTGTACG;

[0078] From-MEL1-R2:ACACTTGTCCTGCCCAAAAACGCCTGGCAAAC;

[0079] MEL1-Bra-F1:GGCGTTTTTGGGCAGGACAAGTGTAAAGAGGTGTA CG;

[0080] From-KR-R2:ACACTTGTCCTGACGCTTGTGCAAGTGGTTTG;

[0081] KR-Bra-F1:TTGCACAAGCGTCAGGACAAAGTGTAAGAAGGTGTAC GA;

[0082] From-INU1-R2:CGTACACCTTCTTACACTTGTCCTGTCTCTTGTAATTGATAACTGAAGCACTGACTC;

[0083] INU1-Bra-F1:GTTATCAATTACAAGAGACAGGACAAGTGTAAAGAAG GTGTACGAA;

[0084] Fra-0030-R2: CTTCTTACACTTGTCCTGGGCAGCAAAAACAGCGGC;

[0085] 0030-Bra-F1:CTGTTTTTGCTGCCCAGGACAAGTGTAAGAAGGTGT ACGA;

[0086] eGFP-Bra-R1:CCGCTGCCGCTACCATACTCACAGTAGTCGCAAATG CATT;

[0087] Fra-eGFP-F2:GTGAGTATGGTAGCGGCAGCGGC.

[0088] (2) The gene fragment obtained above was connected with the plasmid framework obtained in Example 1 by one-step fusion PCR. The connected product was transferred into DH5α competent cells, and then spread on LB plates supplemented with bleomycin after culture. After inverted culture at 37°C overnight, single colonies were picked for colony PCR. The positive colonies were transferred to 2 mL LB (supplemented with bleomycin) and cultured at 37°C for 12 hours. The plasmid was extracted and sequenced.

[0089] (3) The above-mentioned correctly sequenced plasmid was linearized and electroporated into Pichia pastoris X33 competent cells. After culturing, the plasmid was spread on a YPD plate supplemented with bleomycin and cultured at 30°C until a single colony was obtained. A single colony was picked for colony PCR. The positive single colony and the blank control colony were transferred to 2 mL of YPD (supplemented with bleomycin) and cultured overnight.

[0090] (4) 2 mL of the above-cultured seed liquid was inoculated into a 250 mL conical flask containing 25 mL of BMMY medium (Pichia pastoris methanol induction medium). After culturing at 30°C and 220 rpm for 24 h, the fermentation broth was centrifuged (4000 × g, 5 min), the supernatant was discarded, and the cells were resuspended in 10 mL of sterile water. The cells were centrifuged under the same conditions, the supernatant was discarded, and 25 mL of BMGY medium was added to resuspend the cells. The cells were transferred to a 250 mL conical flask and cultured for 5 days at 30°C and 220 rpm for methanol induction. 1% by volume of methanol was added every 24 h.

[0091] (5) The fermentation broth was centrifuged (4000 × g, 5 minutes), 200 μL of the supernatant was collected, and the fluorescence value was detected using a microplate reader. The excitation wavelength of eGFP fluorescent protein was 488 nm, the emission wavelength was 523 nm, and the gain was 50. The results were as follows: Figure 1 shown.

[0092] (6) According to Figure 1The results shown in Figure 1 were obtained by selecting α, OST1, MEL1, ExpL KR, UTH1, ExpL SP, and 0030 signal peptides to construct Brazzein proteins with 6×His tags (α-MF-Braz zein-6×His, ExpL KR-Brazzein-6×His, ExpL SP-Brazzein-6×His, UTH1-Brazzein-6×His, OST1-Brazzein-6×His, MEL1-Brazzein-6×His, and 0030-Brazzein-6×His). Recombinant plasmids and recombinant bacteria were constructed and fermented according to the method of Example 1. The supernatant of the fermentation broth on the 5th day was subjected to SDS-PAGE and Western Blot protein immunoblotting experiments, and the results were shown as follows. Figure 2 and Figure 3 shown.

[0093] (7) After the fermentation broth supernatant passed through a nickel column and a desalting column, the production of brassicin was detected using a BCA kit. The process is as follows: Figure 4 As shown, the ExpL KR-Bra zzein using ExpL KR as the signal peptide had the highest yield, reaching 76.57 mg / L.

[0094] Example 3: Signal peptide structure optimization promotes extracellular secretion expression of brazilin

[0095] (1) Based on the transmembrane secretion ability of the pro segment of the α-MF signal peptide (nucleotide sequence shown in SEQ ID NO. 14) in the signal peptide segment predicted by Signal IP 6.0, the C-terminus of the signal peptide screened in Example 2 was connected to the pro segment of the α-MF signal peptide, and a brasiliensis strain fused with a signal peptide was constructed. The resulting fusion signal peptides were ExpL KR-α, ExpL SP-α, UTH1-α, SUC2-α, SCW10PRO-α, OST1-α, MEL1-α, INU1-α, and 0030-α. Recombinant plasmids and recombinant Pichia pastoris were constructed according to the method described in Example 1, and positive single colonies were obtained.

