Recombinant escherichia coli for synthesizing glucuronic acid by using glucose and application of recombinant escherichia coli
By introducing specific gene modifications into Escherichia coli to construct a recombinant strain and using glucose as raw material to synthesize glucuronic acid, the problems of low product yield and environmental pollution in the existing technology are solved, and efficient and low-cost glucuronic acid production is achieved.
Patent Information
- Application Number
- CN202510904242.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-01
- Publication Date
- 2025-09-23
AI Technical Summary
Existing glucuronic acid production methods, such as polysaccharide hydrolysis and chemical oxidation, have problems such as low product yield and serious environmental pollution, making it difficult to meet industrial needs.
By introducing nucleotide pyrophosphatase LcUPP, upregulated expression of glucose-1-phosphatase yihX and knocking out glucuronic acid isomerase uxaC into Escherichia coli, recombinant Escherichia coli was constructed to synthesize glucuronic acid using glucose as raw material, forming an efficient microbial fermentation production route.
The efficient synthesis of glucuronic acid is achieved, the production cost and industrial difficulty are reduced, and a low-cost and high-efficiency production route is provided.
Smart Images

Figure FT_1 
Figure SMS_1
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of gene editing, gene recombination-edited microbial strains, synthetic biology, and microbial whole-cell catalysis technology, and specifically to a recombinant Escherichia coli that synthesizes glucuronic acid from glucose and its application. Background Art
[0002] Glucuronic acid (D-glucuronic acid; GlcUA) is a natural glucose derivative found in a wide variety of organisms. In the cosmetic and food industries, glucuronic acid is a key intermediate in the synthesis of glucuronolactone. Its aqueous solution is unstable and easily converts to glucuronolactone. In the biopharmaceutical industry, glucuronic acid participates in the metabolism of drugs and harmful substances in the liver, helping the body excrete toxic substances and playing a detoxifying role. Its derivatives are liver detoxifiers and immune regulators, useful as adjunctive treatments for epidemic hepatitis, cirrhosis, food and drug poisoning, rheumatic and rheumatoid arthritis, and other conditions. Furthermore, glucuronic acid is a key precursor for the biosynthesis of ascorbic acid (vitamin C), a widely used food additive in various foods. In the cosmetic industry, glucuronic acid is added to cosmetics to provide anti-inflammatory, anti-aging, and skin-moisturizing benefits. With increasing awareness of health and the desire for improved quality of life, the demand for glucuronic acid is expected to continue to grow.
[0003] The production methods of glucuronic acid at present mainly include polysaccharide hydrolysis and chemical oxidation. Polysaccharide hydrolysis refers to the process of obtaining glucuronic acid by hydrolyzing polysaccharides containing uronic acid. Usually, methods such as alkaline hydrolysis of cotton and cellulose, hot water extraction of holocellulose, and chlorine aqueous solution oxidation of cellulose are adopted to prepare uronic acid. However, in the polysaccharide hydrolysis method, the glycosidic bond connecting uronic acid is generally stable and difficult to hydrolyze. Therefore, it is necessary to use strong acid and alkali to hydrolyze polysaccharides such as cellulose, and the product glucuronic acid is often decomposed under strong acid and alkali conditions, and the product yield is low, which cannot meet production needs. Oxidation method has defects such as poor oxidation selectivity, inability to effectively control the degree of oxidation, difficulty in product separation, low product yield, and serious environmental pollution. Therefore, this area is in the urgent need to develop a new method for efficiently producing glucuronic acid. Summary of the Invention
[0004] The present disclosure provides a recombinant Escherichia coli for synthesizing glucuronic acid using glucose and applications thereof.
[0005] According to an exemplary embodiment of the present disclosure, the present disclosure provides a recombinant Escherichia coli that synthesizes glucuronic acid using glucose, comprising the following modifications:
[0006] Insertion, up-regulation or enhanced expression of the nucleotide pyrophosphatase encoding gene LcUPP;
[0007] Insertion, up-regulation or enhanced expression of the glucose-1-phosphatase encoding gene yihX; and
[0008] Knockout, deletion or inhibited expression of the glucuronide isomerase encoding gene uxaC.
[0009] Optionally or alternatively, the recombinant E. coli further comprises the following modifications:
[0010] Knockout, deletion or inhibited expression of the gene pfkA encoding 6-phosphofructokinase I.
[0011] Optionally or alternatively, the recombinant E. coli further comprises the following modifications:
[0012] Knockout, deletion or inhibited expression of the gene pfkB encoding 6-phosphofructokinase II.
[0013] Optionally or alternatively, the recombinant E. coli further comprises the following modifications:
[0014] Knockout, deletion or inhibitory expression of the glucose-6-phosphate dehydrogenase encoding gene zwf.
[0015] Alternatively or optionally, in the recombinant Escherichia coli, the nucleotide pyrophosphatase encoding gene LcUPP is derived from Lysinibacillus composti, preferably as shown in SEQ ID No. 2;
[0016] The glucose-1-phosphatase encoding gene yihX is shown in SEQ ID No. 4; and
[0017] The glucuronide isomerase encoding gene uxaC is shown in the sequence SEQ ID No.10.