[0096] (2) Transfer the positive single colony and the blank control colony into 2 mL YPD (added with bleomycin) and culture overnight.

[0097] (3) 2 mL of the above-cultured seed liquid was inoculated into a 250 mL conical flask containing 25 mL of BMMY medium. After culturing at 30°C and 220 rpm for 24 h, the fermentation broth was centrifuged (4000 × g, 5 min), the supernatant was discarded, and the cells were resuspended in 10 mL of sterile water. The cells were centrifuged under the same conditions, the supernatant was discarded, and 25 mL of BMGY medium was added to resuspend the cells. The cells were transferred to a 250 mL conical flask and cultured with methanol at 30°C and 220 rpm for 5 days. 1% by volume of methanol was added every 24 h.

[0098] (4) Take the supernatant of the fermentation broth on the 5th day and perform SDS-PAGE. The results are as follows Figure 5 As shown in Figure 2, by adding dithiothreitol, a single protein band was found, indicating that the protein spontaneously aggregated to form protein dimers during the fermentation process. The yield of other signal peptide fermentation proteins in the same batch is shown in Figure 2. Figure 6 During the screening process, it was found that ExpL SP-α had the highest yield. The strain's brasiliensis production was repeatedly verified and the yield was stable at 450 mg / L. The SDS-PAGE results were shown in Figure 7 As shown, it can be found that after purification, the protein spontaneously aggregated to form polymers due to the high concentration, and the protein loss during the purification process was small.

[0099] Example 4: Protein transport pathway modification promotes the secretory expression of brassinapin

[0100] By connecting GFP fluorescent protein to the C-terminus of brazilian tadalafil, fluorescence localization was performed. Fluorescence localization confirmed that brazilian tadalafil was mainly accumulated in the endoplasmic reticulum in the cell, such as Figure 8 As shown, the protein transport pathway was modified according to the fluorescence localization results, and the yield was increased by co-expressing molecular chaperones, ribosomal proteins, and transcription factors. The shake flask fermentation results of molecular chaperone co-expression are shown in Figure 2. Figure 9 The results of shake flask fermentation of ribosomal proteins and transcription factors co-expression are shown in Figure 10 shown.

[0101] Finally, the treated fermentation broth was subjected to BCA testing. The ribosomal protein synthesis factor Bcy1 had the best effect in increasing the target protein production. After co-expression with the Brazilian sweet protein encoding gene, the shake flask level protein production of the recombinant Pichia pastoris strain reached 1.3g / L.

[0102] The highest yield strain obtained in the above steps was scaled up to a 5-L tank for verification. The fermentation was carried out using basal salt medium (BSM) and trace salt (PTM1) as the bottom tank. After the glycerol in the bottom tank was consumed within 24 hours, glycerol was added until the cell wet weight reached 180 g / L. Methanol was used as the carbon source for induced fermentation. The induced fermentation lasted for 134 hours. The process data are shown in Figure 2. Figure 11The final product was subjected to BCA assay according to the method of Example 2, and the brazilin yield reached 5.215 g / L.

[0103] The fermentation tank steps are as follows:

[0104] (1) Preparation of seed solution: Pick a colony and place it in a test tube containing 2 mL of YPD medium. Incubate overnight at 30°C and 220 rpm.

[0105] The bacterial solution was inoculated into a 500 mL shake flask containing 100 mL YPD medium as seed solution, and cultured at 30°C, 220 r / min for 16-20 h (from 8 am to 8 pm, and the status was observed at all times) until the OD 600 Reach 10 or more;

[0106] (2) Sterilization Preparation: Place the fermentation basal salt medium containing 4% glycerol into the fermentor, and then sterilize the fermentor (sterilization conditions are 121°C, 20 min); (A. Fermentor Sterilization: First, sterilize the air, then add the basal medium and defoamer for sterilization before fermentation; B. Glycerol Bottle: Prepare 400 mL of 50% glycerol in a 500 mL feeding bottle and sterilize; C. Sterilize the 1 L feeding bottle and fill it with methanol)

[0107] (3) After sterilization, install the corresponding pipes while they are still hot and tighten the corresponding bottle caps;

[0108] (4) Glycerol fermentation stage: After sterilization and cooling, set the temperature to 30°C, stir and aerate to operating conditions (usually maximum rpm and 0.1-1.0 vvm air), and adjust the pH of the fermentation basal salt medium to 5.0 with ammonia. Aseptically add 4.35 mL / L PTM1 trace salts to the fermentation basal salt medium;

[0109] Inoculate the fermentor with approximately 5-10% of the initial fermentation volume from the seed culture in the shake flask. Before the seed culture begins to grow, the DO will be close to 100%. As the culture grows, it consumes oxygen, causing the DO to decrease. Ensure the DO is maintained above 20% by adding oxygen as needed.