[0018] Alternatively or optionally, in the recombinant Escherichia coli,
[0019] The gene encoding 6-phosphofructokinase I, pfkA, is shown in SEQ ID No.6.
[0020] Alternatively or optionally, in the recombinant Escherichia coli,
[0021] The gene encoding 6-phosphofructokinase II, pfkB, is shown in SEQ ID No. 12.
[0022] Alternatively or optionally, in the recombinant Escherichia coli,
[0023] The glucose-6-phosphate dehydrogenase encoding gene zwf is shown in the sequence SEQ ID No.8.
[0024] According to an exemplary embodiment of the present disclosure, the present disclosure provides use of any of the aforementioned recombinant Escherichia coli in preparing glucuronic acid.
[0025] According to an exemplary embodiment of the present disclosure, the present disclosure provides a method for preparing glucuronic acid using glucose, comprising: subjecting the recombinant Escherichia coli described in any one of the preceding items to arabinose induction culture to obtain induced recombinant bacteria, and using the induced recombinant bacteria to catalyze the glucose reaction to obtain glucuronic acid.
[0026] Alternatively or optionally, in the method, the arabinose induction culture is carried out in a culture medium containing L-arabinose with a final concentration of 0.2 g / 100 mL, the induction culture temperature is 25° C., and the induction culture time is 12-16 hours (such as 12 hours).
[0027] Optionally or alternatively, the method further comprises: using the induced recombinant bacteria to catalyze a glucose reaction at a temperature of 37° C. for a period of 8-25 hours.
[0028] According to at least one aspect of the present disclosure, exogenous genes of glucuronic acid synthesis-related enzymes, namely, nucleotide pyrophosphatase gene and glucose-1-phosphatase gene, are introduced into an Escherichia coli mutant to construct a recombinant Escherichia coli bacterium that synthesizes glucuronic acid using glucose as a raw material. The recombinant bacterium acquires the ability to efficiently synthesize glucuronic acid, thereby obtaining a low-cost, high-efficiency production route for producing glucuronic acid through microbial fermentation, thereby reducing the production cost of glucuronic acid and the difficulty of industrial production. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 This is the liquid phase spectrum of glucuronic acid, inositol, and glucose. Note: The retention time of glucuronic acid is 7.666 minutes, the retention time of glucose is 8.724 minutes, and the retention time of inositol is 9.087 minutes. DETAILED DESCRIPTION
[0030] definition
[0031] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
[0032] Throughout this specification and the appended claims, the words "comprise" and "include" and variations thereof should be interpreted inclusively. That is, these words are intended to convey that other elements or integers not specifically listed may be included, where the context permits.
[0033] The articles "a / an" are used herein to refer to one / a or more than one / more than a (i.e., one / an or at least one / at least one) grammatical object of the article. For example, "an element / an element" can mean one element / an element or more than one element / more than one element. When nouns (e.g., compounds, additives, etc.) are referred to in the singular, the plural is intended to be included. Thus, when referring to a particular part (e.g., "a gene"), this means "at least one" of the gene, e.g., "at least one gene," unless otherwise specified.
[0034] Unless explicitly indicated otherwise, the various embodiments of the invention described herein may be cross-combined.
[0035] The term "cell" refers to a eukaryotic or prokaryotic organism, preferably existing as a single cell. In the present invention, the cell can be a recombinant Escherichia coli. That is, the recombinant cell is selected from a cell population of the genus consisting of Escherichia coli.
[0036] As used herein, the term "transgenic" (e.g., with reference to "transgenic E. coli" and / or "transgenic cells") refers to E. coli and / or cells, respectively, that contain a nucleic acid that is not naturally present in the E. coli and / or cells and that has been introduced into the E. coli and / or cells using, for example, recombinant DNA techniques, such as recombinant yeast and / or cells.
[0037] As used herein, the term "gene" refers to a nucleic acid sequence that can be transcribed into mRNA and then translated into a protein. A gene encoding a protein refers to one or more nucleic acid sequences encoding the protein.
[0038] As used herein, the term "nucleic acid" or "nucleotide" refers to a monomeric unit in a deoxyribonucleotide or ribonucleotide polymer (i.e., a polynucleotide) in a single-stranded or double-stranded form, and unless otherwise limited, encompasses known analogs with the essential properties of natural nucleotides because they hybridize with single-stranded nucleic acids (e.g., peptide nucleic acids) in a manner similar to naturally occurring nucleotides. For example, an enzyme defined by a nucleotide sequence encoding an enzyme includes (unless otherwise limited) a nucleotide sequence that hybridizes with a reference nucleotide sequence encoding the enzyme. A polynucleotide can be the full length or subsequence of a natural or heterologous structure or regulatory gene. Unless otherwise indicated, the term includes reference to a specified sequence and its complementary sequence. Therefore, a DNA or RNA with a modified backbone for stability or other reasons is a term "polynucleotide" as intended herein. In addition, a DNA or RNA comprising rare bases (such as inosine) or modified bases (such as tritylated bases) (to give only two examples) is a term polynucleotide as used herein. It will be understood that a variety of modifications have been made to DNA and RNA for many useful purposes known to those skilled in the art. The term polynucleotide as used herein includes such chemically, enzymatically, or metabolically modified forms of the polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells (especially including simple and complex cells).
[0039] The terms "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein. An example of a nucleic acid sequence is a DNA sequence.
[0040] The term "enzyme" refers to a protein with catalytic function in this article. In the case of a certain biological reaction of protein catalysis, the terms "protein" and "enzyme" can be used interchangeably in this article. When enzymes are mentioned with reference to enzymes (EC), enzymes are such classifications, wherein enzymes are classified or can be classified according to the enzyme nomenclature provided by the International Union of Biochemistry and Molecular Biology Nomenclature Committee (NC-IUBMB), which can be found at http: / / www.chem.qmul.ac.uk / iubmb / enzyme / . It is intended to include other suitable enzymes that have not yet been classified in a given category but can be so classified.
[0041] If a protein or nucleic acid sequence (such as a gene) is referred to herein by reference to an accession number, unless otherwise specified, that number is specifically used to refer to the protein or nucleic acid sequence (gene) having the sequence that can be found via www.ncbi.nlm.nih.gov / (available as of October 1, 2020).
[0042] As used herein, the term "functional homolog" (or simply "homolog") of a polypeptide and / or amino acid sequence or a gene having a specific sequence (e.g., "SEQ ID NO: X") refers to a polypeptide and / or amino acid sequence comprising the specific sequence, or refers to a nucleic acid sequence comprising a polypeptide and / or amino acid sequence encoding the specific sequence, provided that one or more amino acids are mutated, substituted, deleted, added and / or inserted, and the polypeptide has (qualitatively) the same enzymatic function for substrate conversion.
[0043] As used herein, the term "functional homolog" (or simply "homolog") of a polynucleotide and / or nucleic acid sequence having a specific sequence (e.g., "SEQ ID NO: X") refers to a polynucleotide and / or nucleic acid sequence comprising the specific sequence, provided that one or more nucleic acids are mutated, substituted, deleted, added, and / or inserted, and that the polynucleotide encodes a polypeptide sequence having (qualitatively) the same enzymatic function for substrate conversion. With respect to nucleic acid sequences, the term functional homolog is intended to include nucleic acid sequences that differ from another nucleic acid sequence due to the degeneracy of the genetic code and that encode the same polypeptide sequence.
[0044] Variants of the nucleotide or amino acid sequences disclosed herein may also be defined as nucleotide or amino acid sequences having one or more mutations, substitutions, insertions and / or deletions compared to the nucleotide or amino acid sequences specifically disclosed herein (e.g., in the sequence listing).
[0045] The nucleotide sequences of the present invention can also be defined by their ability to hybridize to portions of the specific nucleotide sequences disclosed herein, respectively, under moderate hybridization conditions or, preferably, under stringent hybridization conditions. Stringent hybridization conditions are defined herein as conditions that allow a nucleic acid sequence of at least about 25 nucleotides, preferably about 50, 75, or 100 nucleotides, most preferably about 200 or more nucleotides to hybridize at a temperature of about 65° C. in a solution comprising about 1M salt (preferably 6xSSC or any other solution with comparable ionic strength), and washed at 65° C. in a solution comprising about 0.1M or less salt (preferably 0.2x SSC or any other solution with comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with about 90% or higher sequence identity. Moderate conditions are defined herein as conditions that allow a nucleic acid sequence of at least 50 nucleotides, preferably about 200 or more nucleotides, to hybridize at a temperature of about 45° C. in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength) and washed at room temperature in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with up to 50% sequence identity. One skilled in the art will be able to modify these hybridization conditions to specifically identify sequences with identities varying between 50% and 90%.
[0046] "Expression" refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA), followed by translation into protein.
[0047] "Overexpression" refers to the expression of a gene (corresponding to a nucleic acid sequence) by a recombinant cell in excess of its expression in a corresponding wild-type cell. Such overexpression can be achieved, for example, by increasing the frequency of transcription of one or more nucleic acid sequences, for example by operably linking the nucleic acid sequence to a promoter functional in the recombinant cell; and / or by increasing the copy number of a nucleic acid sequence.
[0048] The terms "upregulate," "enhance," and variations thereof refer to a process by which a cell increases the amount of a cellular component, such as RNA or protein. Such upregulation can be in response to or caused by a genetic modification.
[0049] The term "pathway" or "metabolic pathway" is understood herein as a series of chemical reactions that build and break down molecules in a cell.
[0050] "Native," "homologous," or "endogenous" with respect to a host cell means that the nucleic acid sequence does exist naturally in the genome of the host cell, or that the protein is naturally produced by the cell. The terms "native," "homologous," and "endogenous" are used interchangeably herein.