[0110] Grow the batch culture until the glycerol is completely consumed (18 to 24 hours), as indicated by an increase in DO to 100%. (This step indicates that the glycerol in the bottom tank is completely consumed. This is determined when the DO+agitation linkage speed reaches its maximum. Automatic control is disabled, and the manual speed is set to 1000 rpm. When the DO drops to 0% and then rebounds, rapidly climbing to a peak value (the peak value varies; follow the instrument's display). When the peak value remains constant for about 1 minute, begin adding glycerol. A recommended initial glycerol flow rate is 10 ml / h. After additions are started, the DO will begin to decrease and stabilize. If the DO stabilizes and falls below 20%, stop adding glycerol. Once the DO has climbed to its peak value, reduce the glycerol flow rate and resume adding glycerol. It is recommended that after adding glycerol, you see a decrease in DO, then stop adding glycerol and observe whether the DO recovers within a few minutes or even instantaneously. If so, the glycerol flow rate is sufficient for yeast growth in the tank.) The time required to consume all the glycerol will vary with the density of the initial inoculum.

[0111] Sampling was performed at the end of each fermentation period, at least twice a day, with 6 mL samples taken at each time point and 1 mL aliquots taken from the 6 mL samples. The samples were analyzed for cell growth (OD 600 and wet cell weight), and samples were kept on ice.

[0112] (5) Glycerol fed-batch phase: Start a 50% w / v glycerol feed containing 12 ml of PTM1 trace salts per liter of glycerol feed (trace salts were added in the laminar flow hood after the 50% glycerol was sterilized). Set the feed rate to 18.15 mL / h / L of initial fermentation volume.

[0113] The glycerol feed is run for approximately four hours or longer. At the end of this period, a cell yield of 180 to 220 g / L wet cells should be achieved without significant recombinant protein production.

[0114] If the dissolved oxygen is below 20%, the glycerol or methanol feed should be stopped and the oxygen rate should not be increased until the dissolved oxygen reaches its peak. At this point, adjustments can be made to the agitation, aeration, pressure or oxygen supply.

[0115] (6) Methanol fermentation stage: Before starting the methanol feed, all glycerol needs to be consumed (the sign of complete consumption is that the DO reaches 100%, and the judgment standard is: the DO drops and then maintains for a period of time, and then rises rapidly to 60-70%) to fully induce the transcriptional activity of the promoter PAOX1. It is very important to add methanol slowly to allow the culture to adapt to methanol growth. If methanol is added too quickly, it will kill the cells. Once the strain has adapted to methanol, the state of the fermentation broth can be analyzed by DO and time points can be taken during the methanol induction process to optimize protein expression. Growth on methanol also generates a lot of heat, so temperature control at this stage is very important.

[0116] The glycerol feed was terminated and induction was initiated by starting a 100% methanol feed containing 12 mL of PTM1 trace salts per liter of methanol (trace salts were added to the methanol under sterile conditions). The feed rate was set to 3.6 mL / h per liter of initial fermentation volume;

[0117] During the first 2-3 hours, methanol will accumulate in the fermenter and the dissolved oxygen values ​​will be unstable as the culture adapts to the methanol. Eventually, the DO reading will stabilize and remain constant.

[0118] If DO cannot be maintained above 20%, stop the methanol feed, wait for DO to peak, and then continue at the current methanol feed rate. Increase agitation, aeration, pressure, or oxygen supply to maintain dissolved oxygen above 20%;

[0119] Once the culture is fully adapted to methanol utilization (2-4 hours), and the use of methanol is limited, you will see stable DO readings and a rapid DO peak time (generally under 1 minute). After adaptation, maintain a low methanol feed rate under limited conditions for at least 1 hour, then double the feed. Then double the feed rate to approximately 7.3 mL / h / L of initial fermentation volume.

[0120] After 2 hours at a feed rate of 7.3 mL / h / L, the methanol feed rate was increased to approximately 10.9 mL / h per liter of initial fermentation volume. This feed rate remained constant for the remainder of the fermentation.

[0121] During the methanol fed-batch phase, the cell density can be increased to a final level of 350-450 g / L wet cells.