[0051] As used herein, "heterologous" or "exogenous" can refer to nucleic acid sequences or proteins. For example, with respect to host cells, "heterologous" can refer to polynucleotides that are not naturally present in the genome of the host cell in this way, or polypeptides or proteins that are not naturally produced by the cell in this way. A heterologous nucleic acid sequence is a nucleic acid derived from an alien species, or if from the same species, it is substantially modified in composition and / or genomic locus relative to its native form by deliberate human intervention. For example, a promoter operably linked to a natural structural gene is from a species different from the species from which the structural gene was derived, or if from the same species, one or both are substantially modified relative to their original form. A heterologous protein can be derived from an alien species, or if from the same species, it is substantially modified relative to its original form by deliberate human intervention. In other words, heterologous protein expression relates to the expression of a protein that is not naturally expressed in this way in a host cell. The term "heterologous expression" refers to the expression of heterologous nucleic acids in a host cell. The expression of heterologous proteins in eukaryotic host cell systems (such as Escherichia coli) is well known to those skilled in the art. Polynucleotides containing nucleic acid sequences encoding genes for proteins or enzymes having specific activities can be expressed in such eukaryotic systems. In some embodiments, transformed / transfected cells can be used as expression systems for expressing enzymes. The expression of heterologous proteins in E. coli is well known. Published by Cold Spring Harbor Laboratory, is a recognized work describing various methods for expressing proteins in E. coli.
[0052] As used herein, a "promoter" is a DNA sequence that directs the transcription of a (structural) gene or other (partial) nucleic acid sequence. Suitably, the promoter is located in the 5' region of the gene, near the transcription start site of the (structural) gene. The promoter sequence can be constitutive, inducible or repressible. In one embodiment, no (external) inducer is required.
[0053] "Plasmid" refers to autonomously replicating extrachromosomal DNA that is not integrated into the genome of a microorganism and is typically circular in nature.
[0054] "Host cell" is understood herein to be a cell (such as an E. coli cell) that is transformed with one or more nucleic acid sequences encoding one or more heterologous proteins to create a transformed cell (also referred to as a recombinant cell). For example, a transformed cell can contain a vector and can support replication and / or expression of the vector.
[0055] As used herein, "conversion" refers to that exogenous polynucleotides are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome. As used herein, "conversion" refers to that exogenous polynucleotides (i.e., exogenous nucleic acid sequence) are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome.
[0056] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.
[0057] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0058] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, and instruments used in the following examples are all commercially available unless otherwise specified.
[0059] Unless otherwise specified herein, the nouns and terms used herein should be understood in accordance with the common knowledge and usage of persons of ordinary skill in the art. Unless otherwise noted, the specific operating methods employed in this application (including preparation processes, experimental procedures, detection methods, etc.) employ conventional biochemical experiments, cell biology experiments, molecular biology experiments, gene editing (e.g., recombinant DNA technology), zoology experiments, and related techniques in the art. These techniques are well described in the existing literature, see Sam Brook et al., Molecular Cloning: a Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, 2012; Ausubel et al., Current Protocols in Molecular Biology, Wiley Online Publishing, updated from time to time; Kursad Turksen et al., Embryonic Stem Cell Protocols, 3rd edition, Springer, 2016; P. Nagarajan et al., Essentials of Laboratory Animal Science: Principles and Practices, Springer, 2021; and Jann Hau et al., Handbook of Laboratory Animal Science: Essential Principles and Practices, 4th edition, CRC Press, 2021.
[0060] The quantitative tests in the following examples were all repeated three times, and the results were averaged. In the following examples, for the chromatograms under the same conditions and parameters, the peak in the test sample with the same retention time (±0.1 min) as the standard can be identified as the target peak.
[0061] The E. coli DH5α competent cells in the following examples are products of Beijing Qingke Biotechnology Co., Ltd., with the product catalog number being TSC01.
[0062] The vector pBAD / HisB in the following examples is a product of Invitrogen, with the catalog number being V430-01.
[0063] The glucuronic acid used in the following examples is a product of Aladdin, catalog number G105701.
[0064] The glucose in the following examples is a product of Sigma-Aldrich Company, with the catalog number being G8270.
[0065] The starting E. coli in the following examples can be E. coli BW25113, E. coli MG1655, or E. coli BL21(DE3), or mutants of these strains, such as the MC02 mutant of E. coli MG1655. E. coli BW25113 (CGSC#: 7636), E. coli MG1655 (CGSC#: 6300), and E. coli BL21(DE3) (CGSC#12504) were purchased from the Yale University E. coli Genetic Collection (CGSC). E. coli MC02 is deposited with the China General Microbiological Culture Collection (CGMCC) (CGMCC No. 34378). This biological material was used only for repetition of the experiments described herein and is not intended for use for any other purpose.
[0066] The genotypes of the E. coli mutants in the following examples are shown in Table 1 below.
[0067] Table 1 Escherichia coli mutants and genes in the examples
[0068] strain genotype source G01 MC02 ΔuxaC The present invention is constructed G02 MC02 ΔuxaC ΔpfkA The present invention is constructed G03 MC02 ΔuxaC ΔpfkA ΔpfkB The present invention is constructed G04 MC02 ΔuxaC ΔpfkA ΔpfkB Δzwf The present invention is constructed
[0069] The primer sequences involved in the following examples are shown in Table 2 below.