[0122] Table 2 Composition of PTM1 trace salt solution (filter sterilized)

[0123]

[0124] Table 3 Composition of basal salt medium

[0125] Reagents Dosage <![CDATA[CaSO4]]> 0.93g <![CDATA[K2SO4]]> 18.2g <![CDATA[MgSO4·7H2O]]> 14.9g KOH 4.13g glycerin 40.0g <![CDATA[85%H3PO4]]> 26.7mL <![CDATA[Make up the volume to with ddH2O]]> 1L

[0126] Comparative Example: Effects of different signal peptide combinations on the yield of brasilienin

[0127] Signal IP 6.0 was used to predict the different segments of the signal peptide ExpL SP. Currently, it is known that the signal peptide segments are mainly divided into the following categories: (1) n-region is composed of positively charged amino acids, such as lysine and arginine; (2) hydrophobic region (h-region) is composed of 9 or more hydrophobic core regions composed mainly of neutral amino acids, which can form an L-helical structure, and common ones include leucine and isoleucine; (3) processing region (c-region) is the site where signal peptidase cuts the signal peptide, and is composed of polar, small molecular amino acids (such as glycine, alanine, serine, etc.). It is generally believed that the longer the amino acid sequence in the hydrophobic region and the stronger the hydrophobicity, the higher the protein secretion efficiency. Therefore, the length and hydrophobicity of the hydrophobic region are very important for protein secretion. Based on the predicted signal peptide structure, different segments are fused to it. The specific modifications are as follows:

[0128] AS-1: deletion of the hydrophobic region;

[0129] AS-2: fusion of ExpL SP with the signal peptide BGL2;

[0130] AS-3: fusion of ExpL SP with signal peptide Exg1;

[0131] AS-4: fusion of ExpL SP with signal peptide Dan4;

[0132] AS-5: ExpL SP was mutated, and the fourth serine in the amino acid sequence was mutated to glycine:

[0133] AS-6: ExpL SP was mutated, and the fifth threonine in the amino acid sequence was mutated to alanine;

[0134] AS-7: ExpL SP was mutated, and the asparagine at position 6 of the amino acid sequence was mutated to alanine;

[0135] AS-8: ExpL SP was subjected to combined mutations, with the fourth serine in the amino acid sequence mutated to glycine, the fifth threonine to alanine, and the sixth asparagine to alanine.

[0136] The subsequent shake flask fermentation verification showed that Figure 12 As shown, it was found that brasiliensis was not secreted and expressed, so the signal peptide modification strategy of this comparative example could not increase the yield of brasiliensis in the Pichia pastoris cell factory.

[0137] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will appreciate that other variations or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. A Pichia pastoris producing brasiliensis, characterized in that: In the Pichia pastoris, ExpL SP is used as a signal peptide to heterologously express brazilin having a nucleotide sequence as shown in SEQ ID NO.1, and the nucleotide sequence of the signal peptide is shown in SEQ ID NO.

4.

2. The Pichia pastoris according to claim 1, wherein: The signal peptide and the brazilin were expressed using the AOX1 promoter.

3. The Pichia pastoris according to claim 1, wherein: The Pichia pastoris is Pichia pastoris X33.

4. The Pichia pastoris according to claim 1, wherein: The signal peptide is modified, and the modification is to combine it with the α mating factor to obtain a fusion signal peptide.

5. The Pichia pastoris according to claim 4, wherein: The modification is to connect the Pro region of α mating factor to the C-terminus of the signal peptide ExpL SP.

6. The Pichia pastoris according to claim 1, wherein: The brazilian thaumatin is co-expressed with ribosomal protein synthesis factors.

7. The Pichia pastoris according to claim 6, wherein: The ribosomal protein synthesis factor is protein kinase A regulatory subunit Bcy1.

8. The method for constructing Pichia pastoris according to any one of claims 1 to 7, characterized in that: The following steps are involved: Step S1, constructing a recombinant expression vector that sequentially expresses the signal peptide and brazilin; Step S2: Transform the recombinant expression vector into competent Pichia pastoris to obtain recombinant Pichia pastoris.

9. The construction method according to claim 8, characterized in that: The recombinant expression vector uses pPICZα as a skeleton.

10. A microbial agent comprising the Pichia yeast according to any one of claims 1 to 7.

11. Use of the Pichia pastoris according to any one of claims 1 to 7 or the microbial agent according to claim 8 in the production of brazilian thaumatin.

12. A method for producing brasilien, characterized in that: The Pichia yeast according to any one of claims 1 to 7 or the microbial agent according to claim 8 is added to the fermentation system, and methanol is added to the fermentation system for induction.

13. The method according to claim 12, wherein: The steps include activating the Pichia yeast and inoculating it into a seed culture medium to obtain seed liquid, inoculating the seed liquid into a fermentation culture medium for fermentation, and obtaining brazilian tamarind after purifying the fermentation supernatant.

14. The method according to claim 12, wherein: The fermentation time is 96-134 hours.

15. The method according to claim 12, wherein: The methanol is added 18-24 hours after the start of fermentation, at which time the glycerol in the fermentation system is completely consumed.

Images