[0070] Table 2 Primer names and primer nucleotide sequences in the examples
[0071] Primer name Nucleotide sequence (5'-3') P1 aaattcaccaccaaccatcagctg P2 gatggtgatgatggtcagagtgatc P3 ctctatatctttgatttaggtaatgtg P4 gcataacaccttcgcgaaatagtcc pTarget-uxaC-F <![CDATA[ aaactgctggggccggatgt gttttagactagaaatagcaag<!-- 6 --> ]]> pTarget-uxaC-R <![CDATA[ acataaggccccagcagttt actagtattatacctaggactgagct]]> pTarget-pfkA-F <![CDATA[ gaagtaatgggtatttatga gttttatagctagaaatagcaagtta]]> pTarget-pfkA-R tcataaatacccattacttcactagtattatacctaggactgagct pTarget-pfkB-F tttgcgcagcggaaatcagtgttttagagctagaaatagcaag pTarget-pfkB-R actgatttccgctgcgcaaaactagtattatacctaggactgagct pTarget-zwf-F ccactatcttggtaaagaaagttttagagctagaaatagcaagtta pTarget-zwf-R <![CDATA[ tttctttaccaagatagtgg actagtattatacctaggactgagct]]> pTarget-cexu-F cctttgagtgagctgatacc uxaC-up500-F gtaggtgtggctgaagaggaac uxaC-up500-R aggaagacgaaaggtctggggttgatatgcaa uxaC -down500-F aaccccagacctttcgtcttcctctcaacgagtgag uxaC -down500-R caccagtgcgatcatataccaacg pfkA-up500-F tacgcatgggatatgaggcggtac pfkA-up500-R tccgaaatcagactacctctgaactttggaatg pfkA -down500-F cagaggtagtctgatttcggaaaaaggcagattcc pfkA-down500-R gtgactgacgaatcaccacgttatc pfkB-up500-F ataccaggtcatggtggtg pfkB-up500-R ggaatgtttttgcatttcctcctataggctg pfkB -down500-F aggaggaaatgcaaaaacattcccccagcattgg pfkB-down500-R acatgatgtctctcccatgttg zwf-up500-F agaaacgattcaccgtcggttc zwf-up500-R agcgcagatagtcattctccttaagttaactaac zwf-down500-F aggagaatgactatctgcgcttatcctttatgg zwf-down500-R tctggatagtgttcataaggctggtg uxaC-up700-F catcctgctgttggcagatc uxaC-down700-R cacagcacagcaaacattgcataac pfkA-up700-F cgttgggtggtgcggcggacg pfkA-down700-R ctttatcaatccgcccgcgttccg pfkB-up700-R gtcaacacatcgcgctctcgatag pfkB-down700-R aggcacggtgacggttttactac zwf-up700-F tgcctgagtgagcaagtcgac zwf-down700-R tgtcgcacacaccgaggaac
[0072] Example 1. Construction of recombinant vector pG co-expressing LcUPP and yihX
[0073] 1. Obtaining the pUPP gene fragment
[0074] Using the artificially synthesized sequence containing sequence 1 (synthesized by Nanjing GenScript Biotech Co., Ltd.) as a template, PCR amplification was performed using primers P1 and P2 to obtain a PCR product, namely the coding gene sequence of nucleotide pyrophosphatase LcUPP (shown as sequence 2 in the sequence table).
[0075] The PCR product was detected by 1% agarose gel electrophoresis. The PCR product was approximately 600 bp in size, consistent with the target fragment, and was named pUPP. The pUPP gene fragment was recovered from the gel.
[0076] 2. Construction of pBAD / HisB-LcUPP recombinant vector
[0077] After double digesting the pBAD / HisB vector with XhoI and SpeI, the vector fragment (approximately 3500 bp) was recovered. The pUPP gene fragment recovered in step 1 was ligated with the recovered vector fragment using the Gibson method (Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO: Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 2009, 6:343-345.) to obtain a ligation product. The ligation product was transformed into DH5α competent cells and plated on LB plates containing streptomycin. Incubate overnight at 37°C. Single clones were selected, plasmids were extracted, and sequencing was performed to verify the identity of the vector. The vector containing the correct sequence was designated pBAD / HisB-LcUPP.
[0078] 3. pPPase gene fragment
[0079] Using the artificially synthesized sequence containing sequence 4 (synthesized by Nanjing GenScript Biotech Co., Ltd.) as a template, PCR amplification was performed using primers P3 and P4 to obtain the PCR product, namely the gene sequence encoding glucose-1-phosphatase yihX (shown as sequence 4 in the sequence listing).
[0080] The PCR product was detected by 1% agarose gel electrophoresis. The PCR product was approximately 600 bp in size, consistent with the target fragment, and was named pPPase. The pPPase gene fragment was recovered from the gel.
[0081] 4. Construction of pG recombinant vector
[0082] The pBAD / HisB-LcUPP vector obtained in step 2 was double-digested with SpeI and PstI to recover the vector fragment (approximately 4000 bp). The pPPase gene fragment recovered in step 3 was ligated with the recovered vector fragment using the Gibson method to obtain a ligation product. The ligation product was transformed into DH5α competent cells and plated on a solid LB plate containing streptomycin. Incubate overnight at 37°C. Single clones were selected to extract plasmids and verified by sequencing. Vectors containing the correct sequence were designated pG.
[0083] Example 2: Construction of E. coli mutants G01, G02, G03, and G04
[0084] G01, G02, and G03 were constructed using CRISPR technology (Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S: Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 2015, 81:2506-2514.) using Escherichia coli as the starting bacteria. The specific construction steps are as follows:
[0085] 1. Preparation of electroporated competent cells
[0086] The pCas plasmid (Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S: Multigene editing in the Escherichia coli genome via the CRISPRCas9 system. Appl Environ Microbiol 2015, 81: 2506-2514.) was chemically transformed into Escherichia coli MC02. Positive clones were screened by culturing on LB plates containing kanamycin (kanamycin concentration was 50 μg / ml) at 30°C. Positive clones were inoculated into LB liquid medium containing 2 g / L arabinose and cultured at 30°C until the OD reached 0. 600nm When the concentration is about 0.6, prepare electrocompetent cells.
[0087] 2. Construction of pTarget plasmid
[0088] Use the website https: / / crispy.secondarymetabolites.orgThe knockout site N20 was selected, and primers were designed to construct the pTarget plasmid. Using pTargetF (Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S: Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 2015, 81: 2506-2514.) as a template, PCR amplification was performed using primer pairs pTarget-uxaC-F and pTarget-uxaC-R, pTarget-pfkA-F and pTarget-pfkA-R, pTarget-pfkB-F and pTarget-pfkB-R, and pTarget-zwf-F and pTarget-zwf-R, respectively, to obtain fragments of approximately 2100 bp. After approximately 3 hours of digestion with DpnI methylase, the cells were directly transformed into competent E. coli DH5α cells using the chemical transformation method. Positive clones were screened on LB plates containing streptomycin (50 μg / ml) and verified by sequencing using primer pTarget-cexu-F. The correctly sequenced recombinant plasmids were designated pTarget-uxaC, pTarget-pfkA, pTarget-pfkB, and pTarget-zwf.
[0089] 3. Amplify the targeting fragment:
[0090] PCR amplification of the E. coli K12 genome using the primer pairs uxaC-up500-F and uxaC-up500-R, and uxaC-down500-F and uxaC-down500-R, yielded fragments of approximately 500 bp and 500 bp, respectively. PCR amplification of the mixture of the two fragments using the primer pairs uxaC-up500-F and uxaC-down500-R yielded a uxaC targeting fragment of approximately 1000 bp.
[0091] PCR amplification of the E. coli K12 genome using primer pairs pfkA-up500-F and pfkA-up500-R, and pfkA-down500-F and pfkA-down500-R, yielded fragments of approximately 500 bp and 500 bp, respectively. PCR amplification of the pfkA target fragment of approximately 1000 bp was performed using a mixture of the two fragments as a template using primer pairs pfkA-up500-F and pfkA-down500-R.
[0092] PCR amplification of the E. coli K12 genome using primer pairs pfkB-up500-F and pfkB-up500-R, and pfkB-down500-F and pfkB-down500-R, yielded fragments of approximately 500 bp and 500 bp, respectively. PCR amplification of the pfkB-up500-F and pfkB-down500-R primers using a mixture of the two fragments as a template yielded a pfkB targeting fragment of approximately 1000 bp.
[0093] PCR amplification of the E. coli K12 genome using primer pairs zwf-up500-F and zwf-up500-R, and zwf-down500-F and zwf-down500-R, yielded fragments of approximately 500 bp and 500 bp, respectively. PCR amplification of the mixture of the two fragments using primer pairs zwf-up500-F and zwf-down500-R yielded a zwf targeting fragment of approximately 1000 bp.
[0094] The target fragments uxaC, pfkA, pfkB and zwf were recovered. The target fragments comprised a 500 bp upstream homology arm and a 500 bp downstream homology arm from upstream to downstream.
[0095] 4. Electroconversion:
[0096] Mix 200 ng of the pTarget-uxaC plasmid (prepared in Step 2) and 400 ng of the targeting fragment uxaC (prepared in Step 3) with 100 μl of electroporated MC02 cells (prepared in Step 1). Place the cells in a 2 mm electroporation cuvette and electroporate at 2.5 kV. Add 1 ml of LB liquid medium and resuspend at 30°C. Then spread the cells onto LB plates containing kanamycin and streptomycin (50 μg / ml kanamycin and 50 μg / ml streptomycin), incubate at 30°C, and screen for positive clones. PCR amplify the uxaC-up700-F and uxaC-down700-R primers, and verify the amplified fragments by sequencing.
[0097] 5. Eliminate pTarget plasmid:
[0098] Positive clones verified by sequencing were inoculated into LB liquid medium containing 0.1 mM IPTG and kanamycin and cultured overnight at 30°C to eliminate the pTarget plasmid. The overnight culture was then streaked onto solid LB plates containing kanamycin and cultured overnight at 30°C to obtain the E. coli MG1655 mutant MC02 ΔuxaC containing the pCas plasmid.
[0099] 6. Pick a single colony from the plate in step 5 and prepare electrocompetent cells (E. coli MG1655 mutant MC02 ΔuxaC). Mix it with the pTarget-pfkA plasmid (prepared in step 2) and the pfkA targeting fragment (prepared in step 3). Repeat steps 4-5 and verify by sequencing using primers pfkA-up700-F and pfkA-down700-R to obtain E. coli MG1655 mutant MC02 ΔuxaCΔpfkA containing the pCas plasmid.
[0100] 7. Prepare electroporation competent cells of E. coli MG1655 mutant MC02 ΔuxaCΔpfkA containing the pCas plasmid, mix with the pTarget-pfkB plasmid (prepared in step 2) and the pfkB targeting fragment (prepared in step 3), repeat steps 4-5, and sequence and verify with primers pfkB-up700-F and pfkB-down700-R to obtain E. coli mutant MG1655 ΔuxaCΔpfkAΔpfkB containing the pCas plasmid.
[0101] 8. Prepare electroporation competent cells of Escherichia coli MG1655 mutant MC02 ΔuxaCΔpfkAΔpfkB containing the pCas plasmid, mix with the pTarget-zwf plasmid (prepared in step 2) and the zwf targeting fragment (prepared in step 3), repeat steps 4-5, and sequence and verify with primers zwf-up700-F and zwf-down700-R to obtain Escherichia coli MG1655 mutant MC02 ΔuxaCΔpfkAΔpfkBΔzwf containing the pCas plasmid.
[0102] 9. Eliminate pCas plasmid:
[0103] The E. coli MG1655 mutant MC02 ΔuxaCΔpfkAΔpfkBΔzwf, which contained the pCas plasmid and was verified by sequencing, was inoculated into LB liquid medium and cultured overnight at 42°C to eliminate the pCas plasmid. The overnight culture was streaked onto solid LB plates and cultured overnight at 37°C to obtain the E. coli MG1655 mutant MC02 ΔuxaCΔpfkAΔpfkBΔzwf (abbreviated as G04).
[0104] The Escherichia coli MG1655 mutant MC02 ΔuxaC (abbreviated as G01) is a mutant Escherichia coli G01 obtained by knocking out the glucuronide isomerase gene (uxaC gene) in the genome of the mutant Escherichia coli MG1655.
[0105] The Escherichia coli MG1655 mutant MC02 ΔuxaCΔpfkA (abbreviated as G02) is a mutant Escherichia coli G02 obtained by knocking out the glucuronide isomerase gene (uxaC gene) and 6-phosphofructokinase I gene (pfkA gene) in the mutant Escherichia coli MG1655 genome.
[0106] The Escherichia coli MG1655 mutant MC02 ΔuxaCΔpfkAΔpfkB (abbreviated as G03) is a mutant Escherichia coli G03 obtained by knocking out the glucuronide isomerase gene (uxaC gene), 6-phosphofructokinase I gene (pfkA gene) and 6-phosphofructokinase II gene (pfkB gene) in the mutant Escherichia coli MG1655 genome.
[0107] The Escherichia coli MG1655 mutant MC02 ΔuxaCΔpfkAΔpfkBΔzwf (abbreviated as G04) is a mutant Escherichia coli G04 obtained by knocking out the glucuronide isomerase gene (uxaC gene), 6-phosphofructokinase I gene (pfkA gene), 6-phosphofructokinase II gene (pfkB gene) and glucose-6-phosphate dehydrogenase gene (zwf gene) in the mutant Escherichia coli MG1655 genome.
[0108] Example 3. Construction of recombinant E. coli strains GlcA01, GlcA02, GlcA03, GlcA04, and GlcA05
[0109] The expression vector pG constructed in Example 1 was chemically transformed into E. coli MC02 and E. coli mutants G01, G02, G03, and G04. Positive clones were screened on LB plates containing 50 μg / mL of streptomycin to obtain the corresponding recombinant strains. The recombinant strain obtained by transforming E. coli MC02 with the expression vector pG was named GlcA01; the recombinant strain obtained by transforming E. coli mutant G01 with the expression vector pG was named GlcA02; the recombinant strain obtained by transforming E. coli mutant G02 with the expression vector pG was named GlcA03; the recombinant strain obtained by transforming E. coli mutant G03 with the expression vector pG was named GlcA04; and the recombinant strain obtained by transforming E. coli mutant G04 with the expression vector pG was named GlcA05.
[0110] Example 4: Cultivation and Induction of Recombinant Escherichia coli and Whole-cell Catalytic Production of Glucuronic Acid
[0111] 1. Cultivation and induction of recombinant E. coli
[0112] The following experiment was performed simultaneously using any of the five recombinant E. coli strains GlcA01, GlcA02, GlcA03, GlcA04, and GlcA05 obtained in Example 3 as recombinant bacteria: the recombinant bacteria (genetically engineered bacteria producing glucuronic acid) were streaked onto an agar LB plate containing 1.5 g / 100 mL of 50 μg / mL streptomycin and cultured at 37°C for 12 h. A single clone was picked and inoculated into a liquid LB medium containing 50 μg / mL streptomycin, cultured at 37°C with shaking for 10 to 12 h at 220 rpm to obtain an overnight culture; the overnight culture was inoculated into an LB liquid medium at a volume percentage of 1% and cultured at 37°C with shaking at 220 rpm until the OD 600nm After about 1.5 (about 5 h), the inducer (arabinose, final concentration of 2 g / L) was added and cultured with shaking at 25°C for 12 h-16 h to obtain the induced recombinant Escherichia coli.
[0113] 2. Whole cell catalysis produces glucuronic acid
[0114] The recombinant E. coli obtained in step 1 was centrifuged at 4500 rpm for 10 min at 4°C and resuspended in 10 mL of conversion substrate solution (the conversion substrate solution consists of 1× Tris-HCl buffer and glucose. The 1× Tris-HCl buffer is prepared as follows: 50 mL of 0.1M tris (hydroxymethyl)aminomethane (Tris) solution is mixed with 40.3 mL of 0.1N hydrochloric acid and diluted to 100 mL with water. The concentration of glucose in the conversion substrate solution is 50 mM) to a final OD of 0. 600nm The reaction mixture was placed in a 100 mL baffled shake flask and reacted at 37°C and 220 rpm for 12 h to obtain a conversion solution. The conversion solution was diluted 10-fold with distilled water, and the glucuronic acid and residual glucose concentrations were determined by HPLC. The conversion rate was calculated according to the following formula (Formula 1).
[0115]
[0116] Chromatographic conditions: Bio-Rad Aminex HPX-87H Column (300×7.8 mm, 9 μm); mobile phase: 5 mM H2SO4, flow rate: 0.6 mL / min, column temperature 55°C; injection volume 6 μL; differential refractive index detector (RID).
[0117] The glucuronic acid content and conversion rate in the E. coli recombinant bacteria transformation liquid are shown in Table 3.
[0118] Table 3 Glucuronic acid content and conversion rate in the transformation solution of recombinant E. coli
[0119] recombinant bacteria Glucuronic acid production (mM) Conversion rate (%) GlcA01 0 \ GlcA02 0.3mM 12% GlcA03 1.7mM 55% GlcA04 2.3mM 67% GlcA05 4.1mM 90%
[0120] The results showed that GlcA05 had the best glucuronic acid production ability among the five recombinant strains, indicating that the combined trait ΔuxaCΔpfkAΔpfkBΔzwf was beneficial to the production of glucuronic acid and could improve the efficiency of whole-cell catalysis of glucose to produce glucuronic acid.
Claims
1. A recombinant Escherichia coli that synthesizes glucuronic acid from glucose, comprising the following modifications: Insertion, up-regulation or enhanced expression of the nucleotide pyrophosphatase encoding gene LcUPP; Insertion, up-regulation or enhanced expression of the glucose-1-phosphatase encoding gene yihX; and Knockout, deletion or inhibited expression of the glucuronide isomerase encoding gene uxaC.
2. The recombinant Escherichia coli according to claim 1, further comprising the following modifications: Knockout, deletion or inhibited expression of the gene pfkA encoding 6-phosphofructokinase I.
3. The recombinant Escherichia coli according to claim 2, further comprising the following modifications: Knockout, deletion or inhibited expression of the gene pfkB encoding 6-phosphofructokinase II.
4. The recombinant Escherichia coli according to claim 3, further comprising the following modifications: Knockout, deletion or inhibitory expression of the glucose-6-phosphate dehydrogenase encoding gene zwf.
5. The recombinant Escherichia coli according to claim 1, wherein The nucleotide pyrophosphatase encoding gene LcUPP is derived from Lysinibacillus composti, preferably as shown in SEQ ID No. 2; The glucose-1-phosphatase encoding gene yihX is shown in SEQ ID No. 4; and The glucuronide isomerase encoding gene uxaC is shown in the sequence SEQ ID No.
10.
6. The recombinant Escherichia coli according to claim 2, wherein The gene encoding 6-phosphofructokinase I, pfkA, is shown in SEQ ID No.
6.
7. The recombinant Escherichia coli according to claim 3, wherein The gene encoding 6-phosphofructokinase II, pfkB, is shown in SEQ ID No.
12.
8. The recombinant Escherichia coli according to claim 4, wherein The glucose-6-phosphate dehydrogenase encoding gene zwf is shown in the sequence SEQ ID No.
8.
9. Use of the recombinant Escherichia coli according to any one of claims 1 to 8 in the production of glucuronic acid.
10. A method for preparing glucuronic acid from glucose, comprising: The recombinant Escherichia coli according to any one of claims 1 to 8 is cultured with arabinose to obtain an induced recombinant bacterium, and the induced recombinant bacterium is used to catalyze a glucose reaction to obtain glucuronic acid.
11. The method according to claim 10, wherein: The arabinose induction culture is carried out in a culture medium containing L-arabinose with a final concentration of 0.2 g / 100 mL, the induction culture temperature is 25° C., and the induction culture time is 12-16 hours (eg, 12 hours).
12. The method according to claim 11, further comprising: The temperature for catalyzing the glucose reaction by the induced recombinant bacteria is 37° C., and the time is 8-25 hours.
Citation Information
Cited By
Glucose-6-phosphate dehydrogenase mutant and application thereof in production of L-tryptophan
CN121203992A